ID: 1013217676

View in Genome Browser
Species Human (GRCh38)
Location 6:108043838-108043860
Sequence CGAGCAGAAAGGGACCTGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013217676_1013217679 -7 Left 1013217676 6:108043838-108043860 CCTCTCAGGTCCCTTTCTGCTCG 0: 1
1: 0
2: 2
3: 18
4: 195
Right 1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013217676 Original CRISPR CGAGCAGAAAGGGACCTGAG AGG (reversed) Exonic
900364757 1:2306558-2306580 CGATCTGAAAGGGAGCCGAGTGG - Exonic
901136618 1:7000881-7000903 TGAGCAGAAAGGGGCTTTAGAGG + Intronic
902529616 1:17082369-17082391 AGAGCAGGAAAGGACCTCAGAGG + Intronic
902894879 1:19472560-19472582 GGAGGAGAAAGGGAAGTGAGGGG + Intronic
903579740 1:24361874-24361896 ACAGCAGGAAGGGACCTCAGAGG - Intronic
905543176 1:38776449-38776471 AGAGAAGAAAGGGAACAGAGTGG + Intergenic
905904159 1:41605711-41605733 CGAGCAGAAAAGGGGATGAGTGG + Intronic
906029330 1:42705194-42705216 CAAACAGAAAGGGGCCTGAAGGG + Intergenic
906400531 1:45500995-45501017 CAAGAAGAAAGGGACCTGTGAGG + Intronic
907288325 1:53396343-53396365 CAACCACAAAGGGCCCTGAGGGG - Intergenic
907386493 1:54129021-54129043 TGAGTAGAAAGGGACATGAAGGG + Intergenic
909905966 1:81195370-81195392 TGAGCAGAAAAGGACATGAGTGG - Intergenic
910435883 1:87205345-87205367 CCAGCACAAAGGAAGCTGAGAGG - Intergenic
910860116 1:91734648-91734670 GGACCTGGAAGGGACCTGAGGGG - Intronic
911129168 1:94371922-94371944 AGAGTGGAAGGGGACCTGAGTGG + Intergenic
913070031 1:115290261-115290283 AGAGCAGAAAAGGCCCTGAGAGG - Intronic
915533564 1:156519197-156519219 CTAGTAGAAAGGCAACTGAGAGG + Intergenic
915979149 1:160409367-160409389 CAAGCTGAAAGGGGCCTTAGAGG - Intronic
919570462 1:199242498-199242520 CGTTCAGAAAGGGACAGGAGAGG + Intergenic
920715428 1:208335914-208335936 AGGGCAGAAAGGGGCATGAGAGG + Intergenic
922472203 1:225883280-225883302 GGTGCTGGAAGGGACCTGAGAGG - Intergenic
922475766 1:225906072-225906094 GGTGCTGGAAGGGACCTGAGAGG + Intronic
923511837 1:234659747-234659769 TAAGCAGAAAGAGGCCTGAGCGG - Intergenic
1067299044 10:44992861-44992883 AGAGCTGAAAGGGATCTGGGGGG + Intronic
1069978820 10:72237921-72237943 AGAGCTGAAAGAGACCTTAGAGG + Intergenic
1073234077 10:101998586-101998608 AGAGCAGAAAGGAGCCTGGGTGG - Intronic
1074103517 10:110372509-110372531 GGAGGAGAAAATGACCTGAGAGG + Intergenic
1076210035 10:128632796-128632818 CCAGCAGAATGGGACCTGAGGGG + Intergenic
1077337883 11:2013594-2013616 AGAGCAGGGAGGGGCCTGAGAGG - Intergenic
1077740708 11:4842598-4842620 CGTGGAGAGAGGGACCTGATGGG - Intronic
1077881898 11:6357405-6357427 AGACCAGAAAGGGAGCTGAGTGG + Intergenic
1078399118 11:11008783-11008805 AGCGCAGTAAGGGAGCTGAGAGG + Intergenic
1080600679 11:33818702-33818724 AGAGCAGAAAAGTACCTGGGGGG - Intergenic
1083178927 11:60971969-60971991 CAACCAGAAAGGGGACTGAGAGG - Intronic
1083788962 11:64971737-64971759 CGCTGAGAAAGGGACCTCAGGGG + Intronic
1086352944 11:85961348-85961370 GGAGGTGAAAGGGACCTTAGAGG + Intronic
1089593449 11:119559857-119559879 GGAGCAGCAAGGGGCCTGTGAGG - Intergenic
1091206084 11:133822154-133822176 GGAGGAGAAAGAGAGCTGAGGGG - Intergenic
1202820867 11_KI270721v1_random:68776-68798 AGAGCAGGGAGGGGCCTGAGAGG - Intergenic
1092067031 12:5599289-5599311 GGGGCAGAAAGAGACCTGGGAGG - Intronic
1092261759 12:6956645-6956667 AGGGCAGAAAGGGATCTCAGGGG + Intronic
1095430530 12:42129156-42129178 AGAGCAGGAAGGGACCTAAGAGG + Intronic
1096052439 12:48622979-48623001 AGCGTGGAAAGGGACCTGAGTGG + Intergenic
1096743544 12:53711438-53711460 AGAACCAAAAGGGACCTGAGAGG + Intronic
1096828445 12:54296818-54296840 CAAGCAGAAAGGGACCTCCAAGG - Intronic
1098200790 12:68053276-68053298 TGACTAGAAAGAGACCTGAGGGG - Intergenic
1101259416 12:103013323-103013345 CGAGAAGAAAGAGACTTGAGAGG - Intergenic
1101556117 12:105811433-105811455 CGAGCAGATAGTGACCTGGATGG + Intergenic
1101687237 12:107037101-107037123 TGAGCAGAAAGACACCTAAGGGG + Intronic
1102484041 12:113244123-113244145 CCACCTGAAAGGGACCTAAGTGG - Intronic
1102792210 12:115657012-115657034 AGAGCTGAAAGAGACCTCAGTGG - Intergenic
1105431856 13:20344114-20344136 AGCGGAGAAGGGGACCTGAGCGG - Intergenic
1105779667 13:23695532-23695554 CGGGCACAAAGGGCCCTGCGGGG + Intergenic
1106034541 13:26031836-26031858 AGCGTAGAAGGGGACCTGAGCGG + Intergenic
1107401545 13:40074301-40074323 AGAGCAGAAGGGTCCCTGAGTGG - Intergenic
1108856422 13:54799416-54799438 CGTGCAGAAGGGGACCCCAGCGG + Intergenic
1110232740 13:73183548-73183570 CGAGCATGAAGGCACATGAGGGG + Intergenic
1112103572 13:96216719-96216741 GCAGGAGAGAGGGACCTGAGAGG - Intronic
1117442180 14:55770354-55770376 GGAGCTGAAAGGGATCTCAGAGG + Intergenic
1118180033 14:63483492-63483514 CGTGCAGAAAGGGCACAGAGAGG + Intronic
1118615051 14:67569438-67569460 AGAGCTGGAAGGGATCTGAGAGG + Intronic
1118926174 14:70191583-70191605 TGAGTATAAAGGGGCCTGAGAGG - Intergenic
1121005785 14:90489788-90489810 CCAGCAAAAAGTGACCGGAGAGG - Intergenic
1121224598 14:92312085-92312107 GGAGCAGAAAGGGCTCTGATGGG - Intergenic
1122829061 14:104386852-104386874 GCAGCAGAGAGGGACCTCAGGGG - Intergenic
1125321578 15:38494564-38494586 ACAGCACAAAGGGACCTGAAGGG + Exonic
1125714494 15:41811640-41811662 GGGGCAGAAATAGACCTGAGTGG + Intronic
1127117420 15:55742528-55742550 CGAGAAGGAAGAGACCAGAGTGG + Intronic
1127309866 15:57743176-57743198 CAGGCAGACAGGGCCCTGAGGGG - Intronic
1128306373 15:66601458-66601480 AGAGCAGCCAGGGACCAGAGTGG - Intronic
1128328949 15:66743152-66743174 CGAGGAAAAAGGTACCGGAGGGG - Intronic
1128577984 15:68789375-68789397 AGAGAAGAAAAGGCCCTGAGGGG - Intronic
1129300707 15:74623965-74623987 AGGGCAGGAAGGGACCTCAGGGG - Intronic
1129675592 15:77631346-77631368 GGGGCAGAAGGGGGCCTGAGAGG - Intronic
1129777146 15:78244222-78244244 TGTGCAAATAGGGACCTGAGAGG + Intronic
1132375138 15:101323853-101323875 TGAGCAGTAAGGGCCCAGAGAGG + Intronic
1133246625 16:4453353-4453375 CGAACAGAGAGGGAACTGGGGGG + Intronic
1133447025 16:5870240-5870262 GGGGCAGAAAGGGACCTAATGGG + Intergenic
1135262800 16:20995926-20995948 CGGGAAGGAATGGACCTGAGAGG - Intronic
1135550734 16:23396312-23396334 GGTGCTGGAAGGGACCTGAGTGG - Intronic
1137959587 16:52868841-52868863 AGTGTAGAAGGGGACCTGAGCGG - Intergenic
1138151172 16:54658538-54658560 GGAGCAGCAAGGGACCAGTGTGG + Intergenic
1138287765 16:55823020-55823042 CAAGCAGAAAATGAGCTGAGTGG + Intronic
1138303782 16:55956156-55956178 AGAGCTGAAAGAGACCTCAGAGG + Intergenic
1138552286 16:57754403-57754425 CTGGCAGGAAGGGAGCTGAGAGG + Intronic
1139352651 16:66347028-66347050 GAGGCAGAAAGGAACCTGAGAGG - Intergenic
1141021337 16:80499521-80499543 GGAGCAGAAAGGGATCTCTGAGG - Intergenic
1141465596 16:84204061-84204083 AGTGCACAAAAGGACCTGAGTGG + Intergenic
1142664909 17:1456919-1456941 CGAGCAGAAACGGACCGACGTGG - Intronic
1143498252 17:7324493-7324515 GGAGCAGGAGGGGACATGAGGGG + Intronic
1144626751 17:16847830-16847852 CAGGCAGAAAGGGGCCTCAGTGG + Intergenic
1144879682 17:18424880-18424902 CAGGCAGAAAGGGGCCTCAGTGG - Intergenic
1145152554 17:20519505-20519527 CAGGCAGAAAGGGGCCTCAGTGG + Intergenic
1145374935 17:22338418-22338440 CGACCCTGAAGGGACCTGAGGGG + Intergenic
1145992552 17:29087829-29087851 TGAGCGGAAGGGAACCTGAGGGG + Intronic
1146163886 17:30573666-30573688 CAGGCAGAAAGGGGCCTCAGTGG + Intergenic
1150804494 17:68308604-68308626 AGTGTGGAAAGGGACCTGAGCGG + Intronic
1151405863 17:73885700-73885722 AGAGGAGGAAGGGACCAGAGTGG - Intergenic
1153261580 18:3229400-3229422 CGAACTGAAAGAGACCTAAGAGG - Intergenic
1157756162 18:50219405-50219427 TGAGCTGAAAGGGACCTGAGAGG - Intergenic
1160554391 18:79716590-79716612 AGGGCAGACAGGCACCTGAGGGG - Intronic
1164527284 19:29021686-29021708 GGAGCAGGCAGGAACCTGAGTGG + Intergenic
1165403608 19:35617255-35617277 AGAGGAGGAAGGGACCTGAGGGG - Intronic
1165572973 19:36791189-36791211 CGACCCTGAAGGGACCTGAGCGG - Intergenic
1166782379 19:45349307-45349329 AAAGCAGAGAGTGACCTGAGAGG - Intronic
925370166 2:3339210-3339232 CCAGCAGGTAGGTACCTGAGTGG + Intronic
925688674 2:6497680-6497702 GGCCCAAAAAGGGACCTGAGAGG - Intergenic
925802816 2:7618243-7618265 GGAGGAGAAAGGGAGCTAAGTGG - Intergenic
926140012 2:10362874-10362896 TGAGCAGAGGGGGACCTCAGAGG + Intronic
928435864 2:31254068-31254090 TGTGCAGAAAGGGGCCTGTGGGG - Intronic
929465848 2:42143100-42143122 ACATCAGAAAAGGACCTGAGTGG - Intergenic
930037026 2:47092614-47092636 GGAGGAGAAAGGGAGCAGAGGGG + Intronic
930171789 2:48259032-48259054 AGAGCTGAAAGGGATATGAGAGG + Intergenic
931681444 2:64752290-64752312 CGTGCAGAAATGCACCTGTGGGG - Intergenic
932152545 2:69386852-69386874 CCGGGAGAAAGGCACCTGAGAGG - Intronic
933712010 2:85333766-85333788 CGCACAGAAGGGGACCTGAGTGG + Intergenic
936944906 2:117921507-117921529 GTAGCAGAAAGGGCCCGGAGAGG + Intronic
943899348 2:193412353-193412375 AGTGTGGAAAGGGACCTGAGCGG + Intergenic
943902401 2:193456656-193456678 AGTGTGGAAAGGGACCTGAGCGG - Intergenic
944506614 2:200418818-200418840 CGAGCAGATGGGAACCTTAGTGG + Intronic
945376962 2:209089173-209089195 CTGGCAGAAAGGGACTTGGGTGG + Intergenic
946179012 2:217938844-217938866 AGGGCAGACAGGGAGCTGAGCGG - Intronic
947565456 2:231190437-231190459 CGTGCAGTAAGGGACCCGGGTGG + Intergenic
948331684 2:237172295-237172317 TGAGCAGAAATGGGCTTGAGAGG - Intergenic
1169091386 20:2863228-2863250 GGAGGAGAAAGGGAGCAGAGTGG - Intronic
1169193043 20:3669774-3669796 GGAGCAGGAAGGGAGCTGAGAGG - Intronic
1169855038 20:10093046-10093068 AGAGCTGAAAGGGACTTCAGAGG + Intergenic
1171527861 20:25829993-25830015 CGACCCTGAAGGGACCTGAGGGG - Intronic
1171548965 20:26025887-26025909 CGACCCTGAAGGGACCTGAGGGG + Intergenic
1172021450 20:31917212-31917234 TGAGTGGAAAGGGGCCTGAGAGG - Intronic
1172169062 20:32917917-32917939 AAAGCAGGAAGGGACCTTAGGGG + Intronic
1172441297 20:34968528-34968550 CGAGCAGGGAGGGGCCTGGGAGG - Intergenic
1172896348 20:38302956-38302978 TGAGCAGACAGGGACCTGTCTGG + Intronic
1173002225 20:39112458-39112480 GGAGCAGAAAGAGAAGTGAGGGG + Intergenic
1173821468 20:46022650-46022672 CGAGCAGACAAGGAGCTAAGTGG - Intronic
1177399551 21:20584862-20584884 AGCGTAGAAGGGGACCTGAGTGG - Intergenic
1178311798 21:31535987-31536009 CCAGCAGAAAAGGTCCTGGGAGG + Intronic
1181056920 22:20264700-20264722 GGTGCAGAGAGGGACCCGAGAGG + Intronic
1182267714 22:29131440-29131462 GGAGCAGAAAGGAACTTGTGAGG - Intronic
1183172577 22:36198924-36198946 GGAGCAGAGAGGGAGGTGAGAGG + Intronic
1183748087 22:39703859-39703881 AGAGCAGAAAGGGGCCAGTGGGG - Intergenic
953913383 3:46903951-46903973 CCAGCAGAAAGGGCCCAGAGTGG + Intergenic
954038464 3:47866452-47866474 AGAGCAGAAAGGGAAATGGGAGG + Intronic
954105162 3:48405883-48405905 GGGGGAGAAGGGGACCTGAGAGG + Intronic
956283619 3:67585398-67585420 GGAGCACAAAGGGAGCAGAGAGG - Intronic
957002137 3:74899498-74899520 AGCGCAGAAGGGGACCCGAGCGG + Intergenic
959323453 3:104906974-104906996 GGTGCAGAAGGGGACCTGAGTGG - Intergenic
959422150 3:106142320-106142342 GGAGCACCAAGGGACCAGAGAGG + Intergenic
964475056 3:157090624-157090646 GGAACAGAAATGGACCTGAGAGG + Intergenic
964802758 3:160573510-160573532 AGTGTGGAAAGGGACCTGAGTGG + Intergenic
968536480 4:1133798-1133820 AGAGCAGGAAGGGACCTTACGGG - Intergenic
972453603 4:39230202-39230224 GGAACAGAGAGGGACTTGAGTGG - Intronic
973774446 4:54231572-54231594 CGAGGAGAAAGGGAGAAGAGGGG - Intronic
976102618 4:81581287-81581309 AGTGCAGAAGGGGACCAGAGCGG - Intronic
979415613 4:120434652-120434674 AGAGCAGAAAAGGAGATGAGAGG + Intergenic
980103664 4:128566452-128566474 CCAGCAGAAGGGGACCTGTGGGG + Intergenic
980655271 4:135774786-135774808 AGCGCGGAAGGGGACCTGAGCGG + Intergenic
981294561 4:143116573-143116595 AGAGCAGAAAGGAACCTAATGGG + Intergenic
983595672 4:169464386-169464408 GGATCAGAAAGGGATCTGAAGGG + Intronic
983717730 4:170805602-170805624 TGAGCAGAAGGGCACCTAAGAGG + Intergenic
990908827 5:60833301-60833323 TGAGCTGCAAAGGACCTGAGAGG - Intronic
991364907 5:65858414-65858436 GGAGCAGACAGAGAGCTGAGGGG - Intronic
995207690 5:109501137-109501159 CCAGCATATAGGGAGCTGAGTGG + Intergenic
995539476 5:113170505-113170527 CAAGCAGATAGGGACATGGGTGG - Intronic
996216087 5:120868473-120868495 GGAGCAGAAGGGGCACTGAGTGG + Intergenic
997695198 5:135856142-135856164 TGAGGAGACAGGGAACTGAGTGG - Intronic
998152475 5:139765163-139765185 CGAGCAGAAGGGGCACTGAGTGG - Intergenic
998701640 5:144709216-144709238 CGCGTGGAAAGGGACCTGAGTGG - Intergenic
999324131 5:150632613-150632635 AGAGCCGAAAGGGCCCTTAGAGG - Intronic
1000941590 5:167368864-167368886 TGATCAGAAGAGGACCTGAGGGG - Intronic
1003353957 6:5347300-5347322 TGACCAGAAAGGGGCATGAGGGG - Intronic
1004181653 6:13385873-13385895 AGAGCAGAGAGGGAACTGAAGGG - Intronic
1004235389 6:13871184-13871206 AGTGCAGAAGGGGACCAGAGCGG + Intergenic
1006113483 6:31762935-31762957 ACAGCAGGAAGGGGCCTGAGAGG + Exonic
1007252877 6:40508307-40508329 TGAGCAGAGAGAGACCAGAGTGG - Intronic
1007736903 6:43987533-43987555 AGGGCAGAATGGGCCCTGAGGGG + Intergenic
1008867312 6:56228323-56228345 AGAGCAGAAAGTGATTTGAGAGG + Intronic
1012949484 6:105503039-105503061 AGAGAAGAAGGGGACCTGATGGG - Intergenic
1013217676 6:108043838-108043860 CGAGCAGAAAGGGACCTGAGAGG - Exonic
1013467765 6:110432550-110432572 TGAGCAGAAATCCACCTGAGAGG + Intronic
1015178099 6:130333361-130333383 GGAGCACAAAGGGACATGGGTGG - Intronic
1016236591 6:141875307-141875329 CGAGGAGAGAAGGAACTGAGTGG - Intergenic
1017616758 6:156254260-156254282 CTAGAAGAAAGGGACTTGATGGG - Intergenic
1019538229 7:1539735-1539757 CGTTCAGAAAGGGTCCTGTGGGG + Intronic
1028361812 7:89976778-89976800 AGAGCATAAGGGAACCTGAGAGG - Intergenic
1032947444 7:136869846-136869868 CCAGCAGGAAGGAACCCGAGGGG - Intronic
1034245322 7:149639706-149639728 CCAACAGAAAGGGAGCTGACGGG - Intergenic
1034407158 7:150912299-150912321 CCAATAGAAAGGGCCCTGAGTGG - Intergenic
1034415230 7:150961081-150961103 TGAGCAGAGGGGGAGCTGAGAGG - Intronic
1034737392 7:153441538-153441560 GGACCAGAAAGGGATCTGAAGGG - Intergenic
1035332631 7:158106253-158106275 AGAGCAGAAATGGAGCTGGGGGG - Intronic
1035673755 8:1440075-1440097 CTAGAATAATGGGACCTGAGAGG - Intergenic
1037648857 8:20818602-20818624 CGAGCAGAAAGCGCGCGGAGTGG - Intergenic
1040525338 8:48217921-48217943 AGAGCAGAAGGGGACCTTTGTGG - Intergenic
1040649885 8:49435443-49435465 AGAGTGGAAGGGGACCTGAGCGG - Intergenic
1041748855 8:61237515-61237537 TGAGCTGAAAGGGACCTCAGAGG + Intronic
1045392317 8:101727797-101727819 GGAGCAGAGAGAGAACTGAGAGG - Intronic
1048852060 8:138654826-138654848 CGAGAGGAAAAGGTCCTGAGAGG - Intronic
1050774052 9:9238005-9238027 GGAGGAGAAAGGGACTTGAAGGG - Intronic
1051027611 9:12632065-12632087 CAAGCATAAAGGGAGCAGAGGGG + Intergenic
1051892805 9:21959879-21959901 GGTGCAGAAGGGGACCCGAGTGG - Intronic
1054149355 9:61588733-61588755 CGACCCTGAAGGGACCTGAGGGG + Intergenic
1054469115 9:65519844-65519866 CGACCCTGAAGGGACCTGAGGGG + Intergenic
1056914219 9:90730646-90730668 AGGGAAGAAAAGGACCTGAGTGG - Intergenic
1057766529 9:97924613-97924635 CAAGCAGAAAGGGTCCCGAGAGG + Intergenic
1058807914 9:108610247-108610269 CAAGAAGAAAGGGTCCTAAGTGG - Intergenic
1061059485 9:128243438-128243460 GGAGGAGACAGGGACCTGGGAGG - Intronic
1186708855 X:12171897-12171919 CAAGCAGAGAGGGACCTCTGGGG - Intronic
1189161706 X:38815693-38815715 TGATCAGAAAGGAACATGAGGGG - Intergenic
1189994747 X:46627716-46627738 AGAGCAGAAAGGGAAATCAGGGG + Intronic
1190801850 X:53796498-53796520 CAAGCAGAAAGGGGCGGGAGGGG + Intergenic
1191669033 X:63731911-63731933 AGAGCTGGAAGGGACTTGAGAGG - Intronic
1191911547 X:66156963-66156985 AGAGCTGAAAGGGACCTCAAAGG + Intergenic
1200166751 X:154041025-154041047 CGCGCACAAAGGGACCGGGGCGG + Intronic
1201340524 Y:12927900-12927922 CTAGCAGAAAGTGACATGAGAGG + Intergenic
1202109980 Y:21408199-21408221 AGTGTGGAAAGGGACCTGAGGGG - Intergenic