ID: 1013215490

View in Genome Browser
Species Human (GRCh38)
Location 6:108023726-108023748
Sequence AAGTGAGTACATGTGGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013215490_1013215497 17 Left 1013215490 6:108023726-108023748 CCAAACACCACATGTACTCACTT No data
Right 1013215497 6:108023766-108023788 AATAACACATGGACACAGGGAGG No data
1013215490_1013215494 6 Left 1013215490 6:108023726-108023748 CCAAACACCACATGTACTCACTT No data
Right 1013215494 6:108023755-108023777 GGGAGCTGAACAATAACACATGG No data
1013215490_1013215496 14 Left 1013215490 6:108023726-108023748 CCAAACACCACATGTACTCACTT No data
Right 1013215496 6:108023763-108023785 AACAATAACACATGGACACAGGG No data
1013215490_1013215495 13 Left 1013215490 6:108023726-108023748 CCAAACACCACATGTACTCACTT No data
Right 1013215495 6:108023762-108023784 GAACAATAACACATGGACACAGG 0: 23
1: 20
2: 91
3: 1041
4: 17329
1013215490_1013215499 19 Left 1013215490 6:108023726-108023748 CCAAACACCACATGTACTCACTT No data
Right 1013215499 6:108023768-108023790 TAACACATGGACACAGGGAGGGG 0: 52
1: 5166
2: 15626
3: 16973
4: 8296
1013215490_1013215498 18 Left 1013215490 6:108023726-108023748 CCAAACACCACATGTACTCACTT No data
Right 1013215498 6:108023767-108023789 ATAACACATGGACACAGGGAGGG 0: 53
1: 5566
2: 16166
3: 17604
4: 8684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013215490 Original CRISPR AAGTGAGTACATGTGGTGTT TGG (reversed) Intergenic
No off target data available for this crispr