ID: 1013227186

View in Genome Browser
Species Human (GRCh38)
Location 6:108128480-108128502
Sequence AGCTAACACAAGAAGCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013227186 Original CRISPR AGCTAACACAAGAAGCTACA GGG Intronic
906762241 1:48386730-48386752 AACTAACACAAGGAGCTGCCGGG + Intronic
907800223 1:57757464-57757486 AGCAAACGCCAGAAGCTAGAAGG - Intronic
912017342 1:105058795-105058817 GCCTAAAACAAGAAGCTTCAAGG + Intergenic
913041971 1:115035900-115035922 AGCTACCAGAAGAAGAGACATGG - Intergenic
916153925 1:161825682-161825704 AGCAAACACAAGGAGGTACTAGG - Intronic
923414495 1:233742188-233742210 AGCTACCAAAAAAAGCTACTGGG + Intergenic
923632254 1:235659020-235659042 AGCAAAAAAAAAAAGCTACAAGG - Intergenic
924213626 1:241795905-241795927 AGCTAACAGATGATGCTAAAGGG + Intronic
924478179 1:244400417-244400439 AACAAACAAAAAAAGCTACAGGG - Intergenic
924559700 1:245147483-245147505 AGGAATCACAAGAAGCTAGAGGG - Intergenic
1064499131 10:15949805-15949827 ATCTAACAGAAGAATCTCCAAGG - Intergenic
1070052358 10:72901711-72901733 TTCTAAAACAAGAAGCTACTTGG - Intronic
1070501266 10:77074877-77074899 AGCAAACACAAGGAGCACCAAGG + Intronic
1071696908 10:87886118-87886140 AGCTTACACACAAAGCAACATGG - Intronic
1071870702 10:89790634-89790656 AGCTCAGAAAAGAAGCTGCAAGG - Intergenic
1075993384 10:126857141-126857163 AGCAACCACCAGAAGCTAGAAGG - Intergenic
1080124880 11:28721195-28721217 AGCTAACTGAAGCAGCTACTAGG + Intergenic
1080665170 11:34329599-34329621 AGCTATCACAAGAAGCCAACTGG + Intronic
1081354662 11:42097468-42097490 AGTTTAAATAAGAAGCTACAGGG + Intergenic
1081577897 11:44330626-44330648 GGCAAACACCAGAAGCTAGAAGG + Intergenic
1081732241 11:45379784-45379806 AGCTAACACAAGCAGCCATGTGG - Intergenic
1082723540 11:56707806-56707828 ACCAAACACAAGAAGCTTAAAGG + Intergenic
1086241045 11:84691977-84691999 AGCTAACAAAAGGAGCTGAAAGG - Intronic
1091204517 11:133810514-133810536 AGCTAAAACATGAATTTACACGG + Intergenic
1094007866 12:25774597-25774619 AGGTGACACAAGAAGTTACTGGG + Intergenic
1095942544 12:47736444-47736466 AGCTCACCCAGGAAGCTCCAGGG - Intronic
1098381516 12:69875403-69875425 AGCTACTATAAGAAGCTAAATGG - Intronic
1099027990 12:77490207-77490229 AGCTAACAAAAGATGCTCCTTGG - Intergenic
1100991726 12:100258649-100258671 CACCAACACAAGAAGCTAGAAGG + Intronic
1104692280 12:130835961-130835983 AGCTAAGAAAAGAAACTTCATGG + Intronic
1110245506 13:73319065-73319087 AGCAAACACCAGAAGCTCGAAGG - Intergenic
1112679949 13:101752656-101752678 ATCTAACACTAGAAGCACCAAGG - Intronic
1113864011 13:113509293-113509315 TCCTAACACAGGAAGCTCCAGGG - Intronic
1114519259 14:23322386-23322408 AGCTCAGACAAGCAGCTCCAGGG - Intronic
1117753474 14:58948017-58948039 AGCAAGAACAAGAAACTACAAGG - Intergenic
1117840612 14:59856858-59856880 GGATAACACAAGAAGATGCATGG - Intronic
1118976226 14:70679081-70679103 AGCTCACACATGTAGCTCCAGGG + Intergenic
1121590767 14:95106464-95106486 TGATAACACATGAAGCTAAATGG + Intronic
1123579384 15:21702990-21703012 AGCTAAAACAAAAAATTACACGG - Intergenic
1123616011 15:22145501-22145523 AGCTAAAACAAAAAATTACACGG - Intergenic
1124719794 15:32101611-32101633 AGGCAAGACAAGAAGATACAGGG + Intronic
1124911695 15:33927567-33927589 GGCTAACAGAACAAGCTTCAGGG + Intronic
1126118832 15:45233146-45233168 AGCTAACACAAGAACAGAGAAGG + Intergenic
1126945154 15:53810981-53811003 AGCTAACATAAGCAGCAGCATGG - Intergenic
1127795342 15:62433283-62433305 AGATACAACAAGAAGTTACAAGG - Intronic
1127897263 15:63312383-63312405 AGATAAGACAGGAAGCTAGAAGG + Intergenic
1129566203 15:76625712-76625734 AACTAACATAAGAAGCTACTTGG - Intronic
1130963581 15:88681126-88681148 AGCTCACACAAGGACCTACAAGG + Intergenic
1131763807 15:95653613-95653635 AGGTTACACAAGCAACTACAGGG - Intergenic
1202988254 15_KI270727v1_random:437235-437257 AGCTAAAACAAAAAATTACACGG - Intergenic
1133101944 16:3485228-3485250 AGCTAACACAGCAGGCTCCATGG + Intronic
1133609237 16:7417584-7417606 GGCTATCACAGGAGGCTACATGG - Intronic
1136221471 16:28832045-28832067 AGGTAACACAAGCAGGTAAATGG - Intronic
1136610255 16:31361734-31361756 AGCTAAGACTGGAGGCTACAGGG - Intronic
1137906935 16:52332733-52332755 AGCTAACCTAAAAATCTACAGGG - Intergenic
1138530512 16:57631858-57631880 ACCTAAGACCAGAATCTACAGGG - Intronic
1140102351 16:71928544-71928566 ATCCAACACAATATGCTACAGGG - Exonic
1140855887 16:78977435-78977457 AGCACACACCAGAAGCTATAAGG + Intronic
1142925124 17:3229170-3229192 AATTTACACAAGAAGATACATGG + Intergenic
1144307741 17:13984406-13984428 ATTTAACAAAAGAAGTTACACGG - Intergenic
1146155064 17:30516529-30516551 AGTTAACACAAGTTGCTTCAGGG - Intronic
1147246807 17:39127029-39127051 AGATAACACCTGAAGCTTCAAGG + Intronic
1151012016 17:70510511-70510533 GCCTAACACCAGAAGCCACATGG - Intergenic
1156977571 18:43242301-43242323 AGCTGACAGGAGAAACTACAGGG - Intergenic
1164175069 19:22765679-22765701 AGTTAAAAAAAAAAGCTACATGG + Intronic
1166581452 19:43903623-43903645 TGCTAACAGTAGAAGCCACATGG + Intergenic
1168546287 19:57253151-57253173 AACTAACACAAGGAGCTTCAGGG + Exonic
925858406 2:8152472-8152494 ATCTAAAATAAGAAGATACATGG + Intergenic
926865250 2:17349301-17349323 AGTGAAAACAAGAAGGTACAAGG + Intergenic
927235559 2:20871388-20871410 AGCTGACACGAGAAGATGCAGGG + Intergenic
927977972 2:27354412-27354434 AGTTAACATAAGGAGCTAAATGG + Intronic
928466706 2:31528974-31528996 AGCTAACCCAAGAAGGTGCAAGG + Intronic
928623431 2:33114640-33114662 ATCTAACACAAGCAGCTTCCTGG - Intronic
930644778 2:53894162-53894184 ACCTAACACCAGAAGTTAAAAGG + Intronic
932840172 2:75074483-75074505 AGCTGACACAACAAGCTCTAGGG - Intronic
935593326 2:104860856-104860878 AGCAAACACTGGAGGCTACAGGG - Intergenic
935624637 2:105162045-105162067 AGTTAACACATAAAACTACAGGG - Intergenic
940480535 2:154224482-154224504 AGCAAAGAAAAAAAGCTACAAGG + Intronic
940894312 2:159065485-159065507 AGATAATGAAAGAAGCTACATGG - Intronic
942052964 2:172157682-172157704 AGCAAACACCAGAAACTAGAAGG - Intergenic
942119082 2:172758971-172758993 AACTAGCAAAAGAAGCTGCATGG + Intronic
1168786879 20:547090-547112 AGCTTACTGAAGAAGCAACATGG - Intergenic
1168906883 20:1411371-1411393 AGGTAATAAAAGAAGCTAAAAGG + Intergenic
1169787918 20:9380404-9380426 ATCTAATACAAGAAAGTACATGG - Intronic
1173322649 20:42002035-42002057 AACTGACACAAGAAGCTGCTGGG - Intergenic
1175580784 20:60097366-60097388 ATCAAAGACAAGAAGCCACAAGG + Intergenic
1175842333 20:62036950-62036972 AGGACACACAAGAAGCTGCATGG + Intronic
1177038836 21:16080495-16080517 AGCTAACACACAAAGGTACATGG + Intergenic
1177040190 21:16098981-16099003 AGTAAACACATGAAGCTACTTGG - Intergenic
1182522919 22:30894463-30894485 AGAAAAGACAGGAAGCTACAGGG + Intronic
1182892633 22:33831694-33831716 AGCAAACAGTGGAAGCTACAGGG + Intronic
1183112892 22:35665227-35665249 AGCATACACAGGAAGATACATGG - Exonic
949150224 3:757776-757798 AACTAACACAAGAAGCTGTCAGG - Intergenic
949525175 3:4896228-4896250 AGTTAAGACAAGAGGCCACATGG + Intergenic
949799936 3:7892656-7892678 TGGTAACACAAGAAGGTACCAGG + Intergenic
951113891 3:18837316-18837338 AGCTACCACAAGAGGCAACTGGG + Intergenic
953018692 3:39100426-39100448 AGCTACCACAAGAAGCCACCTGG - Exonic
953521716 3:43649186-43649208 AGCCAAGACATGAACCTACATGG - Intronic
955457607 3:59141138-59141160 AACTAACCCAGGAAGCTAGAAGG + Intergenic
958951963 3:100426423-100426445 AGCAAAGCCAAGAAGATACAGGG + Intronic
959856319 3:111162791-111162813 AGCTAACAGAAGAAGCTTGATGG - Intronic
959989686 3:112617211-112617233 ACCTAACACAGGAAACTAAATGG + Intronic
965962861 3:174449290-174449312 AGGTTTCACAAGAAGCTAGAAGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967038963 3:185671697-185671719 AGATAACCCAAAAAGCTACTGGG + Intronic
967714666 3:192748780-192748802 AGCCAGCCCAAGATGCTACAGGG - Intronic
967882226 3:194309862-194309884 AGCTAAACCACGAAGCTTCATGG - Intergenic
968112196 3:196057624-196057646 AGTTGACACAAGAAGATCCATGG + Intronic
968226584 3:196976166-196976188 ATCAAACACAAGAACCTAAAGGG - Intergenic
971657846 4:29372505-29372527 AGCTAATAAAACAAGCTTCAGGG - Intergenic
975962293 4:79926408-79926430 AGCTAACACAACCTGCTAGATGG - Intronic
976625817 4:87180687-87180709 AGATAGCACAAGCAGCTACCAGG - Intronic
977389927 4:96395027-96395049 AACTGACAAAAGAAGCTAGAGGG + Intergenic
978847614 4:113292568-113292590 AGCTCAGACAAGAAGCCACCAGG - Intronic
981897072 4:149815173-149815195 AACCAACTCACGAAGCTACATGG + Intergenic
984046456 4:174805433-174805455 AGAACACTCAAGAAGCTACAAGG + Intronic
986639733 5:9860537-9860559 AAGTAACACAAGAAACTAGAGGG - Intergenic
989668787 5:43889501-43889523 AGCTAACACAGTAAGCTAACTGG + Intergenic
991979648 5:72218043-72218065 AGCAAACACCAGAAGTTAGAAGG - Intergenic
992265329 5:75012787-75012809 AGCTACCACCAGAAGCTAGGAGG + Intergenic
992887057 5:81169437-81169459 AGCAAACACCAGAAGCTAGGAGG - Intronic
994967861 5:106697352-106697374 AGCAAACATGAGAAACTACATGG - Intergenic
995252093 5:110005542-110005564 GGCTAACATCAGAATCTACAAGG - Intergenic
995576220 5:113537802-113537824 AGGTAACACAAGAAGAGAAAAGG - Intronic
997043382 5:130283576-130283598 AGGAAAGGCAAGAAGCTACAAGG + Intergenic
998229453 5:140350718-140350740 AGCCAGCATAAGAAGGTACACGG - Intergenic
1000870386 5:166569916-166569938 AGCAAATACCAGAAGCTACAGGG - Intergenic
1003329147 6:5115385-5115407 AGCTCACACAGGGAGCTACATGG - Intronic
1010393892 6:75368601-75368623 AGCTAACAGAAGAGGCTTCCTGG + Intronic
1011894922 6:92213890-92213912 AGCTAACACAATATGTTAAATGG + Intergenic
1011966434 6:93163529-93163551 AGCTAACACAAGAAAAAAGAGGG - Intergenic
1011989818 6:93500496-93500518 AGAGAACCCCAGAAGCTACAAGG + Intergenic
1012049763 6:94327002-94327024 TGCTTATGCAAGAAGCTACAAGG + Intergenic
1013227186 6:108128480-108128502 AGCTAACACAAGAAGCTACAGGG + Intronic
1013439915 6:110153614-110153636 AGCTAACACAAGACTGGACAAGG + Intronic
1013743590 6:113318492-113318514 AGGTATTACAAGATGCTACATGG + Intergenic
1013850504 6:114507699-114507721 AGCAAAAACAAGAAGACACAAGG + Intergenic
1014095178 6:117452308-117452330 AGCTAACCCAAGAAGCAGTAAGG + Intronic
1014392423 6:120879063-120879085 AGGTAAAACAGGAAGGTACAAGG - Intergenic
1016574039 6:145547744-145547766 AGATAACATAAGAATCTTCAGGG + Intronic
1016641462 6:146353995-146354017 AGCTGACACAAACAGATACATGG - Intronic
1017392337 6:153954890-153954912 GGCTAATACCAGAATCTACAAGG - Intergenic
1018896362 6:168020731-168020753 AGCTAACAAAAAAAGATACATGG + Intronic
1020154276 7:5709562-5709584 ACTGACCACAAGAAGCTACATGG + Intronic
1021142130 7:17039500-17039522 AGCTAACACCAGAAAATACTTGG + Intergenic
1021294344 7:18886027-18886049 AGCTAACAAAAAAAGCAACATGG + Intronic
1022951189 7:35339744-35339766 AGCAAACAGAGGAAGCTGCAAGG - Intergenic
1026027132 7:66754569-66754591 GGCTACCACATGTAGCTACAAGG - Intronic
1027412639 7:77937439-77937461 AGATATCATAAGAAGTTACATGG - Intronic
1030169193 7:106584520-106584542 AGCTAACACAGCCAGCTGCAAGG + Intergenic
1030646824 7:112070837-112070859 AGCAAACTCATGAAGCTCCAGGG - Intronic
1030905825 7:115181169-115181191 AGCTAAAACAAGAAGTTAGGTGG + Intergenic
1032651351 7:133882157-133882179 AGTTAACACAAGAATTCACATGG - Intronic
1034140644 7:148812262-148812284 GGATAACACAAGAAACTACCGGG + Intronic
1035549862 8:513537-513559 AGCTAACACAACATACTAAATGG + Intronic
1037769812 8:21791818-21791840 AGCAGAAACAAAAAGCTACAGGG + Intronic
1038295511 8:26288241-26288263 AGCCAGCAAAAGAAACTACAAGG + Intergenic
1040574084 8:48635651-48635673 GACTAATACATGAAGCTACATGG - Intergenic
1040732585 8:50467608-50467630 AGCAAACACAAAAAACAACAGGG - Intronic
1040758883 8:50813542-50813564 AGCTAACAGGAGAATCCACAAGG + Intergenic
1043842740 8:85127862-85127884 AATTGACACAAGAAGCTACTGGG + Intronic
1046546066 8:115651614-115651636 AGCTCATACCAGAAGCTACCGGG - Intronic
1047996272 8:130339499-130339521 AGCTATCACAAGATTCAACATGG + Intronic
1051059777 9:13032538-13032560 ACCTAACACAAGATGAGACAAGG + Intergenic
1056397068 9:86191848-86191870 AGCTAACAAAAGAAGGTATATGG + Intergenic
1057056249 9:91963463-91963485 AGCTAAAACAAGAAGCAACAAGG - Intergenic
1058332801 9:103785128-103785150 AGCTAACACTAAAATCTAGAGGG + Intergenic
1058525670 9:105855645-105855667 AGCTATCACAGAAAGCTAAAAGG - Intergenic
1060149777 9:121281209-121281231 AGCTAATACCAGCAGGTACAAGG + Intronic
1061257963 9:129463770-129463792 AGGTCCCACAAGAAGCTGCAGGG - Intergenic
1186404712 X:9291812-9291834 AGGTAACAAAAGAAGTTCCAGGG - Intergenic
1188060149 X:25590910-25590932 AGCTAACATAGGAAGCTTCCAGG - Intergenic
1189567133 X:42254712-42254734 AGCTACCACAGGAACATACAAGG + Intergenic
1191123316 X:56927711-56927733 ATCTGACACAGAAAGCTACATGG - Intergenic
1196173807 X:112618056-112618078 AGCTAGCAAGAGAGGCTACAAGG + Intergenic
1197687080 X:129452069-129452091 AGCTAAAACTAGAAGTTAAAAGG + Intronic