ID: 1013215491

View in Genome Browser
Species Human (GRCh38)
Location 6:108023733-108023755
Sequence CACTTTTAAGTGAGTACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26243
Summary {0: 4, 1: 74, 2: 2589, 3: 7872, 4: 15704}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013215491_1013215499 12 Left 1013215491 6:108023733-108023755 CCACATGTACTCACTTAAAAGTG 0: 4
1: 74
2: 2589
3: 7872
4: 15704
Right 1013215499 6:108023768-108023790 TAACACATGGACACAGGGAGGGG 0: 52
1: 5166
2: 15626
3: 16973
4: 8296
1013215491_1013215500 29 Left 1013215491 6:108023733-108023755 CCACATGTACTCACTTAAAAGTG 0: 4
1: 74
2: 2589
3: 7872
4: 15704
Right 1013215500 6:108023785-108023807 GAGGGGAACATCACACAGTGAGG 0: 59
1: 1966
2: 7529
3: 17503
4: 15804
1013215491_1013215498 11 Left 1013215491 6:108023733-108023755 CCACATGTACTCACTTAAAAGTG 0: 4
1: 74
2: 2589
3: 7872
4: 15704
Right 1013215498 6:108023767-108023789 ATAACACATGGACACAGGGAGGG 0: 53
1: 5566
2: 16166
3: 17604
4: 8684
1013215491_1013215495 6 Left 1013215491 6:108023733-108023755 CCACATGTACTCACTTAAAAGTG 0: 4
1: 74
2: 2589
3: 7872
4: 15704
Right 1013215495 6:108023762-108023784 GAACAATAACACATGGACACAGG 0: 23
1: 20
2: 91
3: 1041
4: 17329
1013215491_1013215494 -1 Left 1013215491 6:108023733-108023755 CCACATGTACTCACTTAAAAGTG 0: 4
1: 74
2: 2589
3: 7872
4: 15704
Right 1013215494 6:108023755-108023777 GGGAGCTGAACAATAACACATGG No data
1013215491_1013215496 7 Left 1013215491 6:108023733-108023755 CCACATGTACTCACTTAAAAGTG 0: 4
1: 74
2: 2589
3: 7872
4: 15704
Right 1013215496 6:108023763-108023785 AACAATAACACATGGACACAGGG No data
1013215491_1013215497 10 Left 1013215491 6:108023733-108023755 CCACATGTACTCACTTAAAAGTG 0: 4
1: 74
2: 2589
3: 7872
4: 15704
Right 1013215497 6:108023766-108023788 AATAACACATGGACACAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013215491 Original CRISPR CACTTTTAAGTGAGTACATG TGG (reversed) Intergenic
Too many off-targets to display for this crispr