ID: 1013215494

View in Genome Browser
Species Human (GRCh38)
Location 6:108023755-108023777
Sequence GGGAGCTGAACAATAACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013215491_1013215494 -1 Left 1013215491 6:108023733-108023755 CCACATGTACTCACTTAAAAGTG 0: 4
1: 74
2: 2589
3: 7872
4: 15704
Right 1013215494 6:108023755-108023777 GGGAGCTGAACAATAACACATGG No data
1013215490_1013215494 6 Left 1013215490 6:108023726-108023748 CCAAACACCACATGTACTCACTT No data
Right 1013215494 6:108023755-108023777 GGGAGCTGAACAATAACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013215494 Original CRISPR GGGAGCTGAACAATAACACA TGG Intergenic
No off target data available for this crispr