ID: 1013202541

View in Genome Browser
Species Human (GRCh38)
Location 6:107913775-107913797
Sequence AAAATATATGAGAGTATAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 608}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013202541 Original CRISPR AAAATATATGAGAGTATAAG GGG (reversed) Intronic
900011811 1:119084-119106 AAAATTAATGAAAGGATAAGAGG + Intergenic
900027915 1:295654-295676 AAAATTAATGAAAGGATAAGAGG + Intergenic
900041870 1:475095-475117 AAAATTAATGAAAGGATAAGAGG + Intergenic
900063308 1:710073-710095 AAAATTAATGAAAGGATAAGAGG + Intergenic
902140025 1:14345726-14345748 AGAATACATGAGTGAATAAGTGG + Intergenic
904718651 1:32489118-32489140 AAAATTTGCGAGAGTATAAGGGG - Exonic
905001459 1:34673413-34673435 AATATGTATGAAAGAATAAGGGG - Intergenic
907022733 1:51085284-51085306 AAGATATATGAGAATACAAATGG - Intergenic
907916999 1:58880378-58880400 AAAATCTATGAGAAAAAAAGTGG - Intergenic
907971712 1:59389243-59389265 AAAGTAGATTAGAGTTTAAGAGG - Intronic
908587931 1:65594324-65594346 AAGAGATATGAGAGTATTAAGGG + Intronic
908613261 1:65886851-65886873 AAAATAAATAAGTGTATAAAAGG - Intronic
908936257 1:69380419-69380441 AAATTATTTGAGAGAATAAAGGG - Intergenic
909193654 1:72588071-72588093 AACATATATGAGTATATTAGAGG + Intergenic
909292762 1:73904671-73904693 AAAATATCTAAGAGTGTAACCGG + Intergenic
909505186 1:76380071-76380093 AAAATAAATGAGAGGATATTAGG + Intronic
909553337 1:76924614-76924636 TACATATATGAAAGTATATGAGG - Intronic
910212632 1:84809102-84809124 AAGATATATGAAAGAAAAAGGGG - Intergenic
910290188 1:85593011-85593033 AAAATAACTAAGAGTATAATTGG + Intergenic
910721975 1:90296217-90296239 AAAATCTATGGCAATATAAGAGG + Intergenic
910991211 1:93058503-93058525 AAAATAATTAAGAGTATAATTGG + Intergenic
911035719 1:93544495-93544517 AAAATATATCAAAGTATAAGAGG - Intronic
911315207 1:96348436-96348458 AAAAAATATCTGTGTATAAGTGG - Intergenic
911593384 1:99773133-99773155 ACAATATATTAGAGTAAATGTGG - Intergenic
911989052 1:104668281-104668303 AAAATATATTAAAGAATAATGGG - Intergenic
912091321 1:106080507-106080529 AAAACATATGAGATTTTATGTGG - Intergenic
912311256 1:108623508-108623530 AAAAAATAAAAGAGTATAATTGG + Intronic
912317217 1:108676912-108676934 AAAATAATTAAGAGTATAAATGG + Intergenic
912327003 1:108775434-108775456 AAAATAACTAAGAGTATAATTGG - Intronic
912424043 1:109570513-109570535 AAAATATAACACAGAATAAGGGG + Intronic
912605925 1:110988527-110988549 AAAATGTGTGAGAGTAAAACTGG + Intergenic
912857730 1:113186251-113186273 AAAATAAATCAGTGTATCAGAGG + Intergenic
914254729 1:145952545-145952567 AAAATATACGAATGTCTAAGTGG + Intronic
915045637 1:153012446-153012468 AAAAAATAAGAGACTATAAAAGG - Intergenic
915415813 1:155742006-155742028 AAAATATATATGTGAATAAGTGG - Intergenic
916294163 1:163198482-163198504 TAAATATATAAAAGTATATGAGG - Intronic
916420053 1:164628864-164628886 AAAATATGTGACGGTGTAAGGGG - Intronic
916974198 1:170057526-170057548 AAAATATCTGAATGTATATGTGG - Intronic
916996672 1:170308883-170308905 AAAAAATATGAGACTTTCAGAGG - Intergenic
917136253 1:171790817-171790839 GAAATATGTTAGAGTCTAAGTGG + Intronic
917890182 1:179429243-179429265 AAAGCATTTGAGAGTATAAAGGG + Intronic
918279295 1:182987692-182987714 CAAATTTATGAGAAAATAAGTGG - Intergenic
918398542 1:184140754-184140776 AAAATGTAATAAAGTATAAGAGG + Intergenic
918515668 1:185359880-185359902 AAAATAACTAAGAGTATAACTGG - Intergenic
918539349 1:185611986-185612008 AAAATAACTGAGAGTATAATTGG - Intergenic
918748955 1:188245874-188245896 AAAATTTAGGAGATGATAAGAGG + Intergenic
918828940 1:189366183-189366205 AAAATAAATAAGAGTTTAACTGG + Intergenic
918855193 1:189744853-189744875 AATATATATGTGAGTATATATGG - Intergenic
918870014 1:189959033-189959055 AAGATAAATGACAGTATAAGAGG + Intergenic
919019844 1:192091237-192091259 AAAAAATATCAGACTATAAAAGG - Intergenic
919121021 1:193340248-193340270 TAAATAAATGAGGGAATAAGTGG - Intergenic
919135290 1:193500235-193500257 AGAGTGGATGAGAGTATAAGTGG - Intergenic
919247680 1:195009691-195009713 AAAATATATGCGTGCATATGTGG + Intergenic
919295669 1:195696900-195696922 AAAATATATTAATGTATAAAAGG + Intergenic
919348395 1:196416779-196416801 AAAATAACTAAGAGTATAATTGG - Intronic
919356529 1:196531086-196531108 AAAAGTTATGAGAATATTAGAGG - Intronic
919596336 1:199567995-199568017 AAAATATCTGATAGTGTAAAAGG + Intergenic
921083566 1:211765523-211765545 AAACTATATTAGAAAATAAGAGG + Intronic
921479474 1:215647508-215647530 AAAAAGAATGTGAGTATAAGTGG - Exonic
921757606 1:218878424-218878446 ATAATATATAAGAATATTAGTGG + Intergenic
923055553 1:230424265-230424287 AAAATATAGGACAGTATAAAAGG + Intronic
923588061 1:235293251-235293273 AAAAAATAAGAGAGGAAAAGTGG - Intronic
923937372 1:238778152-238778174 AAAATATTTGAGATGATACGAGG - Intergenic
924503866 1:244662617-244662639 AATATATATGAGATAGTAAGTGG + Intronic
1063202778 10:3801125-3801147 AAAATATACGAGAGCTGAAGGGG - Intergenic
1064052957 10:12073945-12073967 AAAATAAAGGAGAATATCAGAGG - Intronic
1064505785 10:16028337-16028359 AAAATGTCTGAGAGTAAAAAAGG + Intergenic
1064651422 10:17513724-17513746 AAAATATATGTGATTTCAAGTGG - Intergenic
1064672288 10:17728457-17728479 AAAATCTATTAGAATCTAAGTGG - Intergenic
1066234489 10:33471948-33471970 AAAATAACTAAGAGTATAATTGG - Intergenic
1066328306 10:34389087-34389109 AAAATATAGGAGACTAGAAGAGG - Intronic
1066580561 10:36875954-36875976 AGAGTATAAGAGAGAATAAGAGG + Intergenic
1066636411 10:37506331-37506353 AAAATCTATGAGTTTATAAATGG - Intergenic
1066649539 10:37641408-37641430 AAAATAACTAAGAGTATAATTGG - Intergenic
1067032430 10:42886957-42886979 AAAATAACTAAGAGTATAATTGG - Intergenic
1067148571 10:43711254-43711276 AAAATAAATGAAAGTGGAAGAGG + Intergenic
1067214441 10:44290119-44290141 AAATTATAAAAGATTATAAGAGG + Intergenic
1067359595 10:45566284-45566306 AAAATAACTTAGAGTATAATTGG - Intronic
1067694617 10:48525775-48525797 AAAATATATGGGAGGAAAACAGG + Intronic
1068195229 10:53707344-53707366 AAAATACATGAAAGGTTAAGTGG - Intergenic
1068479300 10:57569392-57569414 AAAATATAACAGATCATAAGAGG + Intergenic
1068597274 10:58916677-58916699 AAAAAATATAAAAGTATATGTGG + Intergenic
1069006979 10:63328343-63328365 AAAAAATTTGAGAGGATTAGGGG + Intronic
1069074475 10:64023973-64023995 GAAAAATATCAGAGTATACGTGG + Intergenic
1071024325 10:81093759-81093781 AAAATAAGTGAAAGAATAAGGGG - Intergenic
1071226433 10:83535244-83535266 AAAATATATGAGAGAAAGAGAGG + Intergenic
1071637405 10:87269541-87269563 AAAATAACTAAGAGTATAATGGG + Intergenic
1071657839 10:87468410-87468432 AAAATAACTAAGAGTATAATGGG - Intergenic
1071775456 10:88782087-88782109 AAAATAACTAAGAGTATAATTGG + Intergenic
1072346093 10:94508229-94508251 AAAAAAAGAGAGAGTATAAGAGG - Intronic
1072863423 10:99031123-99031145 AAAATAACTAAGAGTATAATAGG + Intronic
1074169923 10:110921684-110921706 AAAATAACTAAGAGTATAATTGG - Intronic
1074338474 10:112602512-112602534 AAACTATTTTAGAGTTTAAGAGG - Intronic
1074620696 10:115117206-115117228 AAAATAACTGAGAGTATAATTGG - Intronic
1074949354 10:118314439-118314461 AAAATATCTGAAAATATAAAAGG + Intronic
1076968142 11:111324-111346 AAAATTAATGAAAGGATAAGAGG + Intergenic
1078650495 11:13186340-13186362 AAAATTTATTAGAGGATAGGAGG + Intergenic
1078769891 11:14339782-14339804 AAAATGTATATGATTATAAGGGG - Intronic
1078907444 11:15700771-15700793 AAAGTATATGAGAGTATGTGTGG - Intergenic
1079010188 11:16821726-16821748 AAAAAATCTGGGACTATAAGAGG + Intronic
1079167610 11:18060867-18060889 AAAACCTATAAGAGTATAATTGG - Intergenic
1079276115 11:19039490-19039512 AACATATGTGAGACTATCAGTGG + Intergenic
1079801717 11:24877597-24877619 AAAATAACTAAGAGTATAATTGG - Intronic
1080548328 11:33344365-33344387 GAAATATACCACAGTATAAGTGG - Intronic
1081305303 11:41504507-41504529 AAAAAATGTGAGAGGAGAAGGGG - Intergenic
1082088920 11:48072945-48072967 AAAATAGATAATAGTATAAATGG + Intronic
1082231436 11:49772554-49772576 TAAATAAATGAGAGTATGTGGGG + Intergenic
1082310612 11:50642795-50642817 AAAATATGTGAAAGTATATGTGG + Intergenic
1082926297 11:58550972-58550994 AAAATATCTTAAAATATAAGGGG + Intronic
1085467603 11:76734830-76734852 AAATTCTATTAGAGTAAAAGTGG + Intergenic
1086352892 11:85960845-85960867 AAAATGTATGAAAGAAGAAGTGG + Intronic
1086570102 11:88273287-88273309 AAAATAACTCAGAGTATAACTGG + Intergenic
1086752545 11:90515672-90515694 AAAATAACTCAGAGTATAATTGG + Intergenic
1087394458 11:97579782-97579804 ACAAATTATGAGAGTATTAGAGG - Intergenic
1087694409 11:101359823-101359845 TAAAAATAAGAGAGTATAATTGG + Intergenic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1089792015 11:120952440-120952462 AAAAGATGTGAGTGTCTAAGAGG + Intronic
1090126193 11:124087398-124087420 AAATTATATGAGAGAACTAGTGG + Intergenic
1091096112 11:132823643-132823665 AAAAAATATGAGACGATAAATGG - Intronic
1091099922 11:132862494-132862516 AAAAACTCTGAGAGTACAAGAGG + Intronic
1091847790 12:3670626-3670648 AAAATAGAAGAGACTAAAAGAGG + Intronic
1093528002 12:20125847-20125869 TAAATAAATGAGAGTAAATGAGG + Intergenic
1093746475 12:22747737-22747759 AAAATGTATGAGAGGAATAGTGG + Intergenic
1094457173 12:30648909-30648931 AAAATATGTAATAATATAAGGGG - Intronic
1094559908 12:31542492-31542514 AAAATAATTAAGAGTATAACTGG + Intronic
1095071168 12:37849838-37849860 AAAATATTTGGGAGTATACCAGG - Intergenic
1095324825 12:40876530-40876552 AAAATATCTGAGAATAAAGGTGG - Intronic
1096040695 12:48513850-48513872 AAAATAACTAAGAGTATAATTGG - Intronic
1096260905 12:50090742-50090764 TAAATATATTAGACTAAAAGTGG + Intronic
1096791242 12:54046646-54046668 TAAATAAATGAGAGAATAAGTGG + Intronic
1097736412 12:63186565-63186587 AGAGTATATGTGAGTATATGAGG - Intergenic
1097930517 12:65179258-65179280 AAAACATATATGAGTATAAAGGG - Intronic
1098734692 12:74084549-74084571 AAAAAAAATCTGAGTATAAGTGG + Intergenic
1099389119 12:82057190-82057212 AAAATATATAACAGGTTAAGGGG - Intergenic
1099541248 12:83910698-83910720 ACAAAATATGAGAGGATAATAGG - Intergenic
1099609688 12:84851837-84851859 AAAATAACTAAGAGTATAATTGG - Intergenic
1099714710 12:86276424-86276446 AAAATATGAAAGAGTATAATTGG - Intronic
1099893561 12:88618032-88618054 TAAATATATGAAAGAATAAATGG + Intergenic
1101009263 12:100432060-100432082 GAAATATATGTGTGTATAAGTGG - Intergenic
1101298753 12:103455627-103455649 AAAATCGATGAAAGTAGAAGAGG - Intronic
1102032297 12:109747831-109747853 AAATCATATGATAGTATAACTGG - Intronic
1102913129 12:116733872-116733894 AAAAAATATAAGAGTAAAAATGG - Intronic
1103055162 12:117814082-117814104 AAAGTAGATGAGAGGATAACAGG + Intronic
1103202050 12:119095759-119095781 AAAATATAGGAAAGGATAAGTGG - Intronic
1104318609 12:127727895-127727917 AAAATAACTGACAGTATATGAGG + Intergenic
1105340487 13:19519021-19519043 AAAATTCATGAAAGTATAAGGGG - Intronic
1105870560 13:24502327-24502349 AAAATAAATAAAATTATAAGCGG - Intronic
1105982075 13:25527687-25527709 GAAATATAAGAGGGTAGAAGTGG - Intronic
1106271737 13:28160741-28160763 TAAATGGATGAGAGTTTAAGAGG + Intronic
1107056792 13:36114121-36114143 AAAATATATTAAATTAGAAGAGG + Intronic
1107201070 13:37718072-37718094 AAAATATATGACAGTATTCAGGG + Intronic
1108255349 13:48604425-48604447 AAAATAACTAAGAGTATAATTGG - Intergenic
1108635051 13:52325148-52325170 AACATTCATGAAAGTATAAGGGG - Intergenic
1108652752 13:52498044-52498066 AACATTCATGAAAGTATAAGGGG + Intergenic
1108853334 13:54762757-54762779 AAAATATATGATAGTTAAAAAGG + Intergenic
1108888369 13:55220325-55220347 AAAATATCTGACAATATATGGGG - Intergenic
1108964526 13:56281031-56281053 TTAACATATGAAAGTATAAGGGG + Intergenic
1110412358 13:75218437-75218459 AAAATAGATGAAGGTATAACTGG + Intergenic
1110740088 13:78984628-78984650 AAACTATTTAAGATTATAAGTGG - Intergenic
1111006446 13:82255861-82255883 AAAATATACGGGATTATAAAGGG + Intergenic
1111103547 13:83616012-83616034 GAAAAATATGAAAGTATAATAGG + Intergenic
1111108679 13:83678595-83678617 AAAATATATTTCAGTAAAAGAGG - Intergenic
1111216858 13:85154754-85154776 AAAATATCAGAGATTATTAGGGG - Intergenic
1111418830 13:87983419-87983441 AAAATACATTATAGTATATGTGG - Intergenic
1111629998 13:90838291-90838313 AAAATAACTGAAAGTATAATTGG - Intergenic
1111764390 13:92509460-92509482 AAAAGATAAGAAAATATAAGAGG - Intronic
1111772549 13:92616567-92616589 AAAATATATTATAGTAAAATAGG - Intronic
1111824677 13:93252616-93252638 AGAAAATATAAGAGTAGAAGTGG - Intronic
1111864645 13:93753591-93753613 AAAATAACTGAAAGTATAACTGG - Intronic
1112334255 13:98501023-98501045 AAATGAAATGAGAATATAAGGGG + Intronic
1112383621 13:98917609-98917631 AAAATACATGAAAGTATATTTGG - Intronic
1112718883 13:102219088-102219110 AAAATAACTAAGAGTATAATTGG - Intronic
1112844221 13:103618078-103618100 AAAGTAGATGACAGTGTAAGAGG - Intergenic
1113293955 13:108937709-108937731 AAAATCAATCAGAGTATCAGAGG - Intronic
1113298828 13:108993757-108993779 AGAATATATGACAATATATGTGG + Intronic
1114846923 14:26333441-26333463 AAAATATAAAAGACGATAAGGGG - Intergenic
1115458187 14:33629594-33629616 AGAATATATGAGAGTCTAGAGGG - Intronic
1115796933 14:36948037-36948059 AAAATATATGGCATTATAAGGGG + Intronic
1116345541 14:43788066-43788088 AAAATATATGTGCAAATAAGAGG - Intergenic
1116350134 14:43851081-43851103 AAAATATATTAGAATAAAACTGG + Intergenic
1116363485 14:44030709-44030731 AAAATTTCTGAGAGTGAAAGGGG + Intergenic
1116367091 14:44080937-44080959 GAAAAAGAAGAGAGTATAAGTGG - Intergenic
1116558844 14:46350102-46350124 AAAATATTTGAGAATAGAAAAGG - Intergenic
1116883235 14:50192981-50193003 AAAAAAGGTGAGAGAATAAGAGG - Intronic
1117606422 14:57433344-57433366 AAAATAACTAAGAGTATAATTGG - Intergenic
1118198120 14:63647206-63647228 AATATATATGAGTGTATGTGTGG - Intergenic
1120047422 14:79823662-79823684 AAAATATAGAAGAGTATACTAGG + Intronic
1120147078 14:80990354-80990376 AAAAGATATGAGACGATATGGGG - Intronic
1120369858 14:83619631-83619653 AAAATGTATGAAAATATAATTGG - Intergenic
1120561578 14:86000638-86000660 AAAAGATATAAGAGGAAAAGAGG - Intergenic
1120870813 14:89335928-89335950 AAAATGACTGAGAGTTTAAGAGG + Intronic
1121177606 14:91902815-91902837 AATATTTAAGAGAGTCTAAGAGG + Intronic
1121200922 14:92117164-92117186 ATAATATATGACAATATATGTGG + Intronic
1121597588 14:95177497-95177519 AAAATAACTGAAAGTATAATTGG - Intergenic
1121966888 14:98316850-98316872 AAAATAAATGAAAATAAAAGAGG - Intergenic
1124174753 15:27413853-27413875 AAAATATTTGAGAGAAAAATAGG - Intronic
1124858237 15:33411699-33411721 AAAATTTATGAGGGTATCTGAGG + Intronic
1125363919 15:38893300-38893322 AAAAAATAAGACAGGATAAGGGG + Intergenic
1125384782 15:39125727-39125749 AAAATATAGGAGAGTGTTAATGG + Intergenic
1125707977 15:41758077-41758099 GAAATTTATGAGAATATATGTGG + Intronic
1126120838 15:45249942-45249964 AAAATATATAAGATTACAAAAGG - Intergenic
1126748352 15:51850043-51850065 AGAATATTTGAGACAATAAGAGG + Intronic
1126874500 15:53025433-53025455 AAAATAACTGAGAGTATAATTGG - Intergenic
1127427261 15:58868593-58868615 AAAGTATATGGGAGTACAGGGGG + Intronic
1127565605 15:60185119-60185141 AGAAAATAAGAGAGGATAAGGGG + Intergenic
1128918087 15:71585438-71585460 AAACTCCATGAGATTATAAGTGG - Intronic
1128954038 15:71920531-71920553 GAAATATATTACAGTGTAAGAGG - Intronic
1129501791 15:76045917-76045939 AAAATAACTAAGAGTATAATTGG + Intronic
1130558685 15:84942288-84942310 AAAATAACTAAGAGTATAATTGG - Intronic
1131487197 15:92831056-92831078 AAAGTTTAGGAAAGTATAAGAGG + Intergenic
1132168825 15:99626269-99626291 GAAATAAATGAGACTGTAAGAGG - Intronic
1132191991 15:99872572-99872594 AAAATATATTATAGTAAAATAGG + Intergenic
1133726570 16:8542925-8542947 AATATATAGGAGATGATAAGCGG - Intergenic
1135014778 16:18916114-18916136 AAAATTTATGTATGTATAAGTGG - Intronic
1135331999 16:21568244-21568266 AAACTATATGATAGAAGAAGAGG - Intergenic
1135772215 16:25226229-25226251 AAAATAACGAAGAGTATAAGTGG - Intronic
1137435656 16:48452620-48452642 AAAATAAAAGAGAGAATAACTGG - Intergenic
1137946743 16:52740095-52740117 AAAATAACTAAGAGTATAATTGG + Intergenic
1138026526 16:53526550-53526572 AAAAAATATCTGTGTATAAGTGG + Intergenic
1138956189 16:61973079-61973101 GAAAAAAATCAGAGTATAAGTGG - Intronic
1139028422 16:62848508-62848530 AAAATAAATGAAACTATAAAAGG + Intergenic
1140106244 16:71962820-71962842 AAAATAAAGGAAAGTATTAGAGG - Intronic
1140511384 16:75511032-75511054 AAAAAATAAAAGAATATAAGGGG + Intergenic
1140983259 16:80131591-80131613 AACATATATGAGTTGATAAGAGG + Intergenic
1141433749 16:83985720-83985742 AAAATAAATGAGAACATAACAGG - Intronic
1142452536 16:90187822-90187844 AAAATTAATGAAAGGATAAGAGG - Intergenic
1143069911 17:4282965-4282987 TAAATATTTGAGATTATAAAGGG - Intronic
1143415616 17:6746876-6746898 TAAATAAATAAGAGTATAATTGG + Intergenic
1143677761 17:8448751-8448773 AAAAAAAATCAGAGTATAAGTGG - Intronic
1144445135 17:15320300-15320322 AAAATAAATGACAGAAAAAGTGG - Intronic
1144934940 17:18890122-18890144 AAAATAAAAGAAAGTGTAAGTGG - Intronic
1147518665 17:41147037-41147059 AAAACATATGAGAGGATAAAAGG + Intergenic
1149411894 17:56417201-56417223 AAAATAACTAAGAGTATAATTGG + Intronic
1149874627 17:60219216-60219238 AAAAAAGATGATAGTATAAGAGG + Intronic
1150037511 17:61819865-61819887 AAAATAACTAAGAGTATAATTGG + Intronic
1150088416 17:62296467-62296489 AAAAAAGATGATAGTATAAAAGG + Intergenic
1150186796 17:63190531-63190553 AAATTATATGGAAATATAAGGGG - Intronic
1150547647 17:66177584-66177606 AAAATAACTAAGAGTATAATTGG - Intronic
1151442206 17:74137129-74137151 AAAATATATGAAAATCTATGAGG + Intergenic
1151750781 17:76036399-76036421 TAAATAAATAAAAGTATAAGGGG + Intergenic
1152428387 17:80232077-80232099 AAAATATATGAAACAATAACTGG - Intronic
1154056614 18:11018800-11018822 AAAAGATATGTGGGTATGAGTGG - Intronic
1154990791 18:21596291-21596313 ATAATTTTTAAGAGTATAAGGGG + Intronic
1155531686 18:26773555-26773577 AAAACATATGAAAGAATAAAAGG - Intergenic
1155761887 18:29578090-29578112 AAAATATATTATAATAAAAGTGG + Intergenic
1156106063 18:33662680-33662702 AAAATAGATGATTGTATCAGAGG - Intronic
1157087399 18:44595605-44595627 CAAAGATTTGAGAGTATACGTGG + Intergenic
1157418930 18:47528877-47528899 CACATGTATGAGAGTTTAAGAGG + Intergenic
1157729337 18:49990215-49990237 GAAGTGTATGAGAGGATAAGAGG - Intronic
1158071091 18:53471310-53471332 AAAATAACTAAGAGTATAATTGG - Intronic
1158735473 18:60074765-60074787 AAAATATATAACAATATAGGGGG + Intergenic
1158864517 18:61625215-61625237 TAAAAATATGTGAATATAAGTGG + Intergenic
1158896171 18:61915581-61915603 AAAATCTATGGGAGTAACAGAGG + Intergenic
1158919158 18:62169995-62170017 GCAATATATGAGAGTTTCAGTGG + Intronic
1159028483 18:63208058-63208080 AAAATCTATCAGAGAAGAAGAGG - Intronic
1159173180 18:64799300-64799322 AAAATAACTTAGAGTATAATTGG - Intergenic
1159477971 18:68948812-68948834 CAAGTATATGAGAGAATAAGTGG - Intronic
1159516637 18:69467463-69467485 ATAATATATGAAAATATGAGTGG + Intronic
1160545635 18:79651439-79651461 AAAATATTTGAAAGATTAAGAGG + Intergenic
1160644951 19:180937-180959 AAAATTAATGAAAGGATAAGAGG + Intergenic
1163858649 19:19727437-19727459 AAAATATTTTAGAATATAAAAGG + Intronic
1165001871 19:32770397-32770419 AATATATATAAGAGTAAAAAAGG - Intronic
1165103260 19:33452646-33452668 AAAATATATGAGAATAAAATTGG + Intronic
1166039790 19:40194883-40194905 AAAATTTCAGAGAGTATCAGGGG + Intronic
1166261340 19:41643789-41643811 AAAAAATATGAGAATATATGAGG - Intronic
926278166 2:11421748-11421770 AAAATTCATGAAAGTACAAGAGG + Intergenic
926392261 2:12405475-12405497 AAAATATATGAGACACTATGTGG - Intergenic
926603616 2:14874324-14874346 AAAACATAAGAGATTACAAGAGG + Intergenic
926930657 2:18036640-18036662 AAAATATATAAGACAATAAGAGG - Intronic
927325306 2:21798603-21798625 AAAAGATATGAAAGAATATGGGG + Intergenic
927760308 2:25747012-25747034 AAAATATATGGGAAGATATGTGG - Intronic
928722514 2:34136434-34136456 AAAATATGTTACAGTACAAGGGG + Intergenic
928737004 2:34303195-34303217 AAAATTTATGAGAGTTTCATTGG - Intergenic
928758044 2:34549003-34549025 GAAAAATATGAGAGTATTAAAGG - Intergenic
928785935 2:34886228-34886250 AGAATATATAAGAATATAAAAGG - Intergenic
929707885 2:44234688-44234710 ACAATTTGTAAGAGTATAAGTGG - Intronic
929834875 2:45386228-45386250 AAGAAAAATGAGAGTATAAGGGG - Intergenic
929973301 2:46604842-46604864 AAAATAACTAAGAGTATAATTGG + Intronic
930347116 2:50197529-50197551 AAAATATAATAGTGTAAAAGGGG - Intronic
930820739 2:55643786-55643808 AAAATAGATGTGAGAATAGGAGG + Intronic
931160667 2:59686836-59686858 AAAGTTTATGAGAGCATAACTGG - Intergenic
931604213 2:64035801-64035823 AAAATAGAAAAGAGTATAAAGGG + Intergenic
931682736 2:64765916-64765938 AAAATAACTAAGAGTATAATTGG + Intergenic
932949371 2:76274728-76274750 GAAATATATGAGAGGAAAAAAGG - Intergenic
933442880 2:82335564-82335586 AAAATATATTAGTCTATAAAAGG + Intergenic
934999168 2:98994965-98994987 AAAATAGATGAGTGTATTTGAGG + Intergenic
935464314 2:103378124-103378146 GAAAGATAAGAGAGAATAAGAGG - Intergenic
935662315 2:105477681-105477703 AAAATATTTGTGGGTAGAAGAGG - Intergenic
935848517 2:107193532-107193554 AAAATATATTGAAGTATACGAGG + Intergenic
936460226 2:112708768-112708790 AAAATATATAAAATTATAAACGG - Intergenic
936468716 2:112777787-112777809 AAAATATAACAGAGAGTAAGAGG - Intronic
936714830 2:115174021-115174043 AAAATTGATGAGAATGTAAGTGG + Intronic
937372557 2:121310840-121310862 AAATTATAAGAGAGTACTAGAGG + Intergenic
938076686 2:128342535-128342557 AAAAGAAATGAGGGTATCAGGGG - Intergenic
939145008 2:138402949-138402971 AAAATAACTAAGAGTATAATTGG + Intergenic
939186381 2:138865899-138865921 AAAATATATGCCATTATAAAAGG + Intergenic
939205796 2:139101918-139101940 AAAATAAATGAGAGAAGAAAAGG - Intergenic
939341539 2:140901573-140901595 AAAATAACTAAGAGTATAATTGG - Intronic
939360569 2:141166539-141166561 AAAATAACTAAGAGTATAAATGG - Intronic
939370627 2:141295217-141295239 TAAATTTATGATAATATAAGGGG - Intronic
939598185 2:144154112-144154134 GAAATATAAAAGAATATAAGTGG + Intronic
939733096 2:145809741-145809763 AAAATATACAAGAGTTTAAAAGG - Intergenic
939849661 2:147289521-147289543 AAAATATCTGAGTCTATTAGGGG + Intergenic
939870768 2:147523657-147523679 AAAATATTGGAGGATATAAGAGG - Intergenic
939948818 2:148443879-148443901 AAAATAACTGAAAGTATAATTGG + Intronic
940808758 2:158219078-158219100 AAATTATATGTGAGTCTGAGGGG + Intronic
941527166 2:166620559-166620581 AAAATAAATAAAAGTATAATTGG - Intergenic
942342170 2:174960135-174960157 AAAAAACATGAGAGTGTAACAGG + Intronic
942796626 2:179828289-179828311 AAACTATATAATAGGATAAGAGG + Intronic
943181738 2:184552791-184552813 AAAATATATGTGACTATTTGTGG - Intergenic
943218353 2:185069752-185069774 AAACTGTAACAGAGTATAAGAGG - Intergenic
944080494 2:195782899-195782921 AAAATAGATGAGATTTAAAGGGG - Intronic
944279360 2:197877296-197877318 AAAATAAATGAAAGTTCAAGTGG + Intronic
944503540 2:200386219-200386241 AAAATAATTGAGAGTAAAATGGG + Intronic
944615946 2:201460392-201460414 AAAATAACTGAAAGTATAATTGG - Intronic
944814639 2:203363306-203363328 AAAATAACTGAGAGTATAGTTGG - Intronic
944843741 2:203648035-203648057 ATAATATCTGAGAGTATAGAAGG + Intergenic
945336941 2:208603600-208603622 AAAATAACTAAGAGTATAATTGG + Intronic
945451132 2:209997250-209997272 AAAACATAAAAGAGTAAAAGAGG - Exonic
945462334 2:210123655-210123677 AAAATAATTAAGAGTATAATTGG + Intronic
945521810 2:210836617-210836639 AAAATATATCACAGTATTTGAGG - Intergenic
945705070 2:213220424-213220446 AAAAAAAATGTGTGTATAAGTGG + Intergenic
946093775 2:217253951-217253973 AAAATATAAGAAAGGAAAAGAGG + Intergenic
948085841 2:235246582-235246604 AAAGAATATGAGAGTGAAAGAGG + Intergenic
948162167 2:235833913-235833935 AAAATATGTGAGATAATTAGTGG - Intronic
948358634 2:237401676-237401698 AAAAAAAATTACAGTATAAGTGG - Intronic
948914093 2:241021776-241021798 AGTATATATGGTAGTATAAGTGG + Intronic
1169168546 20:3444704-3444726 TAACTAAATGAAAGTATAAGAGG + Intergenic
1169241062 20:3981325-3981347 CAAATAAAAGAGAATATAAGTGG - Intronic
1169621603 20:7513131-7513153 AACACATATGAGATCATAAGTGG + Intergenic
1169822283 20:9724882-9724904 AAAATAACTAAGAGTATAACTGG + Intronic
1170628980 20:18052244-18052266 AAAATGTATGAAATTAAAAGAGG + Intronic
1170665197 20:18380731-18380753 AAAATTTATGATTGTATATGTGG + Intergenic
1170958365 20:21002433-21002455 AAAATAACTAAGAGTATAATTGG - Intergenic
1171945632 20:31374940-31374962 AAAAAATATGCGAGTCTAATAGG - Intergenic
1172377748 20:34459176-34459198 AGAATAAATGTGACTATAAGAGG - Intronic
1175013832 20:55766833-55766855 AAAACATATAAGAATATAGGAGG + Intergenic
1177213495 21:18099219-18099241 AAAATAACTAAGAGTATAATTGG + Intronic
1177261103 21:18731682-18731704 AAAATAACTGAAAGTATAATTGG - Intergenic
1177405228 21:20658312-20658334 AAAACATCTCAGAGTATAAAGGG - Intergenic
1177457591 21:21362285-21362307 AAATTATATGAGACTATTAAAGG - Intronic
1177974760 21:27833873-27833895 TAAATGTATGAAAGAATAAGTGG - Intergenic
1179159716 21:38884305-38884327 CAAATATATAAGAGTAAAGGGGG - Intergenic
1180561394 22:16617543-16617565 AAAATTCATGAAAGTATAAGGGG + Intergenic
1180924266 22:19542855-19542877 CAAGTATATGAAAATATAAGAGG - Intergenic
1181848328 22:25731174-25731196 AAAATAACTAAGAGTATAATGGG - Intergenic
1183534264 22:38387465-38387487 AAAATTCATGAAAGTATAAGGGG - Intronic
1184625236 22:45722255-45722277 AAAATATAAAAGAATACAAGTGG - Intronic
949179277 3:1107899-1107921 AAATTATTTAAGAGTATAACTGG + Intronic
951019675 3:17768606-17768628 AAAGTAACTGAGAGTATAATTGG + Intronic
951102760 3:18708446-18708468 AAAATAACTCAGAGTATAATTGG + Intergenic
951141739 3:19169951-19169973 AAAATAAATGAGATAATACGTGG - Intronic
951150281 3:19280687-19280709 GCAATGTATGAGAGTTTAAGTGG + Intronic
952088045 3:29850469-29850491 AAAAAATATCAGAGTCTCAGTGG - Intronic
952619150 3:35315037-35315059 AAAATATATGAGAGTTCATGTGG - Intergenic
952648110 3:35686912-35686934 AAAATAAATAAGAATAAAAGTGG + Intronic
953549322 3:43888960-43888982 AAAATAACTAAGAGTATGAGTGG + Intergenic
953718885 3:45338342-45338364 AAAACATATGACAGTATTATGGG + Intergenic
955086025 3:55703670-55703692 AAAGTATATGAGTGTAAAAATGG + Intronic
955226015 3:57060947-57060969 ACAATAAAAAAGAGTATAAGAGG - Intronic
955361057 3:58275319-58275341 AAAAAAAAAAAGAGTATAAGGGG - Intronic
955361105 3:58275631-58275653 AAAATAAAAAAGAGGATAAGGGG - Intronic
955757120 3:62236487-62236509 AAAATAAATGGGATTATTAGCGG + Intronic
955796399 3:62641828-62641850 AATTTAGCTGAGAGTATAAGAGG + Intronic
955959408 3:64324118-64324140 AAAAAATATGAGAAAATAAATGG + Intronic
956398787 3:68854040-68854062 AAAATAAATGAAAATATAATAGG + Intronic
956967363 3:74477676-74477698 AAAATAACTGAGAGTGTAATTGG + Intronic
957170795 3:76734309-76734331 AACACATTTGAGAGTAAAAGGGG + Intronic
957369723 3:79277605-79277627 AAAATAATTAAGAGTATAATTGG + Intronic
957380557 3:79423220-79423242 AAAATAGATGAGATTAAAATGGG + Intronic
958008237 3:87841480-87841502 CAAATATATGAAAGTGCAAGGGG + Intergenic
958100668 3:89005410-89005432 AAAATAACTAAGAGTATAATTGG - Intergenic
958659998 3:97054456-97054478 AAAATAAATGGGAGTAGTAGAGG - Intronic
958729213 3:97942990-97943012 ATAATACATGATTGTATAAGTGG - Exonic
959444557 3:106422509-106422531 AAAAAAAATCAGTGTATAAGTGG - Intergenic
960254141 3:115493094-115493116 ACAATACAAGAAAGTATAAGTGG + Intergenic
960260221 3:115559039-115559061 AAAAAATATGAGAGGAAAATGGG + Intergenic
960362672 3:116733705-116733727 AGATTATATGAGATTATAGGAGG - Intronic
960550754 3:118973654-118973676 AAAATATAACAGAAAATAAGTGG + Intronic
962321852 3:134396920-134396942 AAAATATAAGAGAGAAAAAGAGG - Intergenic
962784649 3:138756244-138756266 AAATTATAGGAGAGTATATATGG + Intronic
962972981 3:140422158-140422180 AGAAAATATGAGAATATAAGAGG - Intronic
963361912 3:144284925-144284947 AAAATAACTAAGAGTATAATTGG - Intergenic
963495596 3:146056330-146056352 AAAATAACTAAGAGTATAATTGG + Intergenic
964672563 3:159242744-159242766 AAAATATAGGAGACTATATTTGG + Intronic
964999210 3:162930847-162930869 AAAATATCTTAGTATATAAGGGG - Intergenic
965270363 3:166609361-166609383 TTAACATATGTGAGTATAAGAGG + Intergenic
965647107 3:170895759-170895781 CAAATATTTGAGGGTCTAAGAGG - Intronic
966023423 3:175244307-175244329 AAAATAAATTAGTGTAAAAGAGG - Intronic
966069625 3:175859941-175859963 AAAATATAAAACAGTGTAAGGGG + Intergenic
966718154 3:183034727-183034749 AAAACATAAAAGAGTAAAAGAGG - Intronic
967778537 3:193410172-193410194 AAAATATAAGAGAGTTTATGAGG + Intronic
969047942 4:4351711-4351733 AAATTATATGAGTTTATAAAAGG - Intronic
969951618 4:10842710-10842732 AGTATATATGAGAGTACTAGTGG - Intergenic
970228787 4:13887371-13887393 AATATATATGAATGTATAACTGG + Intergenic
970416270 4:15860640-15860662 ACAACATATGACAGTTTAAGTGG + Intergenic
970443087 4:16101304-16101326 AAAATAACTAAGAGTATAATTGG + Intergenic
971711709 4:30121432-30121454 AAAAGTTATGAAAGTATAAGAGG - Intergenic
971731334 4:30385820-30385842 AAAAGATAAGAGTGCATAAGAGG + Intergenic
971939945 4:33201149-33201171 AATATATGTGAGATTAAAAGTGG + Intergenic
971944649 4:33257851-33257873 AAAATAACTGAGAGTACAAAAGG + Intergenic
972082321 4:35168485-35168507 ACTATATGTGAGAGTACAAGTGG - Intergenic
972829286 4:42795390-42795412 AAAATCTATAAGATTATAAATGG - Intergenic
973215492 4:47664712-47664734 AAAAAGTATGATAGTATAAAAGG - Intronic
973288477 4:48446031-48446053 AAAATAACTAAGAGTATAATTGG - Intergenic
973570389 4:52233195-52233217 AAAATATATGAAAGTAGACTAGG + Intergenic
973608707 4:52612868-52612890 AAAACATATAAAAGGATAAGTGG - Intronic
973762107 4:54127202-54127224 AAAATATCTAAGAGTGTAATTGG - Intronic
974135131 4:57806597-57806619 AAAGTATATGAGCCTATAACTGG + Intergenic
974408191 4:61503926-61503948 AAAATAGATGAGAATTTAAGTGG - Intronic
974789394 4:66667637-66667659 AAAATACAATAAAGTATAAGGGG - Intergenic
974802789 4:66840324-66840346 AAAATTTATGAGATTATAATGGG - Intergenic
975208835 4:71675689-71675711 AAAATAAAAGAGAGTAGCAGTGG - Intergenic
975237758 4:72020160-72020182 ATAAAATATGAAAGAATAAGAGG - Intergenic
976477026 4:85495904-85495926 AAAATATGTGATACTATAAAAGG - Intronic
977402466 4:96549931-96549953 AATACACATGAGAATATAAGAGG + Intergenic
977737019 4:100428815-100428837 AAAATACAACAGAGTATGAGAGG + Intronic
977925433 4:102695206-102695228 AGACTGTATGAGAATATAAGAGG - Intronic
978094117 4:104753924-104753946 AAAATAATTAAGAGTATAATTGG - Intergenic
978162566 4:105566567-105566589 AATATCTAAGAGAGTATAACTGG - Intronic
978572071 4:110148617-110148639 AAAATAACTAAGAGTATAATTGG + Intronic
978624423 4:110668362-110668384 AAATTATATGATTGTAAAAGTGG + Intergenic
978674536 4:111295238-111295260 AAAATAACTAAGAGTATAATTGG + Intergenic
979034921 4:115703587-115703609 AGAATAAAGGAGAGTATAATTGG - Intergenic
979370037 4:119874263-119874285 AAAATATATGTAAGTATCAAAGG - Intergenic
979589237 4:122459569-122459591 AAAAAAGATGAGATTATGAGGGG - Intergenic
979804954 4:124960101-124960123 AAAATAGAAGAGAGAATAAGGGG + Intergenic
981307417 4:143261456-143261478 AAAATATAACAGAGTTTAAATGG + Intergenic
982364083 4:154556324-154556346 AATATTGATGAGAGTATAAATGG + Intergenic
982416778 4:155142763-155142785 AAAATATATGAAGGGGTAAGAGG - Intergenic
982451580 4:155558794-155558816 AAAATAAATTACAGTATAATTGG - Intergenic
982873790 4:160618671-160618693 GAAATATATGAATTTATAAGTGG + Intergenic
983138995 4:164124917-164124939 AAAATAACTTAGAGTATAATCGG + Intronic
983506213 4:168556466-168556488 AAAATATATGTGAATGGAAGAGG - Intronic
983530813 4:168808176-168808198 AATATATATAAGAATATAAGGGG + Intronic
983809994 4:172050065-172050087 AAAATGAAGGAGAGTAAAAGTGG - Intronic
983813437 4:172093255-172093277 AAAATTTAAGAGACTATAAAAGG - Intronic
984726897 4:183030242-183030264 AAAATAACTGAAAGTATAATTGG - Intergenic
986931450 5:12827647-12827669 AAATTAAATGAAAGAATAAGTGG + Intergenic
987427325 5:17788060-17788082 AAATTATCTGAGGGTAAAAGGGG + Intergenic
987590514 5:19919661-19919683 AAAATATTAAATAGTATAAGTGG - Intronic
988060564 5:26162846-26162868 AAAACATATGAGTGTAAAAGAGG - Intergenic
988350340 5:30096880-30096902 AAAATACATAAAAGTATCAGAGG - Intergenic
988898557 5:35705441-35705463 GAGATGTATGAGAGTAAAAGAGG - Intronic
989380122 5:40802209-40802231 AAAATGTATTGGAATATAAGTGG + Intergenic
990061492 5:51655381-51655403 AAATTATTGGAGAATATAAGAGG + Intergenic
990213552 5:53506828-53506850 AAAATAGCTAAGAGTATAACTGG - Intergenic
991130975 5:63122061-63122083 AAAATATTTGAGAGCAGGAGAGG - Intergenic
992850507 5:80802581-80802603 AAAATAACTAAGAGTATAACTGG - Intronic
994082293 5:95720347-95720369 AAAATATTTGAGATTATGATGGG + Intronic
994259387 5:97638988-97639010 TAAATATATGACATTATAACAGG - Intergenic
994848988 5:105028481-105028503 AAAATACATGAGATTAAAAAAGG - Intergenic
994891468 5:105640810-105640832 AAAATTTATGAGATTAAAATAGG + Intergenic
995511291 5:112912449-112912471 AAAATATATATGGGTATAAATGG - Intronic
996239972 5:121185689-121185711 CAAATATTTGAGAATATAATAGG - Intergenic
996317752 5:122179745-122179767 AAAAGATTTGAGTGCATAAGGGG + Intergenic
996445329 5:123542315-123542337 AAAATATATGACAACATAAATGG - Intronic
996773534 5:127110044-127110066 ATAATATATGATAGTATATTAGG - Intergenic
996916393 5:128716848-128716870 AAAGTGTATGAAAGTGTAAGAGG - Intronic
997349306 5:133218978-133219000 AGAATAAATGAGTGTAAAAGGGG + Intronic
998036269 5:138919607-138919629 CAAATGTATGAGAGTATAAGAGG + Intronic
1000867633 5:166534697-166534719 AAAATAAGTAAGAGTATAACTGG - Intergenic
1002731973 5:181343834-181343856 AAAATTAATGAAAGGATAAGAGG - Intergenic
1002752558 6:130271-130293 AAAATTAATGAAAGGATAAGAGG + Intergenic
1002883765 6:1275620-1275642 AAAAAATATGAGAGGACAAGTGG - Intergenic
1003993334 6:11511000-11511022 AAAATATTTGAGAAAATAATTGG + Intergenic
1004003438 6:11617658-11617680 AATATATATAAGTGTATACGTGG - Intergenic
1004774078 6:18822968-18822990 AAAATAACTAAGAGTATAATTGG - Intergenic
1005197646 6:23308005-23308027 AAAGTAAATAAGAGTATAATTGG + Intergenic
1005491680 6:26353206-26353228 AAAATAACTAAGAGTATAATTGG - Intergenic
1005779358 6:29172368-29172390 AATTTATCAGAGAGTATAAGAGG + Intergenic
1006214942 6:32432944-32432966 AAAATAGAAGAGAATATAAGTGG - Intergenic
1006487739 6:34357665-34357687 AAAATATACGAAAGTATAAATGG - Intronic
1007804888 6:44435091-44435113 AAGATATATGGGAGTATGTGGGG - Intronic
1007874520 6:45080908-45080930 AAAATAACTAAGAGTATAAATGG + Intronic
1008042704 6:46818822-46818844 AAAATTTATTAAAGTATAAAAGG + Intronic
1009232765 6:61084253-61084275 AAAATAACTTAGAGTGTAAGTGG - Intergenic
1009798930 6:68508030-68508052 AAAATATAGGAGAATATTTGGGG + Intergenic
1009957505 6:70473564-70473586 GAAATATATTAAAGGATAAGGGG - Intronic
1010182501 6:73103844-73103866 AAAATAATTAAGAGTATAATTGG + Intronic
1010865370 6:80970085-80970107 AAAAAATATGAGCTTATAAATGG + Intergenic
1011521463 6:88211286-88211308 TAAAAATATGAGATAATAAGAGG - Intergenic
1011945766 6:92900783-92900805 AAAATATTTGAGAGTACAGCAGG + Intergenic
1011977857 6:93328443-93328465 ACAATATATGAGAGTTTTAAGGG + Intronic
1012131078 6:95494099-95494121 AAAAAAAATGAGAATATGAGAGG + Intergenic
1012876528 6:104735325-104735347 AAATTATATGAAAGTAAAAATGG + Intronic
1012892841 6:104916605-104916627 AAAATAACTAAGAGTATAATTGG + Intergenic
1012972996 6:105751578-105751600 AAAATAACTAAGAGTATAATTGG - Intergenic
1013202541 6:107913775-107913797 AAAATATATGAGAGTATAAGGGG - Intronic
1013536585 6:111068036-111068058 AAAATATGTGAGGGTGTCAGTGG + Intergenic
1013849344 6:114495239-114495261 AAAATATAAGAAAGTAAGAGAGG + Intergenic
1014527159 6:122514589-122514611 AATATTTATCAGAATATAAGAGG + Intronic
1014699443 6:124665459-124665481 CAAATATATGGGAGCAGAAGGGG + Intronic
1014727194 6:124985449-124985471 AAAATAACTAAGAGTATAATTGG - Intronic
1014729505 6:125016078-125016100 AGAAGAAATGAGAATATAAGGGG + Intronic
1014822597 6:126008577-126008599 GAAATAAATCTGAGTATAAGTGG - Intronic
1015124088 6:129733119-129733141 AAAATATATATGAGAAAAAGTGG + Intergenic
1015183276 6:130383815-130383837 AAATTATATGAGAAAAGAAGAGG + Intronic
1015434937 6:133174253-133174275 AAAATATCTGACAGTATCAATGG - Intergenic
1015484356 6:133751565-133751587 AAAATATATGTAATTAAAAGAGG + Intergenic
1015704571 6:136073784-136073806 CACATGTATCAGAGTATAAGTGG + Intronic
1015749497 6:136545914-136545936 AAAATATCTAAGAGTGTAATTGG - Intronic
1016502644 6:144739212-144739234 AAAATATATGAGATTTTACAGGG - Intronic
1016555853 6:145337158-145337180 AAAATATATGAGAGAACAATAGG + Intergenic
1017090305 6:150753333-150753355 AAAATATTTTAAAGTATAAAGGG - Intronic
1017096253 6:150808049-150808071 AAAATAACTGAAAGTATAATTGG + Intronic
1017798513 6:157869923-157869945 AAAGTGTATGAGAGCATGAGAGG - Intronic
1018021427 6:159764849-159764871 TGAATAAATGAGAGTTTAAGAGG + Intronic
1018164906 6:161084160-161084182 AAACTAAATGATAGGATAAGAGG - Intronic
1018275563 6:162126782-162126804 AAAATGAATTAGAGTAAAAGAGG - Intronic
1018375929 6:163212587-163212609 AAAATAAATGATAGTAAAATGGG + Intronic
1019236224 6:170616151-170616173 AAAATTAATGAAAGGATAAGAGG - Intergenic
1020477875 7:8620287-8620309 TAAATATATATGAGTATCAGAGG - Intronic
1021294743 7:18890838-18890860 AAAATAGATGAAAGGATAGGTGG + Intronic
1021412973 7:20349017-20349039 AAAATATATCACAGTAGAAGTGG - Intronic
1021818364 7:24471832-24471854 AAAATATTTGAGTGTATCTGGGG - Intergenic
1022868467 7:34448274-34448296 AAAATATATGTGAGAACACGTGG + Intergenic
1023329011 7:39093223-39093245 AAACTATTTGAAAATATAAGGGG + Intronic
1023463317 7:40425088-40425110 GAAATATATTACAGTGTAAGTGG + Intronic
1023896485 7:44437790-44437812 TAAATCTATCAGAGTATTAGTGG - Intronic
1024132654 7:46371158-46371180 AAAAACTAACAGAGTATAAGTGG - Intergenic
1024489933 7:49969724-49969746 AAAATATATGAGAATCTAGTTGG + Intronic
1024618651 7:51137985-51138007 AAAACAAATGATAGTATAACTGG - Intronic
1024750427 7:52458873-52458895 GAATTATAAGAGAGTAAAAGGGG + Intergenic
1024761428 7:52601387-52601409 AAAATATTTGAAATTATAATTGG - Intergenic
1025764589 7:64430963-64430985 AATATATCTAAGAGTATAATTGG + Intergenic
1026449042 7:70511195-70511217 AAAAAATTTAAGAGTATAAAGGG + Intronic
1027497547 7:78907061-78907083 AAAACATTTGAGAGTAGAGGTGG + Intronic
1027535680 7:79397886-79397908 AAACTATATGATAAAATAAGTGG - Intronic
1027769091 7:82383978-82384000 AAAATATGTGAGTCTATATGAGG + Intronic
1027933139 7:84565978-84566000 AAAAAATATGAGAAATTAAGTGG - Intergenic
1027973844 7:85122813-85122835 AAAATATAAGGGTTTATAAGAGG + Intronic
1028025119 7:85827781-85827803 AAAACATAAAAGAGTATAACTGG - Intergenic
1030378187 7:108778500-108778522 AAAAAAAATGAAAATATAAGAGG + Intergenic
1030389814 7:108913456-108913478 AAAATAACTAAGAGTATAATCGG - Intergenic
1030901204 7:115126320-115126342 AAAATATATGAAAAAATAACTGG - Intergenic
1030908596 7:115217437-115217459 AAAATATATTAAACTACAAGGGG + Intergenic
1031009374 7:116509629-116509651 AAAAAAAATCTGAGTATAAGTGG - Intergenic
1031250571 7:119375112-119375134 TGAATATATGAGAGTATACATGG + Intergenic
1031351098 7:120731920-120731942 AAAATATTTGAGAGAGGAAGAGG + Intronic
1031773941 7:125883281-125883303 AAATTATATTAAAGTATAAAAGG - Intergenic
1032969468 7:137143371-137143393 AAAATAACTAAGAGTATAATTGG + Intergenic
1033074732 7:138237907-138237929 AAAATATTTCAGAGAATAAAAGG + Intergenic
1034738332 7:153450047-153450069 AAAAAATGTGAGAGTTTAAAGGG + Intergenic
1035362686 7:158323774-158323796 AGACTATATGAGAATAGAAGTGG - Intronic
1035511546 8:190450-190472 AAAATTAATGAAAGGATAAGAGG + Intergenic
1036222591 8:6933223-6933245 AAAATATAGGAGACTATGATGGG - Intergenic
1036596021 8:10213042-10213064 AAAATAACTAAGAGTATAATTGG - Intronic
1036983301 8:13495849-13495871 AAAATAAAAGAGCTTATAAGGGG - Intronic
1037276943 8:17190857-17190879 AAAATAACTAAGAGTATAATAGG - Intronic
1037638589 8:20722458-20722480 AAGGTAAATGAGAGAATAAGGGG + Intergenic
1038203700 8:25442680-25442702 AAACTAAATGAGTGTATAAAGGG + Intronic
1038297660 8:26310475-26310497 AACATATATGAGAAGATAAATGG + Intronic
1038871050 8:31493412-31493434 AAAATATATTGGAATATGAGCGG + Intergenic
1040117680 8:43642828-43642850 AGAATATATGAAAGTATATATGG + Intergenic
1040902414 8:52430380-52430402 GAAATAAATGAGATTACAAGTGG - Intronic
1041339978 8:56834660-56834682 AATATATATGAGAATTTATGTGG + Intergenic
1041353490 8:56974068-56974090 CAAATATATGATTGAATAAGAGG - Intronic
1041408242 8:57525573-57525595 AAAATATATGTGAATCTAAAAGG + Intergenic
1041598651 8:59688868-59688890 AAAATATATGAAAATATATAAGG - Intergenic
1041778197 8:61547816-61547838 ATAATTTTTAAGAGTATAAGAGG + Intronic
1042063405 8:64846408-64846430 TTAACATATTAGAGTATAAGTGG - Intergenic
1043093837 8:75939336-75939358 TAAATATATGAGTGTATTATGGG + Intergenic
1043391237 8:79794429-79794451 AACATTTATGAGGATATAAGAGG - Intergenic
1043424930 8:80139075-80139097 CAAATAGATGAGAGTGGAAGTGG - Intronic
1043632197 8:82349665-82349687 AAAATATAATAGAGTTTAAAAGG - Intergenic
1043814786 8:84788857-84788879 AAAATATCTGAGCCTTTAAGTGG + Intronic
1043980298 8:86630495-86630517 GAAGTACATGAGAGTATGAGAGG + Intronic
1044582873 8:93839693-93839715 AAAATAACTTAGAGTATAATTGG - Intergenic
1045046209 8:98281474-98281496 AAAATAACTAAGAGTATAATTGG + Intronic
1045149648 8:99389866-99389888 ACTAAATATTAGAGTATAAGAGG + Intronic
1045395938 8:101760806-101760828 ATAATAAACAAGAGTATAAGGGG - Intronic
1046204161 8:110968367-110968389 AAAATAAATAAGAGTATCACTGG - Intergenic
1046735512 8:117772349-117772371 AAAAAATATGTTTGTATAAGTGG - Intergenic
1046966738 8:120175937-120175959 ATCAAATATGGGAGTATAAGAGG - Intronic
1047910662 8:129525487-129525509 AAAATAACTAAGAGTATAATTGG + Intergenic
1048198954 8:132355522-132355544 GAAATTGATGAGAGTTTAAGAGG + Intronic
1048670533 8:136713807-136713829 AAAATAAAGGAGAAAATAAGAGG + Intergenic
1049030088 8:140028787-140028809 AGAATATATGAGAATACAGGAGG + Intronic
1050260153 9:3833012-3833034 GTGATATATGAGAGTATAAAAGG + Intronic
1050667539 9:7958133-7958155 AAACTATATGAAAATATGAGGGG - Intergenic
1050671147 9:7998679-7998701 AAAATAAATAAGAATATAAGTGG - Intergenic
1050857851 9:10384160-10384182 AAAATAACTAAGAGTATAATTGG + Intronic
1050942580 9:11478600-11478622 AAAATAAATCACAGTATATGTGG - Intergenic
1051239155 9:15033660-15033682 AAAATAATTAAGAGTATAATTGG + Intergenic
1051390928 9:16562164-16562186 AAAATAGATAAGAATGTAAGAGG - Intronic
1051704891 9:19867048-19867070 AAAATAACTAAGAGTATAATTGG + Intergenic
1052363613 9:27587200-27587222 AAAATAACTAAGAGTATAATTGG - Intergenic
1052420469 9:28236874-28236896 AAAATAACTAAGAGTATAACTGG + Intronic
1052421509 9:28248600-28248622 AAAATAACTAAGAGTATAATTGG + Intronic
1055226949 9:74008902-74008924 ATATTATATGAAAGTAAAAGTGG - Intergenic
1055827756 9:80347338-80347360 AAAATAACTAAGAGTATAATTGG + Intergenic
1055880874 9:81001840-81001862 AAAATAAATGGGAATATGAGGGG + Intergenic
1056088504 9:83181068-83181090 AACACATTTGAGAGTAAAAGGGG - Intergenic
1057403210 9:94742852-94742874 ATATTTTATGAAAGTATAAGGGG + Intronic
1057535500 9:95899784-95899806 AAAGTATATGGGAGGATAACAGG - Intronic
1057947818 9:99344956-99344978 AGAATATATGGAAGTATATGAGG + Intergenic
1058087309 9:100762296-100762318 AAAATAACTGAGAGTATAATTGG + Intergenic
1058284943 9:103165983-103166005 AAAATAGTTAAGAGTATAATTGG - Intergenic
1058472229 9:105291964-105291986 AAAAAATATAAGAGTATGAGTGG + Intronic
1058581115 9:106458580-106458602 TAATTATTTGAGATTATAAGAGG + Intergenic
1058859742 9:109104175-109104197 AAAATAACTAAGAGTATAATTGG + Intronic
1058959840 9:109982440-109982462 AAAATAACTAAGAGTATAATTGG + Intronic
1059301650 9:113318590-113318612 ACAGAATATGTGAGTATAAGGGG - Exonic
1059629554 9:116106099-116106121 AAACTTTCTGAGACTATAAGAGG + Intergenic
1059806933 9:117811474-117811496 AAAATACATGAAAATATTAGAGG + Intergenic
1062756375 9:138296169-138296191 AAAATTAATGAAAGGATAAGAGG - Intergenic
1185679842 X:1879528-1879550 AAATCATATTAGAGTATAATTGG + Intergenic
1186538191 X:10371633-10371655 AAAAAAAATCAGTGTATAAGTGG - Intergenic
1186576629 X:10773516-10773538 AAAATATGTGGCAGTATCAGTGG - Intronic
1186844032 X:13513255-13513277 AAAATAAATAAGAGTATAACTGG - Intergenic
1187081504 X:15994237-15994259 AAAGTAAATGAGAGGAAAAGTGG - Intergenic
1187210733 X:17228901-17228923 AAAAAATCTTAGAGTATAATTGG + Intergenic
1187652917 X:21430013-21430035 AAAATTTAGAAGAGTATAATAGG - Intronic
1187923456 X:24228664-24228686 GAAATATATGAGAGTTCCAGTGG + Intergenic
1188304129 X:28541726-28541748 AAAAAATCTGATAGTATATGAGG - Intergenic
1188427276 X:30063861-30063883 AAAATATATGAGATCATTTGTGG - Intergenic
1188470475 X:30532456-30532478 AAAATAACTAAGAGTATAATTGG - Intergenic
1188562721 X:31487932-31487954 AACATTTTTGAGTGTATAAGGGG + Intronic
1188597102 X:31914870-31914892 AAAATAAATAAGAGTATAATTGG + Intronic
1188750516 X:33899257-33899279 AAAATTTAAGAGAATTTAAGAGG + Intergenic
1188832685 X:34919627-34919649 GAACTATATGAGAGTAGAAAAGG - Intergenic
1188974412 X:36656058-36656080 AATATATAATAGAGTATAACTGG - Intergenic
1189034954 X:37486367-37486389 AAAATAACTGAGAGTATAATTGG + Intronic
1189519912 X:41755656-41755678 AAAATGTATGAGAATAGAAAAGG + Intronic
1189915791 X:45854649-45854671 AAAATATGTGTGTGTATATGTGG + Intergenic
1190121839 X:47666961-47666983 AAAATAACTGAGACTATAATTGG - Intergenic
1191912835 X:66169623-66169645 AAAATAAATGACAGTATGTGAGG - Intronic
1192838585 X:74829205-74829227 AAAATAACTAAGAGTATAATTGG - Intronic
1193243735 X:79204598-79204620 AAAATAACTAAGAGTATAATTGG + Intergenic
1193540386 X:82764489-82764511 AAAATATAAGAGCATATAACAGG + Intergenic
1193678949 X:84493529-84493551 TAAATATATGAAAATATAAAGGG + Intronic
1194470882 X:94295453-94295475 AAAATAGATAAGATTATTAGGGG - Intergenic
1194799153 X:98250341-98250363 AAAATAAATGACAGTATGTGAGG - Intergenic
1194800928 X:98271544-98271566 AAAAGAAATGAGTGTATCAGAGG + Intergenic
1195955508 X:110325307-110325329 AAAATAACTAAGAGTATAATTGG - Intronic
1196034692 X:111131526-111131548 GAAATATGTGAAAGTATATGTGG - Intronic
1196115825 X:111998637-111998659 AAAAAAAATGTGTGTATAAGTGG - Intronic
1196170066 X:112577642-112577664 AAAATAACTAAGAGTATAACTGG - Intergenic
1197090750 X:122533645-122533667 AAAATAACTTAGAGTATAATTGG + Intergenic
1197260160 X:124308841-124308863 AAAAGATAATAGAGCATAAGCGG + Intronic
1197304998 X:124830808-124830830 AAAATCTTTGTGTGTATAAGAGG - Intronic
1197536354 X:127692655-127692677 AAGATATATGGGAGTGTGAGTGG - Intergenic
1197540469 X:127753576-127753598 AAAAAATAACAGAGTATAATTGG - Intergenic
1197902289 X:131387226-131387248 AAAATATATAAAGGTATATGAGG - Intronic
1197966905 X:132073890-132073912 AAAATATAAGGGATTTTAAGAGG - Intergenic
1198761454 X:140037169-140037191 AAAACATATGAGAATATATTTGG + Intergenic
1198971826 X:142290358-142290380 ACAATATAGGAGAATATAAAAGG + Intergenic
1199072267 X:143491143-143491165 AAAAAATATCTGTGTATAAGTGG - Intergenic
1199157487 X:144567799-144567821 AAAATGTAGGAGTGCATAAGAGG + Intergenic
1199192750 X:144990498-144990520 ACAATATATGTGTGTATAACTGG + Intergenic
1199194464 X:145011020-145011042 AATATCTATAAGAGTATAACTGG + Intergenic
1199928950 X:152498509-152498531 AAAGCATATGAGAGTTTGAGTGG - Intergenic
1200855453 Y:7933063-7933085 AACATATATGAGAGTGTGATTGG - Intergenic
1201526543 Y:14941967-14941989 TAAAATTATGAGAGCATAAGTGG - Intergenic
1201736025 Y:17262519-17262541 AAAATGTATTTGAGTATATGTGG + Intergenic
1202591692 Y:26491539-26491561 AAAATTCATGAAAGTATGAGGGG + Intergenic