ID: 1013217673

View in Genome Browser
Species Human (GRCh38)
Location 6:108043809-108043831
Sequence ACTGTAAGACTGTTGGACAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013217673_1013217675 -8 Left 1013217673 6:108043809-108043831 CCACTGTCCAACAGTCTTACAGT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1013217675 6:108043824-108043846 CTTACAGTGAGCATCCTCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 85
1013217673_1013217679 22 Left 1013217673 6:108043809-108043831 CCACTGTCCAACAGTCTTACAGT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013217673 Original CRISPR ACTGTAAGACTGTTGGACAG TGG (reversed) Exonic
903110020 1:21124358-21124380 ACTGCTTTACTGTTGGACAGTGG - Intronic
905459426 1:38112926-38112948 AATGTAAGAATGTTGCAAAGAGG + Intergenic
909557389 1:76969155-76969177 ACACTGGGACTGTTGGACAGGGG + Intronic
911213009 1:95162805-95162827 ACTTTAAGAATGTTGAACATTGG + Intronic
915479582 1:156175695-156175717 TCTGGAAGACTTTTGGGCAGGGG + Intronic
917960222 1:180137145-180137167 ACTGTAAGTATGTTAGACACAGG - Intergenic
921316063 1:213892354-213892376 ACTGTAAGCCTGCTGCAGAGAGG + Intergenic
923054854 1:230418310-230418332 ACTGTAGTACAGTTGTACAGTGG + Intronic
923065195 1:230510956-230510978 ACTGCAACTCTGTTGGACAGAGG - Intergenic
923255235 1:232216288-232216310 TATCTAAGACTGTTGGACACTGG + Intergenic
924127925 1:240875121-240875143 TCTGGAAGACTGTTGTATAGCGG - Intronic
1063863754 10:10341701-10341723 GCTGTAATACTGTGGGAGAGAGG + Intergenic
1064486049 10:15791596-15791618 ACTGTAATGCTGTTGGATTGTGG + Intronic
1066026234 10:31362559-31362581 ACTGTGAGGCTGCTGGGCAGAGG + Intronic
1066102192 10:32127571-32127593 AGTATAACTCTGTTGGACAGAGG - Intergenic
1067073004 10:43150387-43150409 ACTGTAAGTCTTTTAGGCAGAGG - Intronic
1067243164 10:44513557-44513579 ACTTTAATACTGTTGGACTATGG - Intergenic
1067734192 10:48836757-48836779 AGTGTCAGCTTGTTGGACAGAGG + Intronic
1068374239 10:56157216-56157238 ACTATAAAAATGATGGACAGTGG - Intergenic
1069278435 10:66622577-66622599 ACAGTAAGGCTTATGGACAGAGG + Intronic
1070330899 10:75416226-75416248 ACAGTAAGACTGAAGGAGAGCGG - Intergenic
1071603412 10:86969914-86969936 ACTGAGAAAATGTTGGACAGAGG - Intronic
1071681669 10:87712279-87712301 TCTGTAAGACGGTTGTTCAGTGG + Intronic
1072470132 10:95706209-95706231 ATTATTAGAATGTTGGACAGTGG + Intergenic
1077719303 11:4610887-4610909 ACAGTAAGACTTTTGTACAGTGG + Intergenic
1078853623 11:15188079-15188101 ACAGCATGACTGTGGGACAGGGG - Intronic
1079289386 11:19173559-19173581 ACTGTTAGGCTGTTAGACAAGGG + Intronic
1081799955 11:45851452-45851474 ACTGTTGGACTGTTGGGAAGTGG + Intronic
1082670898 11:56034958-56034980 TCTTTAAGACTGTTGGATATTGG - Intergenic
1084408868 11:68994522-68994544 ACTGATGGACTGATGGACAGTGG + Intergenic
1084943100 11:72624920-72624942 ACTGAGACACTGTGGGACAGGGG - Intronic
1085179728 11:74523453-74523475 TCTGTAAGAATTTTGAACAGGGG + Intronic
1088575316 11:111265926-111265948 ACTGGAAGAATGGAGGACAGTGG - Intronic
1090271835 11:125391678-125391700 ACTGTGAGACTTGTGTACAGTGG + Intronic
1092067567 12:5604567-5604589 ACTGTAAGACTGTGTGGCAAAGG + Intronic
1092887067 12:12934215-12934237 ACTACAACTCTGTTGGACAGAGG - Intergenic
1094128340 12:27047441-27047463 ACTGTAAAACTGTTTCATAGTGG + Intronic
1097738524 12:63210860-63210882 TCTGTAAGATTGTTGGGCATGGG + Intergenic
1098312893 12:69165141-69165163 ACTGCAACTCTGATGGACAGAGG + Intergenic
1100565978 12:95793952-95793974 ACTGGATGACCTTTGGACAGAGG - Intergenic
1102435766 12:112922099-112922121 TTTCTAAGACTGTTGGGCAGAGG - Intronic
1103771889 12:123333324-123333346 ACTGTGATATTATTGGACAGTGG - Intronic
1105641661 13:22271095-22271117 CCTCAAAGACTGTTGGACTGAGG - Intergenic
1110165394 13:72436358-72436380 AATGTAAGACTTTTAGGCAGGGG + Intergenic
1111075814 13:83233052-83233074 ACTGTTACACTGTTGGAAACTGG + Intergenic
1111847532 13:93530316-93530338 ATTTTAAGAATGGTGGACAGTGG - Intronic
1112432226 13:99359997-99360019 ATTTTAAGACTGTTGGCCATTGG - Intronic
1112757271 13:102651274-102651296 ACTGAAAGACAATTAGACAGAGG + Intronic
1113503326 13:110795053-110795075 ACTGGAATACTGCTGGGCAGCGG - Intergenic
1114784295 14:25577197-25577219 ACTGCAAAATTGTTGGACAAGGG + Intergenic
1115760522 14:36576476-36576498 ACTGGAAGTCTGGTAGACAGGGG + Intergenic
1117767414 14:59097309-59097331 ACTGTAAGCCTGTTGGGGAAGGG + Intergenic
1120138484 14:80899662-80899684 ACTGTGAGACTTTTGCAAAGAGG - Intronic
1124368305 15:29089338-29089360 ACTGTACCATTGTTGCACAGAGG + Intronic
1127248825 15:57208323-57208345 ACTATAAGAATCTTGGCCAGGGG - Intronic
1135605428 16:23820218-23820240 ACAGTAAGAGGGTTGGGCAGGGG - Intergenic
1135719296 16:24801425-24801447 ACTGGAGGACTGGTGGACTGAGG + Intronic
1135767445 16:25189826-25189848 ACTGTAAGACTTTTGAGGAGAGG - Intergenic
1141797057 16:86282151-86282173 CCTGCAATACTGTTGGACAGAGG + Intergenic
1144050387 17:11492911-11492933 ACAGACAGACTGTGGGACAGGGG - Intronic
1148713578 17:49699602-49699624 AATGTAAGATGGATGGACAGGGG + Intergenic
1149427818 17:56571711-56571733 ACTGTGAGACATTTGGAAAGAGG - Intergenic
1153210557 18:2758813-2758835 ACAGTAAAACTGCTGGGCAGGGG - Intronic
1155642938 18:28041762-28041784 ACTGTAGGAATGTTGAATAGTGG - Intronic
1161821684 19:6533936-6533958 ACTTTAAGAGGGGTGGACAGGGG - Intronic
1163135686 19:15309487-15309509 ACTGCCAGACTGTTTTACAGTGG - Intronic
1168028065 19:53658036-53658058 TCTGTAGGACAGATGGACAGGGG - Intergenic
927498047 2:23563850-23563872 AGGGAAAGAATGTTGGACAGGGG + Intronic
929969382 2:46560668-46560690 GCTGTCTTACTGTTGGACAGAGG + Intronic
930021419 2:47004226-47004248 ACTGAGAGACTGGTGGCCAGGGG - Intronic
931452372 2:62379034-62379056 AATGTAAGACTAATGAACAGGGG + Intergenic
933112809 2:78425617-78425639 ACTGATACACTGTTGGAAAGAGG - Intergenic
933409054 2:81902040-81902062 ACTGTAAGATTTTTGAACATGGG + Intergenic
935455408 2:103261941-103261963 ACTAAATGACTGTTGGAAAGTGG - Intergenic
937700020 2:124853490-124853512 GCTGTAGAACTGTAGGACAGTGG - Intronic
938125082 2:128665359-128665381 GCTGCAAGCCTGTTGGAGAGGGG + Intergenic
938622564 2:133071697-133071719 TCTTTAAGATTGTTGGAAAGAGG - Intronic
942774100 2:179559929-179559951 GCTGTCAGACTGTGGGAGAGAGG - Intronic
943463666 2:188201415-188201437 ACTGTAATATTTTTGGACTGTGG + Intergenic
947132460 2:226942971-226942993 ACTGTAAGATTGTTTAAGAGAGG - Intronic
947939899 2:234043857-234043879 ACTGAAAGACTTCTGCACAGTGG + Intergenic
1173135846 20:40438147-40438169 ACTTGGAGACTGTGGGACAGAGG - Intergenic
1178044586 21:28678732-28678754 TCTTTAAGAATGTTGGACATTGG - Intergenic
1178573253 21:33760812-33760834 CCAGGAAGACTGCTGGACAGAGG - Intronic
1179147731 21:38783279-38783301 TCAGTGAGACTGCTGGACAGTGG + Intergenic
1179793489 21:43768881-43768903 ACTGTAAGCCTCTTAGAGAGCGG + Intergenic
1182874232 22:33676667-33676689 ACTGTAAGATCCTTGAACAGGGG + Intronic
1183319478 22:37156297-37156319 ACTGGGACACTGTTGTACAGTGG - Intronic
950640016 3:14342660-14342682 AGTGAAAGCCTGTGGGACAGTGG - Intergenic
951275147 3:20676084-20676106 CCTTTAAGGCTGTTGGACTGAGG + Intergenic
952093576 3:29921477-29921499 ACTGACAGACTGTTTGGCAGGGG + Intronic
955760023 3:62270036-62270058 ACTGTAATATTTTTGGACTGTGG + Intronic
957110743 3:75953670-75953692 ACTTTATGACTGTTTGAAAGGGG - Intronic
959112597 3:102139731-102139753 ACTGTTACACTGTTGGAGACGGG - Intronic
959448577 3:106470069-106470091 ACAGAAATACTGTTGGACTGAGG + Intergenic
959960660 3:112294396-112294418 AATTTAAGACTTTGGGACAGTGG + Intergenic
960382646 3:116983240-116983262 ACTGGATGACTGCAGGACAGAGG + Intronic
960751992 3:120965579-120965601 TCTGTAAGAATGTTGGATATTGG + Intronic
961361134 3:126367831-126367853 ATTATAACACTGTTGGAAAGAGG + Intergenic
968718965 4:2185392-2185414 ACTGCAAGAGTGTAAGACAGAGG + Intronic
970243181 4:14030657-14030679 ACTGGGAGACTGGGGGACAGTGG + Intergenic
972212530 4:36856067-36856089 TCTTTAAGACTGTTGAACATTGG - Intergenic
972677482 4:41274724-41274746 TCTTTAAGACTGTTGGATATTGG + Intergenic
974438806 4:61890675-61890697 AGTGTAAGAGTGTTGAAAAGTGG - Intronic
977392101 4:96424776-96424798 TCTGTCATACTGTTAGACAGTGG + Intergenic
978410134 4:108416945-108416967 ACTGGGAGACTGGTGGACAGTGG - Intergenic
978432638 4:108649906-108649928 ACTTTAAGATTTTTGGCCAGAGG + Intergenic
990278415 5:54224483-54224505 ATTGAAAGTCTGTTGGATAGTGG - Intronic
992408760 5:76484476-76484498 AGTGTCAGAATGTTGGGCAGAGG + Intronic
993655824 5:90576724-90576746 GCTTTCAGACTGTTGGTCAGTGG - Intronic
997144274 5:131415262-131415284 TTGGTAAGACTGTTGGACACTGG + Intergenic
999878548 5:155835778-155835800 ATTTTAATACTTTTGGACAGTGG - Intergenic
1001554205 5:172625165-172625187 CCTGGAAGACTGTGGGAAAGAGG - Intergenic
1005243394 6:23855678-23855700 ACTGTGAGGCGGTTGGGCAGAGG - Intergenic
1006504989 6:34483416-34483438 ACTGTAATGCTGTGGGACAGAGG + Intronic
1009552823 6:65120978-65121000 ACTGTAAGAATATGGGACATAGG - Intronic
1013217673 6:108043809-108043831 ACTGTAAGACTGTTGGACAGTGG - Exonic
1014562183 6:122904818-122904840 AGTGTAATACTGTTGAACAGTGG - Intergenic
1020511174 7:9059094-9059116 ACTGTAACAGTGCTGGACAAAGG - Intergenic
1022449726 7:30503919-30503941 ACTCTCAGTCTGTAGGACAGAGG - Intronic
1027473099 7:78596816-78596838 ACTGTTACACTATTGGACACTGG - Intronic
1039624013 8:39028961-39028983 ACTGTAAGTCTGCTTGACACAGG - Intronic
1045952512 8:107867189-107867211 ACTGAGAGACTGTTCTACAGAGG - Intergenic
1048354461 8:133641854-133641876 ACTCTAAGACACGTGGACAGAGG - Intergenic
1053190611 9:36063435-36063457 ACTGTTAGACTGTTAATCAGAGG - Intronic
1056740255 9:89248523-89248545 ACAGTAAGACTGTGGGTCAATGG - Intergenic
1057949239 9:99356667-99356689 ACAGTGAGACTGACGGACAGAGG - Intergenic
1058423206 9:104853166-104853188 ACTGGAAGACACGTGGACAGTGG + Intronic
1059490377 9:114661571-114661593 ATTGTCTGACTGTTGGACAATGG + Intergenic
1192560133 X:72122925-72122947 ACTGCAAGACTGTGGTTCAGTGG - Intergenic
1192930081 X:75797774-75797796 TCTTTAAGACTGTTGGATATTGG + Intergenic
1195989733 X:110670747-110670769 ACTGTGAGACTCTGGGACACAGG + Intergenic
1199552267 X:149073213-149073235 ACTGTAACACTGTTCAACAAAGG - Intergenic
1200878606 Y:8187338-8187360 ACTGTAAGTCTGTTGGGTAAAGG + Intergenic
1201478279 Y:14408687-14408709 AAAGTAAGACTGTTGTACAAAGG + Intergenic