ID: 1013225943

View in Genome Browser
Species Human (GRCh38)
Location 6:108119474-108119496
Sequence GCCCTGCCACGCCTGCGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 233}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013225943_1013225956 6 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225956 6:108119503-108119525 CACCGAGGAAGGCGTGGGGCAGG 0: 1
1: 0
2: 2
3: 28
4: 235
1013225943_1013225947 -5 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225947 6:108119492-108119514 AGGGCGCCCCCCACCGAGGAAGG 0: 1
1: 0
2: 1
3: 6
4: 89
1013225943_1013225964 27 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225964 6:108119524-108119546 GGGTGCAGGAAGGGGACCGAGGG No data
1013225943_1013225948 0 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225948 6:108119497-108119519 GCCCCCCACCGAGGAAGGCGTGG No data
1013225943_1013225950 1 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225950 6:108119498-108119520 CCCCCCACCGAGGAAGGCGTGGG No data
1013225943_1013225963 26 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225963 6:108119523-108119545 AGGGTGCAGGAAGGGGACCGAGG 0: 1
1: 0
2: 2
3: 48
4: 445
1013225943_1013225957 7 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225957 6:108119504-108119526 ACCGAGGAAGGCGTGGGGCAGGG No data
1013225943_1013225962 19 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225962 6:108119516-108119538 GTGGGGCAGGGTGCAGGAAGGGG 0: 1
1: 1
2: 12
3: 116
4: 1048
1013225943_1013225946 -9 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225946 6:108119488-108119510 TGGCAGGGCGCCCCCCACCGAGG No data
1013225943_1013225965 30 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225965 6:108119527-108119549 TGCAGGAAGGGGACCGAGGGAGG No data
1013225943_1013225960 17 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225960 6:108119514-108119536 GCGTGGGGCAGGGTGCAGGAAGG 0: 1
1: 0
2: 4
3: 72
4: 653
1013225943_1013225959 13 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225959 6:108119510-108119532 GAAGGCGTGGGGCAGGGTGCAGG 0: 1
1: 2
2: 2
3: 65
4: 718
1013225943_1013225952 2 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225952 6:108119499-108119521 CCCCCACCGAGGAAGGCGTGGGG No data
1013225943_1013225961 18 Left 1013225943 6:108119474-108119496 CCCCAGCGCAGGCGTGGCAGGGC 0: 1
1: 1
2: 2
3: 24
4: 233
Right 1013225961 6:108119515-108119537 CGTGGGGCAGGGTGCAGGAAGGG 0: 1
1: 0
2: 1
3: 56
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013225943 Original CRISPR GCCCTGCCACGCCTGCGCTG GGG (reversed) Intronic