ID: 1013220169

View in Genome Browser
Species Human (GRCh38)
Location 6:108071236-108071258
Sequence GAATTAGTTGTCTCTTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013220169_1013220174 11 Left 1013220169 6:108071236-108071258 CCTCCCCAAGAGACAACTAATTC 0: 1
1: 0
2: 1
3: 7
4: 127
Right 1013220174 6:108071270-108071292 CTCATGACACATTTTTCCATAGG 0: 1
1: 0
2: 1
3: 30
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013220169 Original CRISPR GAATTAGTTGTCTCTTGGGG AGG (reversed) Intronic
903810379 1:26031766-26031788 AAAGCAGATGTCTCTTGGGGAGG + Intronic
907024929 1:51107417-51107439 CTATTAGTTGTCTTTTGGTGGGG - Intronic
907885026 1:58585062-58585084 GAATGGGTTGTCTTGTGGGGAGG - Intergenic
910238848 1:85064405-85064427 GGAATAGTTGTCTCTAGGGGTGG + Intronic
910473205 1:87577610-87577632 GCATTAGTTGACTCTTTAGGAGG - Intergenic
913103185 1:115588377-115588399 GAATTATTGGTCACTTGGTGTGG + Intergenic
914447290 1:147760679-147760701 GAATTGGTTTTCTATTGGGTAGG - Intronic
915106836 1:153540053-153540075 GAAAGAGCTGTGTCTTGGGGAGG - Exonic
916286702 1:163113454-163113476 GAATTTGTTGACTCTTGGCATGG - Intronic
916314215 1:163429369-163429391 GAATTGGTTATCTCTGGGAGGGG + Intergenic
918092945 1:181313215-181313237 GAATTATTTGTGTGTGGGGGGGG + Intergenic
918310991 1:183285116-183285138 GCAGGAGTTATCTCTTGGGGTGG - Intronic
918354513 1:183694157-183694179 GAATTTTATGTCTCTTGGGAAGG + Intronic
918704753 1:187646539-187646561 GGAAGAGTTGTCTCTTGGGTTGG - Intergenic
922158066 1:223055455-223055477 AGAGTAGTTGCCTCTTGGGGTGG - Intergenic
1063236202 10:4119107-4119129 GTCTTAGTTTCCTCTTGGGGAGG + Intergenic
1063547473 10:6996338-6996360 GAATAATTTTTCTCTTGGGGAGG - Intergenic
1064124894 10:12651133-12651155 GAATGATTTGTCTCAGGGGGAGG - Intronic
1064447738 10:15410845-15410867 GTATTACTTGTCTCTTGGCTAGG + Intergenic
1066507125 10:36057050-36057072 GAGTTAGTTGCATTTTGGGGGGG + Intergenic
1068229026 10:54146067-54146089 CAAATATTAGTCTCTTGGGGAGG - Intronic
1070019353 10:72568691-72568713 GAATTAGTTGGCTATTGATGGGG - Intronic
1071289247 10:84176718-84176740 TAATTTGTTGACTTTTGGGGGGG - Intronic
1073874464 10:107906270-107906292 GAATTAGTATTCTGTTGGAGGGG - Intergenic
1075150154 10:119921772-119921794 AAATTAGATGACTCTTAGGGTGG + Intronic
1075276516 10:121098122-121098144 GAATTAATGGTGTCTTGGGAAGG - Intergenic
1077640898 11:3880659-3880681 GATTTATTTTTCTTTTGGGGAGG - Intronic
1078018997 11:7639994-7640016 GAACAAGTTGTACCTTGGGGTGG + Intronic
1079935747 11:26614162-26614184 GAAGCAGTTGTTTCTGGGGGTGG + Intronic
1081244121 11:40743312-40743334 GTATTAGTTTTCTCTTGCTGCGG + Intronic
1081681047 11:45003026-45003048 GCAGTAGTTGCCTGTTGGGGAGG - Intergenic
1083750839 11:64759737-64759759 AAAGTAGTAGTCTCGTGGGGTGG + Exonic
1085010873 11:73141308-73141330 TAATTTGTTTTCCCTTGGGGTGG + Intronic
1086617008 11:88833285-88833307 CAATTATTTGTATTTTGGGGGGG - Intronic
1089104647 11:115992297-115992319 GAAGCAGTTCTCTCTAGGGGTGG - Intergenic
1091706687 12:2698496-2698518 GTATTTGTTGTCTATCGGGGAGG - Intergenic
1092379352 12:7982365-7982387 GACTTAGTTGTATCTGGGTGTGG + Intergenic
1092852976 12:12647640-12647662 GAATTAGTTGAGACTTCGGGGGG - Intergenic
1100959381 12:99945634-99945656 AAATTAGGTGACTCTTGTGGAGG + Intronic
1102395189 12:112579679-112579701 GCAGTAGTTGTCTCTAGGGATGG - Intronic
1107535857 13:41330678-41330700 AAATTAGGTGTCTCTTGGGTGGG + Intronic
1112474327 13:99717128-99717150 GAATTATCTGTTTCTTGGGCTGG + Intronic
1112593158 13:100782931-100782953 GAATATGATGTCTCTTGGTGGGG + Intergenic
1114704241 14:24709249-24709271 AGATTAGTTGTCTCATGGTGGGG + Intergenic
1120359238 14:83475996-83476018 GAATTTGTTGATTCTTGGTGTGG + Intergenic
1121292420 14:92787091-92787113 GCATCAGTTATCTCTTGGGAGGG - Intergenic
1128109587 15:65068037-65068059 GAATTTGGTGGCGCTTGGGGTGG - Exonic
1128448522 15:67786258-67786280 GAATTGGTAGTCTCTTGGGGTGG + Intronic
1131886173 15:96915590-96915612 GAATACATTGTTTCTTGGGGAGG - Intergenic
1132176462 15:99719463-99719485 AGACTAGTTGTCTCTAGGGGCGG - Intronic
1133687592 16:8180785-8180807 GAATCAGTTCTCTGTTGGGGAGG + Intergenic
1134208503 16:12256937-12256959 GTATTAGTTTTCTTTTGGTGTGG + Intronic
1135408723 16:22217277-22217299 GAAGTAGTTGCCTCTAGGGTTGG + Intronic
1139118462 16:63986061-63986083 AAACTAGTTGTCTCCTGGGTGGG - Intergenic
1144046873 17:11461861-11461883 GAATTAGTTAACTCTGGGAGGGG + Intronic
1149029630 17:52068174-52068196 GAAGTAATTGGATCTTGGGGTGG + Intronic
1149271650 17:54985010-54985032 ATATTAGTTGGCTCTTGGGAGGG + Intronic
1149274774 17:55021223-55021245 GAATTAGCAGATTCTTGGGGTGG + Intronic
1157578586 18:48760045-48760067 GCGTGAGATGTCTCTTGGGGTGG + Intronic
1157884554 18:51354008-51354030 GAATTAGCACTTTCTTGGGGTGG - Intergenic
1160448151 18:78943037-78943059 TAATTAGTTGTCGCATGGTGAGG + Intergenic
1163823040 19:19507204-19507226 GAATTTGATGTTTTTTGGGGTGG + Exonic
1166294327 19:41881512-41881534 GAACAAGATGTCTCTTGGGAAGG + Intergenic
1166468340 19:43054806-43054828 GAAATAGTTGTTACCTGGGGTGG - Intronic
1166488775 19:43239124-43239146 GAAATAGTTGTTACCTGGGGTGG - Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
927463894 2:23322869-23322891 GTCTTCGTTGTCTCTTTGGGTGG + Intergenic
929549643 2:42881277-42881299 GAGTTAGTTGTCTCCTGCTGTGG - Intergenic
930005949 2:46896885-46896907 GAATGAATTCTCTCTTGAGGTGG + Intergenic
931861461 2:66359054-66359076 AAATTATTTTTTTCTTGGGGCGG - Intergenic
936837682 2:116727660-116727682 GAATTAGCTGGCTGTTGTGGTGG - Intergenic
939389029 2:141543126-141543148 AAATTGGTTGTCTCTTGGAGAGG + Intronic
942384131 2:175423455-175423477 CAAGGAGTTGTCTCCTGGGGAGG + Intergenic
943148582 2:184079153-184079175 AAATCAGTTGTTTCTTAGGGTGG - Intergenic
944630491 2:201619102-201619124 GGCCTATTTGTCTCTTGGGGTGG + Exonic
945052942 2:205842764-205842786 AAATTAGTTGCCTCTGGGGAAGG - Intergenic
948659070 2:239495701-239495723 GAATTCTTTTTTTCTTGGGGGGG + Intergenic
1169833775 20:9854858-9854880 GCCTTAGTTGCCTCTTGGAGGGG + Intergenic
1171016312 20:21545021-21545043 GAATGAGCTATCTCCTGGGGTGG + Intergenic
1173963609 20:47093961-47093983 AAAGTAATTGTCTTTTGGGGAGG - Intronic
1177185838 21:17795247-17795269 GAATTCGATGACTCTTGGTGAGG - Exonic
1179267942 21:39821842-39821864 GAAATAGTTGTTTCTGGGTGTGG - Intergenic
1184269456 22:43370511-43370533 GAAATAGTTGCCTCTGGGGAGGG - Intergenic
949321908 3:2820634-2820656 TAATTAGGTGACTCTTGGTGAGG - Intronic
953434124 3:42865197-42865219 GTATTGGTTGTGTCTTGGTGAGG + Exonic
954437142 3:50502444-50502466 GAGTTTGCTGGCTCTTGGGGAGG + Intronic
959344753 3:105179278-105179300 GAAGCTGTTGTTTCTTGGGGTGG - Intergenic
963457944 3:145570638-145570660 GAATTAGTTTTCTCTTGATTTGG - Intergenic
965418443 3:168426535-168426557 GACTTTGGGGTCTCTTGGGGTGG + Intergenic
965914685 3:173828915-173828937 GAATTTGTTGCTTTTTGGGGGGG + Intronic
966878115 3:184335152-184335174 AAATTTGGTGTGTCTTGGGGTGG + Exonic
967998436 3:195184590-195184612 GACTTAAATGTTTCTTGGGGGGG - Intronic
968401056 4:297967-297989 GAATCAAATTTCTCTTGGGGAGG - Intronic
976669120 4:87632442-87632464 GGCTAAGTTGTCTCTGGGGGAGG - Intergenic
978033125 4:103960259-103960281 AAATTAGTTGTGTCTGGTGGCGG + Intergenic
980771902 4:137384695-137384717 GATTTATTTGTTTCTTGTGGGGG - Intergenic
988924305 5:35973771-35973793 GATTTAATTGCATCTTGGGGTGG + Intronic
990016853 5:51073634-51073656 GAATTATTTGACTCTTGTGAAGG + Intergenic
998496888 5:142598559-142598581 GATATAGTTATCTCTGGGGGTGG - Intronic
999344971 5:150809714-150809736 GAAAGAGTTCTCACTTGGGGCGG - Intergenic
1004238004 6:13892113-13892135 GAATTATTGGTCTCTTTGTGGGG + Intergenic
1007383122 6:41503302-41503324 GAATTAAGTGTCACTTGCGGAGG - Intergenic
1010799210 6:80154460-80154482 GAATTAGTTGTGTCCTAGGAGGG - Intronic
1010991749 6:82486867-82486889 GAATTATTGGTCTCTGGGTGGGG - Intergenic
1012641770 6:101626384-101626406 TGATCAGCTGTCTCTTGGGGTGG + Exonic
1012736048 6:102945196-102945218 GAATTTGTTGTTTCTTGGAAAGG + Intergenic
1013220169 6:108071236-108071258 GAATTAGTTGTCTCTTGGGGAGG - Intronic
1020479570 7:8641526-8641548 AAAATTGTTGTCTCTGGGGGTGG - Intronic
1021915544 7:25428519-25428541 GAATTATTTTTATTTTGGGGTGG + Intergenic
1022734485 7:33063053-33063075 GAATTAGATTTCTACTGGGGCGG - Intergenic
1024122349 7:46257459-46257481 GGATTAATACTCTCTTGGGGTGG - Intergenic
1025032329 7:55568059-55568081 GGAATAGTTGTCTCTTAGAGAGG - Intronic
1026309580 7:69172084-69172106 GCCTTAGGTGTCTCATGGGGAGG + Intergenic
1026442787 7:70458601-70458623 GAAGTAGTTGTTTTTTAGGGTGG + Intronic
1027051828 7:75025560-75025582 GGTCTAGTTGTCTGTTGGGGAGG - Intergenic
1033247474 7:139729967-139729989 GGTTTACTTGTCTCTTGAGGTGG - Intronic
1037267010 8:17074643-17074665 AAGTTAATTGTCTCTAGGGGTGG - Intronic
1038984193 8:32791044-32791066 AAATTAGTTGTCACTTGTGTTGG - Intergenic
1039387515 8:37149185-37149207 GAATTTGATGGCTCTGGGGGTGG - Intergenic
1040754470 8:50755274-50755296 AAATGAGTGGTTTCTTGGGGTGG - Intronic
1041140027 8:54807850-54807872 GAATTACTTCTTGCTTGGGGAGG + Intergenic
1041503299 8:58563435-58563457 GCATGAGTTTTCTTTTGGGGAGG + Intronic
1051346104 9:16152567-16152589 GAATAAGATGGCTCTTGGGGTGG + Intergenic
1059627360 9:116081334-116081356 GATTTTGTTATCTCTTGTGGGGG - Intergenic
1061775014 9:132956669-132956691 GCATTAGTTGTCTATTGCTGTGG + Intronic
1062384582 9:136304091-136304113 TAATGAGCTGTCTCTTGGTGGGG + Intronic
1186375192 X:8991085-8991107 GAATTAGGTAACTCTTGAGGAGG - Intergenic
1188225065 X:27587409-27587431 GAATTAGTAGGCCCCTGGGGTGG + Intergenic
1188537661 X:31215335-31215357 GACTCAGATGCCTCTTGGGGTGG + Intronic
1190764921 X:53468056-53468078 GAAACAGTTGTCTCTAGGGCTGG + Intergenic
1192212753 X:69137963-69137985 AAATTAGTTGTGTCTGGGTGGGG + Intergenic
1194365810 X:93012195-93012217 GAATTAGTGGTATATTGGAGAGG - Intergenic
1198116875 X:133552671-133552693 GAATTAGTTTCCTATTGGGAGGG - Intronic
1198622261 X:138526497-138526519 GAATGAGTTGTTTGTTGGGGAGG - Intergenic
1200674032 Y:6128442-6128464 GAATTAGTGGTATATTGGAGAGG - Intergenic
1201437821 Y:13978509-13978531 GAATTAGCTGTCTTTTGTAGTGG + Intergenic