ID: 1013226649

View in Genome Browser
Species Human (GRCh38)
Location 6:108123744-108123766
Sequence AGAGCAGAGACTGCCGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013226647_1013226649 0 Left 1013226647 6:108123721-108123743 CCTCAGGATGAAATGTGAGTACA 0: 1
1: 0
2: 2
3: 11
4: 190
Right 1013226649 6:108123744-108123766 AGAGCAGAGACTGCCGGTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 225
1013226646_1013226649 6 Left 1013226646 6:108123715-108123737 CCGCATCCTCAGGATGAAATGTG 0: 1
1: 0
2: 2
3: 15
4: 328
Right 1013226649 6:108123744-108123766 AGAGCAGAGACTGCCGGTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 225
1013226645_1013226649 7 Left 1013226645 6:108123714-108123736 CCCGCATCCTCAGGATGAAATGT 0: 1
1: 0
2: 5
3: 24
4: 215
Right 1013226649 6:108123744-108123766 AGAGCAGAGACTGCCGGTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013226649 Original CRISPR AGAGCAGAGACTGCCGGTGC TGG Intronic
901873940 1:12155292-12155314 TGAGCATAGACTGCCGGTGATGG + Intergenic
903802249 1:25977865-25977887 GGAGCAAAGACTGCCAGTGCAGG + Intronic
904370913 1:30046872-30046894 AGAGCAGAGCCTGCCAGTCACGG + Intergenic
905769565 1:40628842-40628864 AGAGCAGAGCCTGCTGGTACAGG + Exonic
906315527 1:44784446-44784468 TGAGCAGAGCCTGCAGGTGGAGG - Exonic
906519799 1:46460274-46460296 AGAGCTGAGTCTGAGGGTGCAGG + Intergenic
906581830 1:46941298-46941320 TGAGCAGCCACTGCCTGTGCAGG + Exonic
907401782 1:54228931-54228953 TGAGCAGAGCCTGCCGGAGCAGG - Intronic
909907744 1:81220719-81220741 AGAGGCGAGACTGCAGGAGCAGG - Intergenic
910473549 1:87580909-87580931 AGAACAGTGACTGCCTGTGTAGG - Intergenic
912972351 1:114295345-114295367 GGAGCAGAGTGTGGCGGTGCGGG - Intergenic
916416002 1:164592544-164592566 TGAGCAGAGTCTGAGGGTGCTGG + Intronic
919752006 1:201043547-201043569 AGAGCAGTGACTGGGGGTGAGGG + Intronic
919991284 1:202709926-202709948 GGCGCAGAGCCGGCCGGTGCAGG + Intronic
920294646 1:204948469-204948491 AGAGGGGAGACTGTGGGTGCTGG - Intronic
920315764 1:205074718-205074740 AGAGCAGAGTCTGGGGCTGCAGG - Exonic
921945018 1:220880181-220880203 AGAGCGGAGACAGCCGCTGCGGG - Exonic
1066317284 10:34260363-34260385 AGAGGAGACACTGACGGAGCAGG + Intronic
1066441803 10:35446713-35446735 GGAGCAGAGACTGACAGTGCTGG + Intronic
1069579783 10:69558374-69558396 AGAGGAGAGACAGGCGCTGCAGG + Intergenic
1069783781 10:70975077-70975099 AGAGCAGAGGCTGCATGGGCAGG + Intergenic
1069858196 10:71453350-71453372 TCTGCAGAGACTGCCGATGCGGG - Intronic
1070126138 10:73623517-73623539 AGAGCTGAGACTACAGGTGAGGG - Intronic
1072265083 10:93719651-93719673 AGAGCAGAGAATAACAGTGCTGG - Intergenic
1073059563 10:100725178-100725200 AGAGCAGACACTGGGGGTGGAGG - Intergenic
1073269002 10:102245726-102245748 TGAGCAGCGGCTGCCGGTCCTGG + Exonic
1074987673 10:118671945-118671967 AGAGCAGAGACACCCGGAGCTGG - Intergenic
1075819818 10:125297230-125297252 AGAGGAGAGGCTGAAGGTGCTGG - Intergenic
1076554215 10:131311557-131311579 AGAGGAGAGGCTGCCGCCGCCGG + Exonic
1077903634 11:6511567-6511589 AGAGCAGAAACTGCTGTTGCTGG - Intronic
1078448785 11:11424953-11424975 AGCGATGAGACTGCCTGTGCGGG + Intronic
1081915406 11:46727351-46727373 AAAGCTGAGACTGACGGAGCTGG + Intronic
1083856615 11:65396240-65396262 AGTGCAGAGGCTGCCGGCTCAGG + Intronic
1088544435 11:110945662-110945684 AGAGGAGAGGCTGCTGGTGGTGG - Intergenic
1089393378 11:118117270-118117292 AGAACAGAGACTGCTGGGGAGGG - Intronic
1091221155 11:133930817-133930839 GGGGCAAAGGCTGCCGGTGCTGG + Intronic
1091251035 11:134144523-134144545 AGAGCTGAGACTGCCTGAGTTGG + Intronic
1091702657 12:2674235-2674257 AGAGCACTGAGTGCCGGTGGAGG + Intronic
1092279060 12:7086042-7086064 AGAGCTGAGAATGACTGTGCTGG + Intronic
1092489504 12:8932678-8932700 GGAGCTGGGACTGCCGGTGCTGG - Exonic
1092906076 12:13101492-13101514 AGAGCAGGGACTGCCAGGGCAGG + Intronic
1096101140 12:48971098-48971120 AGAGGAGAGGCTCCAGGTGCAGG + Intronic
1096946430 12:55413494-55413516 GGAGCTGGGACTGCCAGTGCTGG + Intergenic
1097220813 12:57449926-57449948 AGAGCAGAGACAGGGGGCGCCGG - Exonic
1102045661 12:109828610-109828632 AGAGCAGCAACTGGCGGAGCTGG + Intronic
1102221129 12:111195096-111195118 GGACCAGTGACTGCAGGTGCTGG - Intronic
1104529229 12:129553331-129553353 AGAGCAGAGAGTGAGGGGGCAGG - Intronic
1104878633 12:132053954-132053976 AGAGCAGGTACTGCCTGTGTCGG + Intronic
1104985493 12:132594263-132594285 AGAGCAGAGATTGCCAGGGAGGG + Intergenic
1105708456 13:22983046-22983068 AGAGCAGAGGCTGTCAGGGCTGG - Intergenic
1105895845 13:24716993-24717015 AAAGCAGAGGCGGCGGGTGCGGG - Intergenic
1113425778 13:110207218-110207240 AGAGCAGAGACAGCTGGAACTGG - Intronic
1113428960 13:110232654-110232676 GGGACAGAGGCTGCCGGTGCTGG + Intronic
1113941750 13:114022022-114022044 CGTGCACAGACTGCTGGTGCTGG - Intronic
1115195860 14:30798667-30798689 AGGGCAGACACTGTGGGTGCTGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118895642 14:69943248-69943270 AGAGCAGATGCTGCTGTTGCTGG + Intronic
1119859465 14:77925796-77925818 AGATCAGAGACTGCCAGAGGTGG - Exonic
1121271143 14:92639020-92639042 AGAGCAGAGACCGCCTGGGATGG - Intronic
1122077917 14:99247490-99247512 AGGGCAGAGACTGGCTGTCCTGG - Intronic
1122269029 14:100560112-100560134 AGAGCAGAGACTGCTGAGGTTGG - Intronic
1123019330 14:105390304-105390326 AGAGGAGAGACTGCCTGCCCGGG + Intronic
1123762177 15:23441559-23441581 GGAGGAGAGACTGCGGGAGCAGG - Exonic
1124109151 15:26771832-26771854 CGGACAGAGACTGGCGGTGCCGG + Intronic
1124618026 15:31256597-31256619 AGAGCACAGACGGCGGGTGTGGG - Intergenic
1125509099 15:40283244-40283266 AGGGCAGAGACGGACGGGGCGGG + Intronic
1126878773 15:53072225-53072247 TGAGAAGAGACAGCTGGTGCAGG + Intergenic
1128034049 15:64507540-64507562 AGTGCAGAGCCTTCTGGTGCAGG + Intronic
1129029754 15:72609652-72609674 GGAGGAGAGACTGCTGGAGCAGG + Intergenic
1129037970 15:72662409-72662431 AAAGCAGAGACTCCAGGAGCAGG + Exonic
1129211919 15:74074822-74074844 AAAGCAGAGACTCCAGGAGCAGG - Exonic
1129398484 15:75266262-75266284 AAAGCAGAGACTCCAGGAGCAGG + Exonic
1129402092 15:75290538-75290560 AAAGCAGAGACTCCAGGAGCAGG + Exonic
1129729045 15:77919136-77919158 AAAGCAGAGACTCCAGGAGCAGG - Intergenic
1132546239 16:534681-534703 AGACCAGAGGCTGCTGGTCCAGG - Intronic
1133205929 16:4233543-4233565 TGAGCATAGACTGCTGGTGGGGG + Intronic
1134114776 16:11539642-11539664 AGGGGAGAGAGTGCAGGTGCTGG - Intergenic
1135629388 16:24023864-24023886 ACAGCAGAGCCTGGCTGTGCTGG - Intronic
1135748660 16:25038681-25038703 TGAGCAAAGACAGCAGGTGCAGG - Intergenic
1136591254 16:31219106-31219128 ACAGCAGAAACTGCAGCTGCAGG + Exonic
1137421591 16:48339598-48339620 AGAGCACAGACTGATGTTGCAGG + Intronic
1139381754 16:66536862-66536884 AGCGCAGAGAATGCCTGGGCAGG + Intronic
1140038569 16:71390057-71390079 TGAGCAAAGACTGCCTGGGCAGG - Exonic
1140726803 16:77820910-77820932 AGGGCAGGGACTGCTGGGGCAGG - Intronic
1141134160 16:81455049-81455071 AGAGCAGAGTCTACCAGTGTGGG + Intronic
1141149280 16:81552938-81552960 TCAGCAGAGACTTCCAGTGCAGG + Intronic
1141999327 16:87655161-87655183 AGAGCCGAGTCTGCCGCTGTGGG + Intronic
1142105322 16:88299406-88299428 AGGGCAGAGGCTCCAGGTGCCGG + Intergenic
1143628275 17:8123048-8123070 AGAGCTGAGGCTGCTGCTGCTGG - Exonic
1144001816 17:11062403-11062425 AGTGCAGAGCCTGACGGTTCTGG + Intergenic
1144886849 17:18468968-18468990 AGAGCAGGAACTGCAGGGGCTGG - Intergenic
1145145366 17:20475328-20475350 AGAGCAGGAACTGCAGGGGCTGG + Intergenic
1146353584 17:32116065-32116087 AGAGCAGGAACTGCAGGGGCTGG - Intergenic
1147374572 17:40016084-40016106 AGATCAGAGAGTGGGGGTGCAGG + Intronic
1149732746 17:58962715-58962737 AGAGCAAAGACAGCCTGTGGAGG - Intronic
1151532647 17:74716781-74716803 AAAGCAGAGAATCCCGGAGCTGG + Intronic
1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG + Intergenic
1151728758 17:75898900-75898922 AGCGCAGGGGCTGCCGGTGGGGG + Exonic
1153358388 18:4164382-4164404 CGATCAGACACTGCCGGGGCTGG + Intronic
1155366214 18:25051454-25051476 AGAGCAGAGGCAGCCTGTGTTGG + Intergenic
1155947897 18:31876924-31876946 AGAGCAGAGATTTCCTGGGCAGG - Intronic
1157389577 18:47289878-47289900 AGAGGAGAGCCTGCCTGGGCGGG - Intergenic
1159517257 18:69473576-69473598 AGAGCATAGACTGACAGTGCTGG - Intronic
1159731952 18:72038516-72038538 AGAGCAGAGACTGCTTGTTTTGG - Intergenic
1160757478 19:765193-765215 AGAGCAGAGACTGAGGGAGGAGG + Intergenic
1161265945 19:3364666-3364688 AGAGCAGAGACTGCCCCTCTTGG - Intronic
1161625758 19:5325643-5325665 GGAGCACAGATTGCCGGTGGGGG - Intronic
1162794524 19:13079625-13079647 AGCCCAGAGGCAGCCGGTGCTGG + Intronic
1163179793 19:15591234-15591256 AGAACAGGGACTCCAGGTGCAGG - Intergenic
1165479925 19:36056710-36056732 AGAGCACAGACTGCTGCTGATGG + Intronic
1166740180 19:45109854-45109876 AGAGCTGAGGCTGCAGATGCAGG - Intronic
925059312 2:878831-878853 AGGGCAGAGACTGCAGTTGAGGG - Intergenic
925385200 2:3457271-3457293 AGACCAGAGACTACCAGTGGGGG + Intronic
926311599 2:11679720-11679742 CGCACAGAGACTGCCGGGGCAGG - Intronic
926777653 2:16438419-16438441 AGAGCAGGGCCTGCCTGAGCTGG - Intergenic
927184456 2:20472402-20472424 GGAGCACAGAATGCCAGTGCTGG + Intergenic
927672657 2:25082112-25082134 AGAGCAGATCCTGCAGCTGCTGG - Intronic
928114457 2:28537148-28537170 AAAGCAGGGACAGCCGGTGAAGG + Intronic
928408372 2:31032684-31032706 AGAGGAGGGACTTCCTGTGCTGG - Intronic
930199001 2:48534860-48534882 AGAGAAGTGACTGGCGGAGCTGG - Intronic
931642333 2:64392859-64392881 AGAGCAGAAAGTGCCTGTGATGG + Intergenic
932340475 2:70960120-70960142 AGAGCAGAGGCTGGGGCTGCTGG + Intronic
932927541 2:75994300-75994322 AGAGCAGACACTACCTGTGGTGG + Intergenic
934847511 2:97671773-97671795 AGAGCAGAAACTGGCGAGGCAGG - Intergenic
936785992 2:116094832-116094854 AGAGCAGAGACTGCTGCTGTTGG + Intergenic
938369462 2:130760304-130760326 AGAGCTGACACTGCAGGGGCTGG - Intronic
938664565 2:133521162-133521184 ACAGCAGAGACTGCAGATCCAGG + Intronic
939566399 2:143790891-143790913 AGAGGAGAGACAGCCACTGCAGG + Intergenic
943121324 2:183739644-183739666 AGTACAGAGACTTCCGCTGCTGG + Intergenic
945200074 2:207272445-207272467 AGGGGAGAGACTGGTGGTGCTGG - Intergenic
946474282 2:219992714-219992736 AGAGCAGTGGCTGCTGGAGCTGG + Intergenic
947985303 2:234442457-234442479 ACAGCAGAGACTGCAGGCCCAGG - Intergenic
948251331 2:236532243-236532265 GGAGCAGCCACAGCCGGTGCTGG - Intergenic
948676992 2:239602629-239602651 AGAGCAGAGAGGCCCAGTGCAGG + Intergenic
948746213 2:240095869-240095891 GGTGCAGGGACGGCCGGTGCAGG + Intergenic
949007639 2:241658724-241658746 AGAGCAGAGCGTGAAGGTGCTGG + Intronic
1169550704 20:6698432-6698454 AGTGCAGAGACTGGCAGAGCGGG - Intergenic
1172280274 20:33703110-33703132 AGAGCAGAGACAGTCGGTAGCGG + Exonic
1174199302 20:48795866-48795888 AGAGCAGAGGCTGGTGGAGCAGG - Intronic
1175694495 20:61091262-61091284 AGGGCCGTGACTGCAGGTGCAGG - Intergenic
1175753524 20:61515186-61515208 GCAGCAGGGCCTGCCGGTGCTGG - Intronic
1175868886 20:62197969-62197991 TGAGCCGAGACTGCCGGACCTGG + Intronic
1178257213 21:31065145-31065167 TGGGCAGAGTCTGCCGGGGCGGG + Intergenic
1178940344 21:36900365-36900387 AGTGCAGAGGCTCCCGGAGCAGG + Intronic
1179357881 21:40678387-40678409 TGAGCAGTGAATGGCGGTGCAGG - Intronic
1179591552 21:42412451-42412473 AGGGGAGAGACTGCTGGTGAAGG + Intronic
1180159201 21:45991531-45991553 ACAGCTGAGTCTGCCGTTGCTGG + Intronic
1180670209 22:17547357-17547379 ATAGCTGGGACTGCAGGTGCCGG + Intronic
1181015628 22:20066848-20066870 AGAGCAGAGACTGCTCTTCCTGG - Intergenic
1181645909 22:24231848-24231870 AGAGCAGAGCCTGCGGGTTAGGG - Intronic
1182549802 22:31094505-31094527 AGAGCAGAGCCTGCCTGGGAGGG + Intronic
1183741056 22:39668871-39668893 AGGGCAGAGAGAGCCGGTGAGGG + Intronic
1183831859 22:40422465-40422487 TGAGAAGAGAATGCAGGTGCAGG + Intronic
1184175342 22:42785803-42785825 AGAGGAGAGGCTGCAGGAGCTGG + Intergenic
1184457529 22:44620247-44620269 TCAGCAGAGCCTGTCGGTGCAGG + Intergenic
1184573160 22:45339902-45339924 AGAGCCGGGGCTGCAGGTGCAGG - Intronic
1185053317 22:48565001-48565023 AGAGCACAGACAGCAGGTGTGGG - Intronic
1185182743 22:49372611-49372633 ACGGCAGAGACTGCAGCTGCGGG - Intergenic
1185204807 22:49531751-49531773 AGAGCAGAGTGTGCCGGGGTTGG - Intronic
949783534 3:7716027-7716049 AGAGGAGAGCCTGGTGGTGCAGG - Intronic
950711325 3:14814804-14814826 ACAGGAAAGACTGCAGGTGCTGG - Intergenic
951741048 3:25923726-25923748 AGAGCAGAGAGTGCTGCTCCAGG + Intergenic
954201284 3:49024840-49024862 AGAGATGAGACTGTCAGTGCAGG + Intronic
954268716 3:49490697-49490719 GTAGCTGAGACTGCAGGTGCAGG + Intronic
954644794 3:52124553-52124575 AGAGCAGAGGCTCCCAGGGCAGG + Intronic
954851771 3:53607181-53607203 ATAGCAAAGACTGCAGTTGCTGG + Intronic
960925968 3:122795216-122795238 AGAGGAGAGGCAGCCGCTGCTGG + Exonic
960994569 3:123332426-123332448 TGAGCAGAGCCTGCTGGTGATGG - Intronic
961488403 3:127233595-127233617 AGGGCACAGACAGCCGTTGCTGG + Intergenic
961585124 3:127915683-127915705 AGAGCCGAGGCTGCAAGTGCCGG - Intronic
961734710 3:128994078-128994100 AGAGGAGCGTCCGCCGGTGCAGG + Exonic
961816997 3:129556187-129556209 TGAGCAGAGACGGCTGGGGCGGG - Exonic
961820535 3:129573539-129573561 AGAGCAGAGGCTGGCACTGCTGG + Intronic
962436124 3:135368422-135368444 AGAGCAGAAACTTCCTCTGCCGG + Intergenic
964626498 3:158764796-158764818 AGAGCACAGAGTGCATGTGCAGG - Intronic
967268013 3:187708355-187708377 AAAGTAGAAACTGCTGGTGCCGG + Intronic
967868390 3:194208886-194208908 AGAACACAGAATGCTGGTGCTGG + Intergenic
968699582 4:2048203-2048225 AGAGCAGAGACTGGGGGAACAGG - Intergenic
968937504 4:3619823-3619845 AGGGCTGAGACTGGCAGTGCAGG + Intergenic
968967070 4:3774090-3774112 AGAGCAGACACTGCAGCAGCCGG - Intergenic
969297241 4:6277400-6277422 AGAGCGGGCTCTGCCGGTGCTGG + Intronic
971287900 4:25307990-25308012 AAGGCAGAGGCTGCCGGGGCAGG + Intergenic
973607956 4:52606473-52606495 AGACAAGAGACAGCAGGTGCAGG + Intronic
973981813 4:56314249-56314271 GGAGCAGAGGCTGCAGGCGCTGG + Exonic
975448876 4:74501040-74501062 GTAGCAAAGACTGCAGGTGCAGG + Intergenic
976593929 4:86876342-86876364 AGCGCAGCGACGGCCGGGGCCGG + Intronic
976829409 4:89297535-89297557 AGCGCAGAGACTGGTGGTGTAGG - Intronic
977666216 4:99649868-99649890 GGAGCTGAGGCTGCAGGTGCTGG + Exonic
982348277 4:154385614-154385636 AGTGCTGAGACTACAGGTGCAGG + Intronic
983180750 4:164645730-164645752 GGAGCTAAGACTGCAGGTGCAGG - Intergenic
983310894 4:166059880-166059902 GGAGCAGAGACTGCCATTTCTGG + Intronic
986368650 5:7059630-7059652 ACAGCATAGACTGCCTTTGCTGG + Intergenic
992200975 5:74383618-74383640 GGAGGAGAGACTGCAGATGCAGG - Intergenic
992618946 5:78573630-78573652 AAAGCAGAGACAGGCTGTGCAGG - Intronic
992769902 5:80036850-80036872 AGAGCAAAGACTGCCTATGAGGG + Intronic
992791432 5:80217806-80217828 AGATCAGGGACTTCCAGTGCAGG - Intronic
995243408 5:109911084-109911106 AGAGCAGAGAGGCCCAGTGCTGG + Intergenic
997633941 5:135390677-135390699 ACAGCATTGACTGCTGGTGCTGG - Intronic
997707308 5:135968613-135968635 AGAGAAGAGAGAGCCTGTGCAGG - Intergenic
998907069 5:146917232-146917254 ACAGCAAAGACAGCCTGTGCAGG - Intronic
1001533665 5:172482868-172482890 AGAACAGGGGCTGCCGGTTCCGG - Intergenic
1008054427 6:46931571-46931593 AGAGGAGGGACTGCCAGGGCAGG - Intronic
1011624439 6:89271730-89271752 AGAGCAGAGACAGCTGGTTAAGG + Intronic
1013226649 6:108123744-108123766 AGAGCAGAGACTGCCGGTGCTGG + Intronic
1013466107 6:110418419-110418441 ACAGCACATACTGCAGGTGCTGG + Intergenic
1014157966 6:118134152-118134174 AAAGGAGAAACTGCCTGTGCAGG + Intronic
1015355535 6:132273267-132273289 AGAGCAGTGGCTGCTGGAGCTGG + Intergenic
1018344004 6:162882173-162882195 AGACCAGAGACTGGGGGTGGGGG + Intronic
1019120575 6:169800871-169800893 AGAGGAGAGACTGCAGGGCCTGG - Intergenic
1019122600 6:169814649-169814671 AGAGCATGGCCTGCAGGTGCAGG - Intergenic
1021043161 7:15888744-15888766 AGAGCAGTGACTGCCTCTGGAGG - Intergenic
1023118397 7:36884890-36884912 AGAGCAGACACTCCCAGTGCAGG - Intronic
1023959228 7:44912871-44912893 GGAGCAGAGACTGCAGCTTCTGG - Intergenic
1024216547 7:47253929-47253951 GTTGCAGAGACAGCCGGTGCTGG - Intergenic
1025723225 7:64035219-64035241 AGAGCAGAGACTGCCAGAGGCGG + Intronic
1026901571 7:74040272-74040294 AGAGAAGCGACTGCCAGCGCAGG + Intronic
1029483101 7:100824614-100824636 CGAGCAGAGGCTGCTGGTGTGGG + Intronic
1029833671 7:103286728-103286750 ATAGCGGAGACTGCCAGTGTGGG - Intergenic
1030207442 7:106964631-106964653 GGAGCAGAGACTGGATGTGCAGG + Intergenic
1030867380 7:114716076-114716098 AGAGAAGTGACTGCCAGTTCTGG - Intergenic
1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG + Intronic
1035704390 8:1664097-1664119 AGAGCTGAGGCTGTGGGTGCGGG + Intronic
1035849036 8:2895882-2895904 AGAGCAGAGACTTGCAGTCCTGG - Intergenic
1037072660 8:14671265-14671287 AGAGCAGAGACAGCCAGTAGAGG - Intronic
1039477110 8:37844825-37844847 GGACCAGTGACTGGCGGTGCTGG + Exonic
1041087431 8:54269781-54269803 GTAGCTGAGACTGCAGGTGCAGG + Intergenic
1042406030 8:68406440-68406462 AGAGAAGAAACTACCGGTCCAGG - Intronic
1043275665 8:78389219-78389241 AGAGAAGAGAGAGCTGGTGCAGG + Intergenic
1047960355 8:130007246-130007268 AGAGCAGACACTGCTCCTGCTGG - Intronic
1051162148 9:14220796-14220818 AGAGCAGAAACTTCGGGTGGTGG - Intronic
1055756599 9:79564948-79564970 ATAGCTGGGACTGCAGGTGCAGG - Intergenic
1056667865 9:88596298-88596320 TGAGCAGTGACTGCCTGGGCCGG + Intergenic
1059157873 9:112005857-112005879 GGAGGAGAGATTGCAGGTGCAGG + Intergenic
1061849338 9:133405250-133405272 AGAGGAGATCCTGCCGGAGCTGG + Exonic
1062021331 9:134320804-134320826 ACAGGAGAGACTGCTGTTGCAGG - Intronic
1062347476 9:136122037-136122059 CGAGCAGAGACTGGCGGGGCAGG - Intergenic
1062359557 9:136181221-136181243 AGAGTAGAGACTGTCTGTGCTGG + Intergenic
1062606473 9:137350874-137350896 AGAGCAGAGCCTGGCAGAGCTGG - Intronic
1191604257 X:63044151-63044173 AGATGAGAAACTGCAGGTGCTGG + Intergenic
1192277869 X:69651726-69651748 AGAGTAGAGATTGCTGATGCAGG + Intronic
1192553040 X:72069218-72069240 AGAGCAGAGACAGCCAGGGACGG + Intergenic
1201482439 Y:14454550-14454572 ATAGCTGAGACTACAGGTGCAGG + Intergenic