ID: 1013217674

View in Genome Browser
Species Human (GRCh38)
Location 6:108043816-108043838
Sequence GATGCTCACTGTAAGACTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013217674_1013217679 15 Left 1013217674 6:108043816-108043838 CCAACAGTCTTACAGTGAGCATC 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013217674 Original CRISPR GATGCTCACTGTAAGACTGT TGG (reversed) Exonic
900092704 1:927387-927409 GATGCTCACGGAAGCACTGTCGG - Intronic
904058265 1:27686419-27686441 GCTGCTCACTGTCAGCCAGTGGG - Intergenic
904305443 1:29585780-29585802 GATCCTCACAGCAAGCCTGTGGG - Intergenic
904343425 1:29852749-29852771 GATCCTCACAGCAAGCCTGTGGG - Intergenic
905106205 1:35565063-35565085 GATGCTCACTGTGTGACCTTGGG - Intronic
909243309 1:73242603-73242625 GATGATCTCTCTAACACTGTCGG - Intergenic
910504566 1:87935323-87935345 GATCCTCACTGTATGTATGTAGG - Intergenic
916451709 1:164927268-164927290 CTTGCTCACTGTAAGACCTTGGG + Intergenic
916876031 1:168970521-168970543 GATTCTCACTGTAATCCTATTGG - Intergenic
917141846 1:171842255-171842277 GAGGCTCCCTGTGAGGCTGTGGG + Intronic
918318278 1:183341219-183341241 GTGGCTCACTGTGAGACTCTGGG + Intronic
918802070 1:188985334-188985356 GAGGCTCACTGTTAGTCTGATGG + Intergenic
918805330 1:189033766-189033788 TATGCTCTCTCTAAGACTCTGGG + Intergenic
920822746 1:209396662-209396684 CTTGCTCACTGTATGACTTTGGG - Intergenic
920934480 1:210418360-210418382 GATGCTAACTGTTGGACTATTGG - Intronic
923326485 1:232884761-232884783 GGTGATCACTATAATACTGTTGG + Intergenic
1062960118 10:1567153-1567175 GATGCTCAGAGGAAGTCTGTGGG + Intronic
1067940479 10:50650870-50650892 GAAGACCACTGTAAGGCTGTGGG + Intergenic
1071126153 10:82337274-82337296 TATGCTCAGTGAAAGACAGTAGG - Intronic
1071402130 10:85283952-85283974 GATACTCACTGTCACAGTGTAGG - Intergenic
1073508072 10:104020035-104020057 GATGTTCACTTTAATTCTGTGGG + Intronic
1073719950 10:106157215-106157237 GATGCTCACATTGAGAATGTGGG + Intergenic
1074567142 10:114590341-114590363 GATGCTGACCGTGAGACTGGAGG + Intronic
1075211529 10:120495346-120495368 GATTATCTCTGTAAGCCTGTGGG - Intronic
1081523922 11:43910718-43910740 GATGGTCACTGTAAGAGAGATGG - Intronic
1087152676 11:94872694-94872716 GATGCTCAGTGTGAGACTAGAGG - Exonic
1087214401 11:95479824-95479846 AATGCTCACTGGAACATTGTAGG - Intergenic
1090175925 11:124649633-124649655 GACGGTCACTGAAAGCCTGTGGG - Exonic
1091534140 12:1389481-1389503 TATGCCCTCTGTAAGCCTGTTGG + Intronic
1092252238 12:6905974-6905996 GATGAGGACTGTGAGACTGTAGG + Intronic
1099854698 12:88149263-88149285 GAAGGTCACTGTTAAACTGTTGG + Intronic
1101152558 12:101896408-101896430 GCTGCTCACTTTAAAACTGATGG - Intronic
1106363360 13:29052649-29052671 GATGCCTATTGTAAGACTGTGGG + Intronic
1108080475 13:46729608-46729630 GGTGCTAACTTTAAGACTATAGG + Intronic
1111430329 13:88141358-88141380 GATGCTCACTGTATGGATGATGG + Intergenic
1111973403 13:94940641-94940663 CATGCTCACTCTGAGACTCTGGG - Intergenic
1113316487 13:109185371-109185393 GATGCTGCCTGGAATACTGTAGG + Intronic
1116525371 14:45897567-45897589 AATGCTCATTATAAGACTTTAGG + Intergenic
1117876914 14:60261925-60261947 AATACACACTGTTAGACTGTTGG + Intronic
1117884656 14:60347794-60347816 AATCCTCACAGTAACACTGTGGG - Intergenic
1120739697 14:88094351-88094373 GATCATCACTGCAAGACCGTAGG + Intergenic
1122595818 14:102891084-102891106 GATGCTCACTGTGGCACTGCAGG + Intronic
1123882744 15:24690653-24690675 GTTGCTCACAGAAAGCCTGTTGG - Intergenic
1125525016 15:40369112-40369134 GCTGCTCACTGTAGGACTCCTGG + Exonic
1126559394 15:50026818-50026840 GCTACTCATTGTAAGACTCTTGG - Intronic
1126714447 15:51499663-51499685 GACTCCCACTGTAAGAATGTGGG + Exonic
1126754246 15:51909737-51909759 GATGGTTACTGTAAGTCAGTTGG + Exonic
1127323100 15:57866537-57866559 AATGTTCACAGTAACACTGTTGG - Intergenic
1128265623 15:66264388-66264410 GAAACTCACTGTCAGACTGTGGG + Intergenic
1130126044 15:81094828-81094850 GAACCTCACTGTTAGACAGTTGG + Intronic
1130822118 15:87506928-87506950 CATACTCACTGGAAGACTATTGG - Intergenic
1131435025 15:92415503-92415525 GACGCTCAGTGTAAGACAGTAGG + Intronic
1135543488 16:23350273-23350295 GATGCACAGTGGAAGACTGTGGG + Intronic
1138166899 16:54810866-54810888 GATGCTCAATGTAAGAAACTGGG + Intergenic
1140967773 16:79983912-79983934 GATACTCACTGTGAAACTGTGGG + Intergenic
1141378875 16:83557529-83557551 GAAGCTCTCTGTAAGCCTTTCGG + Intronic
1141816142 16:86410487-86410509 GCTGCACTCTGTAAGACTCTAGG - Intergenic
1145084888 17:19929074-19929096 GATGCTAAGTGAAAGACAGTTGG + Intronic
1148904390 17:50902706-50902728 GATCTTCCCTGTAAGACTCTCGG - Intergenic
1150621262 17:66809348-66809370 TAGGGTCACTGTAAGGCTGTTGG - Exonic
1153893816 18:9541486-9541508 GGTGGACACTGTAAGACTGCTGG - Intergenic
1153954667 18:10086216-10086238 GATGCTCATGGTGAGACGGTGGG + Intergenic
1156778645 18:40823429-40823451 GAGGTTCACTGTTAGTCTGTTGG - Intergenic
1159389777 18:67775534-67775556 GATGCTCACTGTGATAATGTAGG + Intergenic
1159767553 18:72508894-72508916 GATGCTCAGTGGAAGACATTAGG + Intergenic
1164683306 19:30150297-30150319 GAGGCTCACTGTGATCCTGTTGG + Intergenic
925700606 2:6633612-6633634 CTTGCTCACTGTATGACTTTAGG - Intergenic
925809858 2:7688835-7688857 CATGCTCGTTGTAAGACAGTAGG - Intergenic
927881222 2:26691645-26691667 GAGGCTCACTGGCAGACTGCGGG - Intergenic
930583585 2:53243088-53243110 GATGCTCACTGTAACCCTAAAGG + Intergenic
931239164 2:60437332-60437354 GATGCTCATTGCAGCACTGTGGG - Intergenic
933123424 2:78571782-78571804 GATTCCCACTGTAAAAATGTAGG - Intergenic
933502525 2:83133196-83133218 GATGTTCACTGTAAAATAGTAGG - Intergenic
942042066 2:172076711-172076733 GATGCTGGCTGAAAGCCTGTGGG + Intronic
945748634 2:213751548-213751570 GAGGCTGACGGTAAGACTGGAGG - Intronic
947091333 2:226514691-226514713 GATGCTTACTTTAAGACTTGAGG + Intergenic
947750604 2:232530126-232530148 GAGGCTCACTGTCAGCCGGTAGG - Exonic
948933212 2:241145503-241145525 GAGGCTATCTGTAAGACTTTGGG + Intronic
1172858890 20:38032020-38032042 GATACTCACTGTATGATTTTAGG + Intronic
1173254483 20:41384394-41384416 TTTGCCCAGTGTAAGACTGTTGG - Intergenic
1181654523 22:24285288-24285310 GATGCTTACTGTAATTCTGTGGG + Intronic
1182161262 22:28124069-28124091 GTTGCTTACTGTAAGAATGAAGG - Intronic
1182754447 22:32667335-32667357 CATGCTTTCTGTAAGACTGAAGG + Intronic
1185077351 22:48690503-48690525 GGTCATCACTGTAAGCCTGTGGG - Intronic
949713007 3:6893508-6893530 GATGCTCAGTTTATGTCTGTAGG - Intronic
954073350 3:48159070-48159092 GGGGCTCACAGTAAGACTGAGGG + Exonic
955779637 3:62470753-62470775 GATTCTTATTGTAAGACTGTTGG - Intronic
960055176 3:113271956-113271978 GATGCTCACTGAGAGACAGTTGG + Intronic
982499287 4:156132649-156132671 GATGCCCACTGTTAGCCTGATGG - Intergenic
984451619 4:179910902-179910924 GATGCTGACTGTCACAATGTAGG + Intergenic
984707372 4:182857502-182857524 GGTGCTCACTCTAAGGCTGAAGG - Intergenic
988110658 5:26814500-26814522 GATGTTCACTGTTAGTCTGATGG - Intergenic
989150377 5:38293364-38293386 AATCCTCACTGTAATTCTGTGGG - Intronic
993454755 5:88115132-88115154 GGTGTTCAGTGGAAGACTGTGGG + Intergenic
994179150 5:96744733-96744755 GAAGGTCACTGTCAGCCTGTAGG + Intronic
995458671 5:112379145-112379167 GATGCCCACTGAAAGCCAGTGGG - Intronic
996085677 5:119302604-119302626 AATGTCCACTGAAAGACTGTGGG - Intronic
996853400 5:127977838-127977860 GAAGCTCACTGGAAGAGTGGAGG - Intergenic
1000759189 5:165200845-165200867 GATCCTCACTGTATCACTGTAGG - Intergenic
1003730473 6:8816982-8817004 TATTTTCAGTGTAAGACTGTTGG - Intergenic
1007928253 6:45667632-45667654 GAACCTCACTGAAAGCCTGTTGG + Intergenic
1009196187 6:60688476-60688498 GATGTTCATTGGAAGACTATTGG - Intergenic
1011674370 6:89717401-89717423 CTTGCTAACTGTAAAACTGTAGG + Intronic
1013217674 6:108043816-108043838 GATGCTCACTGTAAGACTGTTGG - Exonic
1014010503 6:116469947-116469969 GATGCTCCCTTTTAGAATGTAGG + Intergenic
1016503490 6:144749438-144749460 GGTGCTAACTGGAAGTCTGTTGG - Intronic
1020212592 7:6167301-6167323 ACTGCTCACTGGAGGACTGTGGG - Intronic
1023157200 7:37262917-37262939 GATGCACTCTGTCACACTGTGGG - Intronic
1023196031 7:37640660-37640682 GAGGCCCACTGTTAGTCTGTTGG + Intergenic
1023992348 7:45135855-45135877 GATGCTTTCAGTAAGACTTTTGG - Intergenic
1028400254 7:90417947-90417969 GAACCTCACTGCAGGACTGTAGG + Intronic
1031640741 7:124161220-124161242 TATGCTGACTGTCAAACTGTTGG + Intergenic
1033216107 7:139494870-139494892 GATGCTCACTCTTGGGCTGTGGG + Intergenic
1034883957 7:154783438-154783460 GCTGCTCCCTGTAAACCTGTTGG - Intronic
1035008104 7:155685099-155685121 GATGCTCATTTTAAGTCTGGGGG - Intronic
1035525954 8:313572-313594 GATGCTCACTGCAAAGCTTTTGG + Intergenic
1037190867 8:16123401-16123423 GATTTTCTCTGTAAGACTGAAGG + Intronic
1039497071 8:37988339-37988361 CATGGTCACTGGAAGGCTGTGGG - Intergenic
1042350099 8:67768444-67768466 GAAGGTCACTGTAAGAATCTTGG - Intergenic
1043788502 8:84432842-84432864 CATGCTCCCTGTGAGACTCTGGG - Intronic
1044264165 8:90163029-90163051 CATCCTCACTGTAAGTCTATAGG - Intergenic
1046909471 8:119610132-119610154 GATTGTCACTGTAAAATTGTTGG - Intronic
1047855526 8:128905778-128905800 GATATTCACTGAAAGACTGTTGG + Intergenic
1055509613 9:76983426-76983448 GATGCCCACTGTTAGTCTGATGG + Intergenic
1191950134 X:66581752-66581774 GATGCCCACTGTTAGTCTGATGG - Intergenic
1194261274 X:91699249-91699271 TATGCTCACTGTCACACTGGTGG + Intergenic
1196617392 X:117782674-117782696 GATGCTTTTTGTAAGACTGGAGG + Intergenic
1196701106 X:118669803-118669825 CATGCTCCCTCTAAGACTCTGGG + Intronic
1198684861 X:139217124-139217146 GATTGTCACTGTAGGTCTGTTGG - Intronic
1200579923 Y:4938050-4938072 TATGCTCACTGTCACACTGGTGG + Intergenic
1201997661 Y:20111895-20111917 GTTGCTCACTTCAAGAATGTAGG + Intergenic