ID: 1013217679

View in Genome Browser
Species Human (GRCh38)
Location 6:108043854-108043876
Sequence CTGCTCGCTGAACCTTAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013217676_1013217679 -7 Left 1013217676 6:108043838-108043860 CCTCTCAGGTCCCTTTCTGCTCG 0: 1
1: 0
2: 2
3: 18
4: 195
Right 1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1013217673_1013217679 22 Left 1013217673 6:108043809-108043831 CCACTGTCCAACAGTCTTACAGT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1013217674_1013217679 15 Left 1013217674 6:108043816-108043838 CCAACAGTCTTACAGTGAGCATC 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013217679 Original CRISPR CTGCTCGCTGAACCTTAAGC TGG Exonic
900790126 1:4674519-4674541 CTGACCTCTGAACCTAAAGCAGG - Intronic
909650164 1:77966078-77966100 CTGCAAGCTGAACCTTCAGTAGG + Intronic
922483820 1:225957988-225958010 CTGCACACTGAGCCTTAAACGGG - Intergenic
922985606 1:229863957-229863979 CTGCTCACTGAAAGTCAAGCAGG + Intergenic
1068959983 10:62857651-62857673 GTGCTCACTGAACCTGAAGAGGG - Intronic
1077221089 11:1416780-1416802 GGGCTCACTGAACCTCAAGCAGG - Intronic
1083492298 11:63021953-63021975 CTGCTCTCTGAACCCTTGGCAGG + Intergenic
1096493933 12:52028283-52028305 CTGCTCCCGGCCCCTTAAGCAGG - Intronic
1096989035 12:55783497-55783519 CTGTTCACTGAGACTTAAGCTGG + Intronic
1099931105 12:89076012-89076034 CTGATCACTGAAGCTAAAGCAGG + Intergenic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1110266179 13:73540435-73540457 CCGCTAGCTGAATTTTAAGCTGG + Intergenic
1133667487 16:7983456-7983478 CTGCTCACTGAACCAGAGGCTGG - Intergenic
1134597220 16:15505431-15505453 CTTCATTCTGAACCTTAAGCAGG + Intronic
1141453351 16:84120351-84120373 CTGCTCACTGACCCAGAAGCTGG - Intergenic
1147242815 17:39101674-39101696 TTGCTCCCAGAACCATAAGCCGG + Intronic
1153956888 18:10104029-10104051 CTGCTGGCTGCATCCTAAGCAGG - Intergenic
1159132845 18:64300295-64300317 CTGCCCGTATAACCTTAAGCAGG + Intergenic
1160965030 19:1743597-1743619 CAGCTCCCTGAACCTTAAAAAGG - Intergenic
1165711524 19:38014438-38014460 CTGCCCCCAGAACCTTCAGCTGG - Intronic
925450836 2:3968200-3968222 CTGGTGGCTGAACCCTGAGCTGG - Intergenic
927841743 2:26449433-26449455 CTGCCCTCTGAACCTGCAGCTGG + Intronic
933199741 2:79435303-79435325 CTGCACTCTGAACATTAAGCAGG - Intronic
941448397 2:165629278-165629300 CTGTACGCAGAACCTGAAGCAGG - Intronic
1182087723 22:27573209-27573231 CTGCTCTCAGAACCTGAAGTCGG + Intergenic
953983544 3:47424918-47424940 CTCCTCTCTGAACCTTAGTCTGG - Intronic
954314904 3:49795758-49795780 CTGCTCGCTGGACCAAAAGGGGG + Exonic
958446299 3:94219136-94219158 CTGCTCCTTAAACCTTGAGCAGG - Intergenic
982148713 4:152427926-152427948 CTGGTTGCTGAACCTTTTGCAGG - Intronic
984257101 4:177402093-177402115 CTGTTCACTAAACCTAAAGCAGG + Intergenic
1006153508 6:32001781-32001803 CTTCTCGGAGAACCTTAACCTGG - Exonic
1006159816 6:32034518-32034540 CTTCTCGGAGAACCTTAACCTGG - Exonic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1013289776 6:108709953-108709975 CCGCCCGCTGAACCTCCAGCAGG + Intergenic
1015368618 6:132425444-132425466 CTGCTGGCTGAAACCTGAGCAGG + Intergenic
1019146890 6:169981388-169981410 CTGCTCACTGAACCTGGAGGGGG + Intergenic
1027554892 7:79651458-79651480 CTGCTCACTGAAGCATAAGTGGG - Intergenic
1031418002 7:121516392-121516414 CTGCTCTGTGAACCTTATGGAGG - Intergenic
1041873751 8:62664291-62664313 GTGCTGGCTGAACCTCAAACTGG - Intronic
1057231418 9:93323872-93323894 CAGCTCACAGAACCTTGAGCTGG - Intronic
1057236678 9:93366751-93366773 CAGCTCACAGAACCTTGAGCTGG + Intergenic
1060756084 9:126214979-126215001 CTGCTCCCTGAACCCTTTGCTGG + Intergenic
1061840577 9:133356537-133356559 CCGCTCGCAGAACCTGGAGCCGG - Exonic
1195427301 X:104748748-104748770 CTGCTCTCTGAATTCTAAGCTGG - Intronic
1195702783 X:107717176-107717198 CCCCTCCCTGAACCTTAGGCTGG + Intronic
1198504375 X:137286900-137286922 CTGATCCCTTAACCCTAAGCAGG + Intergenic