ID: 1013191756

View in Genome Browser
Species Human (GRCh38)
Location 6:107809704-107809726
Sequence GAACTCAACGTTTCCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013191756_1013191759 -4 Left 1013191756 6:107809704-107809726 CCAGTTTTGGAAACGTTGAGTTC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1013191759 6:107809723-107809745 GTTCAGGATGCCTGTGGAACAGG 0: 1
1: 0
2: 1
3: 20
4: 186
1013191756_1013191761 3 Left 1013191756 6:107809704-107809726 CCAGTTTTGGAAACGTTGAGTTC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1013191761 6:107809730-107809752 ATGCCTGTGGAACAGGTAGGTGG No data
1013191756_1013191758 -10 Left 1013191756 6:107809704-107809726 CCAGTTTTGGAAACGTTGAGTTC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1013191758 6:107809717-107809739 CGTTGAGTTCAGGATGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 135
1013191756_1013191760 0 Left 1013191756 6:107809704-107809726 CCAGTTTTGGAAACGTTGAGTTC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1013191760 6:107809727-107809749 AGGATGCCTGTGGAACAGGTAGG 0: 1
1: 0
2: 0
3: 17
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013191756 Original CRISPR GAACTCAACGTTTCCAAAAC TGG (reversed) Intronic
901168620 1:7237497-7237519 GAAATCAATGCATCCAAAACAGG - Intronic
901236570 1:7670472-7670494 GAACTCCAAGTTTTGAAAACAGG - Intronic
904442969 1:30543702-30543724 GAACTCAATGTTGCCAGAATGGG - Intergenic
904708399 1:32409553-32409575 CAACTCAATGTATTCAAAACAGG - Intergenic
907774277 1:57498175-57498197 GAATTCAACATACCCAAAACAGG - Intronic
910104410 1:83615866-83615888 AAACTCAACGTTTGGAAAATAGG - Intergenic
915241443 1:154525142-154525164 GAACTCACCATTTCCAGCACAGG - Intronic
917063674 1:171068157-171068179 GAACTCAAGGACTCCAGAACAGG + Intergenic
919143633 1:193605668-193605690 GTACTTAACCTTTCCCAAACAGG + Intergenic
920415054 1:205793550-205793572 GAACACAACCTTTCTAAAGCTGG + Intronic
1068707107 10:60089170-60089192 GAACTCAACCTGTCCACAAATGG + Intronic
1068999886 10:63251183-63251205 GAATTCAACATTTACAAAAATGG + Intronic
1071460839 10:85894000-85894022 GAAAACGACGTTTCAAAAACAGG + Intronic
1071616164 10:87078714-87078736 GGACTCAAAGTATACAAAACTGG + Intronic
1072555104 10:96508805-96508827 CAAGTCATCTTTTCCAAAACTGG + Intronic
1074585346 10:114762958-114762980 GAAAACAACGTTAGCAAAACTGG + Intergenic
1078335168 11:10457505-10457527 TAAATCAACCTTTCCCAAACTGG - Intronic
1078659641 11:13277177-13277199 GCACTCAACGTTCCTAAAATTGG + Intronic
1080141058 11:28920742-28920764 GAAGTCAACTTTGCCAAAATTGG - Intergenic
1082890504 11:58133865-58133887 GAACTGAACAATTCCAAAAATGG - Intronic
1086622882 11:88909026-88909048 GGACTCAACGTCTCCAAGAAAGG - Intronic
1092729874 12:11520658-11520680 GAACTCAATGTTTGTAAAACTGG + Intergenic
1094187484 12:27660545-27660567 AAACATAACGTTTCTAAAACAGG - Intronic
1095518869 12:43038078-43038100 AAAATCAACGTGTTCAAAACTGG + Intergenic
1098213634 12:68192733-68192755 AAACTCAACCTTTCCAAGAATGG + Intergenic
1103441507 12:120966232-120966254 GAACCCAACGTCTCCCAACCAGG - Intergenic
1104103984 12:125641732-125641754 GGCCTCACAGTTTCCAAAACTGG + Intronic
1106974118 13:35185893-35185915 GAACTCAATGCTTCCAAACGGGG + Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1111141809 13:84128400-84128422 GAGCTCAAGTTTTCCAATACTGG - Intergenic
1112953228 13:105028472-105028494 GACCTCAACGCTTGCAACACTGG - Intergenic
1114263409 14:21055994-21056016 GAACTCACCTTTTCCACAGCAGG - Intronic
1118992798 14:70810641-70810663 GAAGTCAACGTTGCCACGACAGG - Intergenic
1120277000 14:82388679-82388701 CAAACCACCGTTTCCAAAACTGG - Intergenic
1123852175 15:24370185-24370207 GAACAGAACATTTTCAAAACAGG - Intergenic
1123890957 15:24778468-24778490 GGACTCAACGTTTTCATAAAGGG - Intergenic
1126318974 15:47401485-47401507 GAACTGAAGTTTTACAAAACAGG - Intronic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1133018726 16:2956553-2956575 GAACTCTGAGTTTCCAAATCAGG + Intergenic
1133657643 16:7881548-7881570 GACCTCACCTTCTCCAAAACTGG + Intergenic
1136009836 16:27356392-27356414 GGACTCCACATTTCTAAAACCGG + Intronic
1138134968 16:54513458-54513480 AAACTCAAGCTTTCCAACACTGG - Intergenic
1139613764 16:68076705-68076727 GAACTCACCGTTTCATACACAGG - Exonic
1140597347 16:76431912-76431934 GAACTCAATGTGTCAAAAACAGG - Intronic
1149535338 17:57429282-57429304 AACCCCAAAGTTTCCAAAACCGG - Intronic
1153599965 18:6770811-6770833 GAATTCAAGGTTTCAAACACTGG - Intronic
1155959188 18:31979237-31979259 GAACTCACTGTTTCCAACATCGG + Intergenic
1158861920 18:61600919-61600941 AAAACCAATGTTTCCAAAACTGG - Intergenic
1166499783 19:43332170-43332192 GCTCTCACCGTTTCTAAAACAGG - Intergenic
1167271349 19:48508309-48508331 GAACACACCCTTTCCAAAACAGG + Intronic
1167878434 19:52433925-52433947 GAAATCCACATTTCAAAAACAGG - Intronic
926390788 2:12390462-12390484 AAACTCAGAATTTCCAAAACTGG - Intergenic
930173012 2:48270736-48270758 AAAATAAAAGTTTCCAAAACAGG - Intergenic
938831896 2:135058927-135058949 GAACTCAAAGTTCCTAACACAGG - Intronic
939014730 2:136889180-136889202 GAACTCAATCTTTAAAAAACAGG + Intronic
941150795 2:161913018-161913040 GAAGTCAAAGTATCAAAAACAGG + Intronic
942479452 2:176368390-176368412 CAACTCAATATGTCCAAAACTGG - Intergenic
1170205249 20:13791139-13791161 AAACTCAACATATCTAAAACAGG - Intronic
1170426803 20:16243243-16243265 AAACTCAGCGTTTCCAAACATGG - Intergenic
1176360127 21:5988222-5988244 TAGCTCAATGTTTCCCAAACTGG - Intergenic
1179763391 21:43550328-43550350 TAGCTCAATGTTTCCCAAACTGG + Intronic
1182726824 22:32453885-32453907 GATCTCAATGTTTCCCAGACTGG - Intronic
949363787 3:3258929-3258951 TAACTCAACATTTCCCAAAGTGG - Intergenic
950409074 3:12822973-12822995 GAACTCAAGGTTTTCAAAATAGG - Intronic
955401646 3:58595948-58595970 GTTCTCACCGTTTCCAAATCGGG + Intronic
957413825 3:79874871-79874893 GAACTCACCGATTTAAAAACAGG + Intergenic
967412254 3:189178708-189178730 GAACTCAACTTTTAGAAACCAGG - Intronic
970040014 4:11785986-11786008 AATCTCAACGTTTCCAATCCTGG - Intergenic
971693037 4:29862670-29862692 GAACTCAAGGATTTCAAAAAAGG - Intergenic
973840608 4:54856534-54856556 GATCTCAATGTTTCTGAAACTGG + Intergenic
982583988 4:157214182-157214204 GTACCCAACGGTTACAAAACTGG - Intronic
983287455 4:165757689-165757711 GAAATCACCCTTTCCAAAACAGG - Intergenic
989240831 5:39201818-39201840 GAACTCACTGTTTCCAGAAGAGG + Exonic
991099212 5:62773473-62773495 GAACTCACAGCTTGCAAAACTGG - Intergenic
991508021 5:67344880-67344902 AAACTCAAAGGTTCCAAAACAGG + Intergenic
993184801 5:84603743-84603765 GAATTTAGCATTTCCAAAACAGG + Intergenic
993519731 5:88885512-88885534 AAACTCAACATTTGAAAAACCGG - Intronic
994601468 5:101910803-101910825 GAACTCAGCAATTCCAACACTGG - Intergenic
995253073 5:110016595-110016617 GAACTCAACATGTCCTAAACTGG + Intergenic
1006575394 6:35041594-35041616 GAACACAGCCTTTTCAAAACAGG - Intronic
1008326014 6:50182393-50182415 TGACTCAAGGGTTCCAAAACTGG + Intergenic
1010702084 6:79062924-79062946 GAACACAAAGTGTCCAAAAAGGG - Intronic
1013191756 6:107809704-107809726 GAACTCAACGTTTCCAAAACTGG - Intronic
1016951650 6:149586509-149586531 GAAGTCAATCTTTCCAAAGCTGG - Intronic
1018193231 6:161329779-161329801 GAACCCAAAGTATCCAAGACAGG - Intergenic
1023421373 7:39983633-39983655 GAAATCAACTTTTCCTACACTGG - Intronic
1025776454 7:64564917-64564939 AAACTCAACTTTTCAAAATCAGG - Intergenic
1027129533 7:75581236-75581258 GAACTCAACCTCTTCCAAACAGG - Exonic
1028736199 7:94215451-94215473 GAAATCACTGTTTCCAAGACTGG - Intergenic
1029994562 7:104994603-104994625 GGACTCAACTTTTTAAAAACAGG + Intergenic
1030939673 7:115630479-115630501 AAACTGAACAGTTCCAAAACAGG - Intergenic
1033524598 7:142197714-142197736 GAACTCACAGTTTCCAACACAGG - Intronic
1033764307 7:144471632-144471654 GAACTCAGCATTTCCTTAACTGG + Intronic
1042687506 8:71458767-71458789 AAACTCAACGTGTACAAAATTGG - Intronic
1046293351 8:112191273-112191295 GAATTCAACTTTTCCAAAATTGG + Intergenic
1046559670 8:115819754-115819776 AAACTCAACGTACCCCAAACAGG + Intergenic
1048583905 8:135755302-135755324 GAAGACAATTTTTCCAAAACAGG - Intergenic
1051397725 9:16643902-16643924 GAACTCAAGATTTTTAAAACTGG - Intronic
1052442807 9:28519444-28519466 TAGCTCAGCGTTTCCAAAAAGGG - Intronic
1185859437 X:3564087-3564109 AAAATGAACCTTTCCAAAACAGG + Intergenic
1188523250 X:31061428-31061450 GAACTCAATGATGCCAAAACTGG - Intergenic
1188692804 X:33151016-33151038 GAACTCAAGGTTTTCAACAAGGG + Intronic
1189840133 X:45066743-45066765 GAATCCCACATTTCCAAAACAGG - Intronic
1190961627 X:55255468-55255490 GAACATAACATTTCCAATACTGG - Intronic
1193215538 X:78859368-78859390 GAAGTCACCATTTCCAAAACAGG - Intergenic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1196857626 X:119999171-119999193 CAACAAAACATTTCCAAAACAGG + Intergenic
1198138509 X:133779383-133779405 GAACACAACCTTTCCAATCCTGG + Intronic