ID: 1013229040

View in Genome Browser
Species Human (GRCh38)
Location 6:108144734-108144756
Sequence TTTTAAACACAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 8, 3: 37, 4: 431}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013229034_1013229040 3 Left 1013229034 6:108144708-108144730 CCACCGCACCTGGCCTGGAATTT 0: 2
1: 38
2: 441
3: 2807
4: 11477
Right 1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG 0: 1
1: 0
2: 8
3: 37
4: 431
1013229031_1013229040 29 Left 1013229031 6:108144682-108144704 CCAAAGTGTTGGGATTACAGCAT 0: 15
1: 296
2: 2378
3: 45254
4: 355373
Right 1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG 0: 1
1: 0
2: 8
3: 37
4: 431
1013229035_1013229040 0 Left 1013229035 6:108144711-108144733 CCGCACCTGGCCTGGAATTTTTA 0: 1
1: 7
2: 112
3: 691
4: 3076
Right 1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG 0: 1
1: 0
2: 8
3: 37
4: 431
1013229036_1013229040 -5 Left 1013229036 6:108144716-108144738 CCTGGCCTGGAATTTTTATTTTA 0: 1
1: 4
2: 63
3: 498
4: 3263
Right 1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG 0: 1
1: 0
2: 8
3: 37
4: 431
1013229030_1013229040 30 Left 1013229030 6:108144681-108144703 CCCAAAGTGTTGGGATTACAGCA 0: 27
1: 1130
2: 34945
3: 346118
4: 263021
Right 1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG 0: 1
1: 0
2: 8
3: 37
4: 431
1013229037_1013229040 -10 Left 1013229037 6:108144721-108144743 CCTGGAATTTTTATTTTAAACAC 0: 1
1: 1
2: 5
3: 101
4: 945
Right 1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG 0: 1
1: 0
2: 8
3: 37
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013229040 Original CRISPR TTTTAAACACAAATGGAGCT GGG Intronic
901732184 1:11288073-11288095 TGTGAAACAAAAATGGTGCTGGG - Exonic
902242422 1:15097916-15097938 TTTTTAACACAAAGGCAGCATGG - Intronic
902344310 1:15804791-15804813 TAAAAAACACAAATGGGGCTGGG - Intergenic
903879568 1:26500004-26500026 TTTTAAAAAAAAATAGAGATAGG - Intergenic
906053646 1:42896473-42896495 TTTTAATCACAAATGGATGATGG + Intergenic
906586185 1:46980890-46980912 ATTTAAAAATAAATGGTGCTGGG + Intergenic
906642940 1:47452390-47452412 TTCTCAAGACAAAAGGAGCTTGG + Intergenic
906798480 1:48716126-48716148 TTTAAAATACAAAGGAAGCTTGG + Intronic
907301855 1:53491952-53491974 TTTTAAAAACTAATGTGGCTGGG + Intergenic
907412794 1:54294413-54294435 TTTTAATGACCAATGGATCTGGG - Intronic
907590927 1:55670380-55670402 TTTTAAACAGCAATGGTGCTGGG - Intergenic
908695899 1:66841506-66841528 ATTTAAAAACAGATGGATCTTGG - Intronic
909551489 1:76902792-76902814 TTTTTTAAACAAATGGTGCTAGG + Intronic
909824259 1:80106878-80106900 TATTAAACTGATATGGAGCTAGG - Intergenic
910315484 1:85877656-85877678 TTAAAAACACACATGAAGCTGGG - Intronic
911298361 1:96144954-96144976 TTTTAAACACTTAATGAGCTCGG - Intergenic
913391386 1:118316811-118316833 TTTTAAACAAAATGAGAGCTGGG - Intergenic
914770301 1:150678002-150678024 TTTTAAAGAGAAATGTGGCTGGG + Intronic
916292928 1:163186362-163186384 CTTTAAAAAGAAATGGGGCTGGG - Intronic
916425988 1:164680644-164680666 TTTTACAAAAAAATGCAGCTAGG + Intronic
918063142 1:181079310-181079332 TATTAAAAAAAAATGTAGCTGGG - Intergenic
918120518 1:181535292-181535314 TTTTAAAGACAAATGGGGGAGGG - Intronic
918359766 1:183744159-183744181 TTTTAAACACAACTGTAGTGAGG - Intronic
918577361 1:186079078-186079100 TGCTAAACACAACTAGAGCTGGG - Intronic
919020391 1:192097967-192097989 ATTTAAGCAAAAATGGAGTTTGG + Intergenic
920317655 1:205090147-205090169 TTTTAAAAATCAATGTAGCTGGG - Intronic
921808770 1:219487541-219487563 TATTACACACAAATGAATCTGGG + Intergenic
922879220 1:228967379-228967401 TTTAAAAAACAAATGATGCTGGG - Intergenic
1062838691 10:652796-652818 TTTTAAACAGAAATGGCACCAGG + Intronic
1063032034 10:2245059-2245081 ATTTAAACACAAGTGGGGCTGGG - Intergenic
1063182362 10:3615859-3615881 TTTTAAAACCAAATGAAGGTTGG + Intergenic
1063540838 10:6932265-6932287 TTATAAAATCAAATGGGGCTGGG + Intergenic
1063582681 10:7323156-7323178 TATAAAACATAAATGGAGCTGGG + Intronic
1063812400 10:9726677-9726699 TTTTTAATACAAATGGACATTGG - Intergenic
1065245986 10:23758288-23758310 TTTTTAAAACAAATGGTGCTGGG - Intronic
1066493020 10:35912884-35912906 TTTAAAAAACAGATGGAGATGGG + Intergenic
1068232652 10:54190819-54190841 TTATAAAAATAAATGGTGCTCGG + Intronic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1069407103 10:68113398-68113420 GTTTAAAGACACATGTAGCTAGG + Intronic
1070335405 10:75450514-75450536 TATTAAACACAATTGGAGGGAGG + Intronic
1070894549 10:79972202-79972224 TTTAAAACACAAAGAGGGCTGGG + Intronic
1071045686 10:81373237-81373259 TTTTAATCATAAATGGATGTTGG + Intergenic
1072066582 10:91877365-91877387 ATTTAAAGAAAAATAGAGCTAGG - Intergenic
1072519444 10:96218037-96218059 TTTTTAAAACAAATAGTGCTAGG - Intronic
1072981147 10:100098601-100098623 TTTTAAAAAGAAAAGGAGCCAGG + Intergenic
1073248454 10:102107594-102107616 TTTTAAAAAAACTTGGAGCTGGG + Exonic
1074090482 10:110248822-110248844 TTTTAAAAACAAATATATCTTGG - Intronic
1074171648 10:110945471-110945493 TTTTAAAAATAAATGCAACTTGG + Intronic
1074361661 10:112828714-112828736 TTTTAACAATAAATAGAGCTGGG + Intergenic
1075386507 10:122059210-122059232 TTAAAAACACAGATGGAGCCCGG - Intronic
1075432493 10:122399922-122399944 TTTTAAGCAAAAATGGGGCTGGG - Intronic
1075756059 10:124812353-124812375 TTTTAAAAATAAATATAGCTGGG + Intronic
1076036708 10:127204591-127204613 TTTTAAAAAAAAATAGAGATGGG + Intronic
1077580148 11:3412258-3412280 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1078465483 11:11547001-11547023 TTTCAAACACAAAGGCAGCTTGG + Intronic
1078642635 11:13110741-13110763 TTTTAAAGTCAAATGAAGTTGGG + Intergenic
1078918866 11:15808140-15808162 TAATGAAAACAAATGGAGCTGGG - Intergenic
1078948614 11:16101823-16101845 TTTTAATCACAAAGGGATGTTGG - Intronic
1079097686 11:17521411-17521433 TCTGAAACACAAATGCAGATTGG + Exonic
1079653016 11:22954060-22954082 TTTTAAATACAAATAGACCTGGG + Intergenic
1080282594 11:30575634-30575656 TTTTAACCACAGATAGAGATAGG + Intronic
1081366320 11:42239606-42239628 TTTCAAACACAAATGCAGTGAGG + Intergenic
1081438031 11:43049687-43049709 TTTTAAAGTTAAATGGACCTAGG - Intergenic
1081497868 11:43633777-43633799 TTTGAAAGACAAATGTGGCTGGG + Intronic
1084237072 11:67795085-67795107 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1084835331 11:71797749-71797771 TTTTAAACAAAAATGGGGCTGGG - Intronic
1084932660 11:72569532-72569554 TTTAAAACAAAAATGAGGCTGGG + Intergenic
1086954836 11:92925332-92925354 TTTTAGCCATAACTGGAGCTAGG - Intergenic
1087222783 11:95564509-95564531 GTTTAGGCACAAATGAAGCTGGG + Intergenic
1087660547 11:100982538-100982560 TTTAAAAGCCAAATGTAGCTAGG + Intronic
1088465504 11:110132592-110132614 TCTTGAACACAAAAGGAACTGGG - Intronic
1088528256 11:110779945-110779967 TTTTAATCACAAATAGATTTTGG + Intergenic
1088601494 11:111481768-111481790 TTTTAATCATAAATGGATGTTGG - Intronic
1089370805 11:117955098-117955120 TTTTGAACTCAAATGGATCTGGG + Intergenic
1089545501 11:119221378-119221400 TTTTAAATAAAAATAGAGATGGG - Intronic
1089628503 11:119768344-119768366 TTTTAATCAGAAATGGATTTTGG + Intergenic
1089830529 11:121323623-121323645 TTTTAAAAAACAATGGAGCAGGG - Intergenic
1090009364 11:123032638-123032660 TTCTAAACACAAATGAGGCGAGG + Intergenic
1090111834 11:123919645-123919667 TTTTAAAAACAAGTAGAGCTTGG + Intergenic
1091182095 11:133614579-133614601 TAATAAATAAAAATGGAGCTGGG + Intergenic
1094425979 12:30317559-30317581 AGTTAAACACAAATTGAGCCAGG + Intergenic
1094426185 12:30319732-30319754 AGTTAAACACAAATTGAGCCAGG + Intergenic
1097325716 12:58274298-58274320 TTTTTAACATAAATGTAACTCGG - Intergenic
1097998722 12:65918340-65918362 TTATAAAGAGAAGTGGAGCTTGG + Intronic
1099302631 12:80917008-80917030 TTATAAAAACAAATTAAGCTGGG + Intronic
1100116359 12:91309624-91309646 TTTTAAACACTAATTGGGCTTGG + Intergenic
1101535810 12:105615324-105615346 TTTTAAAGAAAAATGCGGCTGGG + Intergenic
1103295358 12:119881732-119881754 TTTTAAACTGAAATGGAGGCCGG + Intergenic
1104144485 12:126019307-126019329 ATGGAAACACAAAGGGAGCTGGG + Intergenic
1104169101 12:126262727-126262749 TTCTAAATACAAAAGGAGTTTGG - Intergenic
1104869305 12:131983215-131983237 TTTTGCACTCACATGGAGCTAGG - Intronic
1104917145 12:132271621-132271643 TTTTAGACACAAACGGCGTTGGG + Intronic
1105774763 13:23647560-23647582 TATTAAAAAAAAATGTAGCTGGG - Intronic
1106055639 13:26234099-26234121 TTTTAAAAATAAATAGAGATGGG - Intergenic
1106299029 13:28446100-28446122 TTTTCATCACGAAAGGAGCTTGG - Intronic
1106390403 13:29329907-29329929 TTATAAAGACACATGCAGCTAGG - Intronic
1108185659 13:47886050-47886072 CTTTAAAAAAAAATGGAGTTAGG + Intergenic
1110110344 13:71737336-71737358 TCTGGAACACAAATGGAACTTGG + Intronic
1110525991 13:76537609-76537631 TTTTGGACAAAAATGGAGCCTGG + Intergenic
1110657870 13:78021963-78021985 GTTTAAACACAAATCCAGTTAGG + Intergenic
1112662217 13:101523145-101523167 TTTCAAGGACAAATGGAGCTAGG - Intronic
1113104325 13:106756825-106756847 TTGTCAACACAGATGGCGCTGGG + Intergenic
1113418702 13:110152764-110152786 CTTTAAACTCTAATGAAGCTGGG - Intronic
1113534604 13:111055273-111055295 TTTTAATCACAAATGGATGCTGG + Intergenic
1115946360 14:38665695-38665717 TGTTAAACACATATGGGCCTGGG - Intergenic
1116089398 14:40285597-40285619 TTTGAAACAAAAAAGAAGCTAGG - Intergenic
1116456409 14:45125209-45125231 TTTAAAACACAAATCTGGCTGGG - Intronic
1116812859 14:49556056-49556078 ATTTAAAAAAAAATGGGGCTGGG - Intergenic
1117313562 14:54552510-54552532 TTTCAAACAGAAATGCAGATGGG - Intergenic
1117373110 14:55096836-55096858 TTTAAAAAACAAATAGGGCTGGG - Intergenic
1117523629 14:56575700-56575722 TTTTGAAGACAAATGAGGCTGGG - Intronic
1117571428 14:57052680-57052702 TTTTAAATAGAAATGGAGCTGGG - Intergenic
1118615831 14:67573913-67573935 TTTTAAACAGAAGAGGTGCTGGG + Intronic
1118662074 14:68025046-68025068 TTTTAATCACAAAGGGAAGTTGG + Intronic
1119606418 14:76021952-76021974 GTTTAAACACAAATGTTGGTTGG + Intronic
1120350870 14:83356544-83356566 TTTTAAAAACTAAGGGAGATAGG + Intergenic
1120491784 14:85187383-85187405 TATTAAATCCAAATGGAGTTAGG - Intergenic
1121329097 14:93038820-93038842 TTTTAAACACATATCTGGCTGGG - Intronic
1121548764 14:94782200-94782222 TTTAAAACAAAATTGAAGCTGGG + Intergenic
1121931398 14:97975764-97975786 TTTTAAAACCAAAGGGAGTTGGG - Intronic
1122451262 14:101809876-101809898 TTTTAAACTAAAATGGAGGCTGG + Intronic
1123437707 15:20267661-20267683 TTTTAAATAAAAATAGAGATGGG + Intergenic
1125487290 15:40120928-40120950 ATTAAAACACAGATTGAGCTGGG - Intergenic
1125648910 15:41297147-41297169 TTTAAAACACAAATGTGGCCGGG + Intergenic
1126425615 15:48524222-48524244 CTTAGAACACAAAGGGAGCTCGG + Intronic
1126461260 15:48917469-48917491 TTTTAAAGACAACTGCGGCTAGG + Intronic
1126708707 15:51432150-51432172 TTTAAAACATACATGCAGCTGGG + Intergenic
1126831487 15:52611815-52611837 TTTTAAACACAAAATTAGGTGGG - Intronic
1127445524 15:59059104-59059126 TTTTAAATATAAATAGAGATAGG - Intronic
1127726940 15:61759605-61759627 TTGTAACCACACATGCAGCTGGG - Intergenic
1127894189 15:63280299-63280321 TTTGAAACACAGCTGGAACTTGG + Intronic
1128164222 15:65448359-65448381 TTTTAAAAATAAATAGAGATGGG - Intronic
1128840233 15:70844250-70844272 TTTAAAACACAAATAGGGCCGGG - Intronic
1129023367 15:72545146-72545168 TTTAAAAAACAAATGGGGGTTGG - Intronic
1129511352 15:76125550-76125572 TGTTAAAAAAAAATGGGGCTGGG + Intronic
1129710096 15:77816526-77816548 TTTAAAACACAAATATAGCAGGG + Intronic
1129874798 15:78967005-78967027 TTTTAAAAAAAAATGAGGCTGGG + Intronic
1130003911 15:80075699-80075721 GTTTAAACAAAAATGGCTCTAGG - Intronic
1130386661 15:83417884-83417906 TTTTAAAGACAAACTGGGCTAGG - Intergenic
1131746029 15:95448136-95448158 TTTTAAACAAAATTTCAGCTTGG - Intergenic
1132057122 15:98660860-98660882 TTTTAAACCCTCTTGGAGCTGGG + Intronic
1132938133 16:2492458-2492480 TTCTAAACAGAACAGGAGCTGGG - Intronic
1133348678 16:5087501-5087523 TTTTAAACAAAAATGGGGTTGGG + Intronic
1133665959 16:7968104-7968126 TTTGAAACACAAATACAGCGGGG - Intergenic
1134160307 16:11882781-11882803 TTTTAAATAAAAATTGAGATGGG - Intronic
1135281578 16:21157896-21157918 TTTGAGACACAACTGGAGGTGGG + Intronic
1135283356 16:21172031-21172053 ATTTATACACACTTGGAGCTGGG - Intronic
1135675539 16:24411897-24411919 TTTTAAATACAATGGGAGGTGGG - Intergenic
1136009199 16:27351808-27351830 TTTTAAAGAGAGATGGGGCTGGG - Intronic
1136846868 16:33583194-33583216 TTTTAAATAAAAATAGAGATGGG - Intergenic
1137297074 16:47105044-47105066 TTTTAAAGAAAAATAGAGATGGG + Intronic
1138116314 16:54363406-54363428 TTTTAAAAAAAACTGGAGCAAGG + Intergenic
1141236140 16:82218986-82219008 TTTTAAACACAAAAGGAAGCCGG - Intergenic
1142197002 16:88743594-88743616 TTTTGAGCACAAATGGTGTTAGG + Intronic
1203108576 16_KI270728v1_random:1431849-1431871 TTTTAAATAAAAATAGAGATGGG - Intergenic
1143236143 17:5402706-5402728 TTTTAAAGCCAAATAGGGCTGGG + Intronic
1143819734 17:9550683-9550705 TTTGAACCACAGATGGAGCGGGG + Intronic
1144224612 17:13132769-13132791 CTTTAAAGACAAAAGGTGCTGGG + Intergenic
1146285104 17:31569130-31569152 TTTTAAAAACACATAGAGATGGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146962629 17:36997004-36997026 TTTCAAACACAAATGGTACCTGG + Intronic
1148597893 17:48871583-48871605 TTTTTAACACAAACAGAACTAGG + Intergenic
1149945384 17:60919920-60919942 TTCTAAACACAAAAGAAGATAGG + Intronic
1150161876 17:62905427-62905449 TTTAAAACACAAGTGGGGCCAGG + Intergenic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1150330091 17:64287445-64287467 TTTTAAAAACAAAGATAGCTGGG - Intergenic
1150974344 17:70066790-70066812 TTTTAAACAGATAAGGACCTTGG - Intronic
1151045846 17:70918649-70918671 ATTTAAACACAGATAGAGATGGG + Intergenic
1152174706 17:78780219-78780241 TTTTAATCACAAAAGGAGGCTGG + Intronic
1152393757 17:80019038-80019060 TTTGAAACACAGAAGGAGGTGGG - Intronic
1153196808 18:2608499-2608521 TTATAAAAACAAATGCGGCTGGG - Intronic
1153366960 18:4267469-4267491 TTGTTAAAACAAATGGAGGTGGG - Intronic
1153627500 18:7035710-7035732 ATTTAAAAAGAAAGGGAGCTGGG - Intronic
1154982145 18:21511644-21511666 TCTTAAAGAAAAATGGTGCTGGG - Intronic
1156730140 18:40183904-40183926 ATTTAAACACATGTGGAGCATGG - Intergenic
1158278773 18:55797821-55797843 TTTAAAAAACAGATGGAGCAAGG - Intergenic
1158450366 18:57558622-57558644 TTTTAAAGAAAAGAGGAGCTGGG + Intronic
1159013789 18:63084555-63084577 TTTAAAACACAAATGCAGGATGG + Intergenic
1159143108 18:64420971-64420993 TTTTAAACAAATATGAGGCTTGG - Intergenic
1159183352 18:64939486-64939508 CTTTAAACACGAATGAGGCTGGG + Intergenic
1161044119 19:2125704-2125726 TTTTAAACAGAAATGTAGGCCGG + Intronic
1162706405 19:12558310-12558332 TTTTAAAAACTGATGGGGCTGGG + Intronic
1163530668 19:17847191-17847213 TTTTAAACTCGACTGGGGCTGGG - Intronic
1163787454 19:19282425-19282447 TTTTTAACATAAATAGAGATGGG - Intronic
1165546509 19:36541527-36541549 TTTAAAAGAAAAATGTAGCTGGG + Intronic
1165703505 19:37957025-37957047 TTTTTTCAACAAATGGAGCTGGG - Intronic
1166819602 19:45569553-45569575 TTCTAAACTCTAATGGAGGTGGG - Intronic
1168007172 19:53499831-53499853 TTTCAAAGTCAAATGAAGCTGGG + Intergenic
925030311 2:645410-645432 GTTGAAACACAAATGCAACTGGG - Intergenic
925267345 2:2575179-2575201 TTCTAAACACAACTGCAGCAGGG + Intergenic
925415080 2:3664374-3664396 TCTTAACTACAAATGGAGCTTGG + Intronic
925659855 2:6190897-6190919 TTTAAGACACAAGAGGAGCTGGG - Intergenic
925894656 2:8462100-8462122 ATCTAGACAAAAATGGAGCTTGG + Intergenic
926351951 2:12003833-12003855 TTTGAAACATAACTGGAACTTGG + Intergenic
926565298 2:14462603-14462625 TTTTAAAAACAAAACAAGCTGGG + Intergenic
927116328 2:19905783-19905805 TTTTTTAAACAAATGGTGCTAGG + Intergenic
927373661 2:22387654-22387676 TTTCAAATTCAAATGTAGCTTGG - Intergenic
928505841 2:31951824-31951846 TTTTAAAATCAAATGGGGCTGGG - Intronic
928851050 2:35747438-35747460 TAATAAACACATATGGATCTGGG - Intergenic
929766150 2:44845494-44845516 TTTTAAATATAAAAGTAGCTGGG - Intergenic
930159711 2:48142333-48142355 TTTTAATCACAAAGGGATATTGG + Intergenic
931310990 2:61080413-61080435 TCTTAAACACAAATGGTGAAGGG - Intronic
931311139 2:61082033-61082055 TTTTAAAATTAAATGGAGATGGG + Intronic
931996036 2:67840094-67840116 CTTTAAATTCAAATGGACCTGGG - Intergenic
933991068 2:87634285-87634307 TTTTAACCACGAATTAAGCTTGG + Intergenic
934669354 2:96199859-96199881 TTTTAATCACAAAAGGAGGCTGG + Intronic
934688510 2:96339104-96339126 GTTTAAACACACATGTGGCTGGG - Intronic
934954893 2:98608990-98609012 TCTGAAATCCAAATGGAGCTGGG + Intronic
935044804 2:99471289-99471311 TTTTAAACACAGATGACCCTGGG - Intronic
935410187 2:102753540-102753562 TTTTAAAAAAAAATTGAGATGGG + Intronic
936302771 2:111316538-111316560 TTTTAACCACGAATTAAGCTTGG - Intergenic
936852229 2:116914348-116914370 TTTTAAGGGCAAATGGAGATTGG - Intergenic
936953157 2:117998523-117998545 TTTAAAGCAAAAATGGAGATTGG - Intronic
937933527 2:127223751-127223773 ATTTAAACACACATGGAGACAGG + Intergenic
938168326 2:129052711-129052733 TTTTCATAACAAATGGTGCTGGG + Intergenic
939998378 2:148941585-148941607 AGTTAAAAACAAATTGAGCTTGG - Intronic
940185849 2:150984386-150984408 CTTTAAACAAAAATGTAGCCAGG - Intergenic
940301704 2:152181942-152181964 TTTAAAACACGAATGTGGCTGGG - Intergenic
940425193 2:153524000-153524022 TTTTAATCACAAATGGGTGTTGG + Intergenic
940511616 2:154622711-154622733 CTTTAATCACAAATGGTGCAGGG + Intergenic
940731216 2:157394961-157394983 TTTAAATCACAAATACAGCTGGG + Intergenic
941461430 2:165776911-165776933 GTTTAAACACAAATTGAGAAGGG + Intronic
942553571 2:177147682-177147704 TCTTTAGCACAAATGTAGCTTGG - Intergenic
943325415 2:186491616-186491638 TTTTAATCCCAAACAGAGCTGGG - Intronic
943662832 2:190577578-190577600 TTTTAAACCCTAGTGAAGCTGGG + Intergenic
945179712 2:207079443-207079465 TATAAAACAAAAATGGCGCTTGG - Exonic
945853173 2:215034487-215034509 TTTTAGTCACTGATGGAGCTTGG - Intronic
946542300 2:220697938-220697960 TTCTAAACACATATGGAACCTGG + Intergenic
947382801 2:229561645-229561667 TATTAAACAGAAATGTAGCACGG - Intronic
947384640 2:229578727-229578749 TTTCAAAAGCAACTGGAGCTGGG - Intronic
947776642 2:232717149-232717171 TATTTAACACAACTGGAGCTGGG + Intronic
948937015 2:241172988-241173010 TTTTAAAAATAAATAGAGATGGG + Intronic
1169803172 20:9532368-9532390 TTTTAAACACAAATGCCTGTGGG + Intergenic
1171032531 20:21690599-21690621 TTTTAAACATGAATGGTACTGGG + Intergenic
1172681029 20:36715520-36715542 TTTTAAACAACCTTGGAGCTGGG + Intronic
1173401226 20:42727772-42727794 TTTTAAACACAAAAGTAACAAGG - Intronic
1174707764 20:52674676-52674698 TTTCATACATAAATGGATCTAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175077421 20:56388101-56388123 TTATAAACCCACATGGAGGTTGG - Intronic
1176992099 21:15509260-15509282 GATAAAACAGAAATGGAGCTAGG + Intergenic
1178176664 21:30107977-30107999 TTTTAAATAAATATAGAGCTGGG - Intergenic
1178254025 21:31034239-31034261 TTTAAAACAGAAATGGAGCAAGG + Intergenic
1178713073 21:34937266-34937288 TTAAAAACACAGATGGACCTGGG + Intronic
1178773132 21:35524118-35524140 TTTTCAAAACAAATGGGGCCGGG - Intronic
1179235607 21:39542820-39542842 TTTAAAATAAAAATGGAGATGGG + Intergenic
1179262134 21:39766946-39766968 TTTAAAACACAAATAGAAATAGG - Intronic
1179318881 21:40270952-40270974 TTTTCAACAGAAAAGGAGATGGG + Intronic
1180728395 22:17962907-17962929 TTTTAAAAAAAAATTTAGCTGGG - Intronic
1181893517 22:26085806-26085828 TTTTAAAGGCACATGGAGCTGGG - Intergenic
1182327838 22:29527473-29527495 TTTTTTACACAAATGGAAATAGG - Intronic
1182529463 22:30944252-30944274 TATAGAACACAAATGGAACTCGG - Intronic
1183793854 22:40098886-40098908 ATTTAAAAACAAAAAGAGCTGGG - Intronic
1184211390 22:43037694-43037716 TTTTCAACACAAATGGTACTTGG - Intergenic
950028083 3:9834365-9834387 GTGTAAACACTAAAGGAGCTGGG - Intronic
950383527 3:12637573-12637595 CTTAAAACACAAATGGAGGCCGG + Intronic
951473695 3:23082394-23082416 TTTTACACAAAAGTGGAGCATGG + Intergenic
951942312 3:28093060-28093082 TTTTTGTCACAAATGGTGCTGGG - Intergenic
954657031 3:52200435-52200457 TTTTAAAAACAAATTTATCTTGG + Intronic
954972560 3:54663510-54663532 TTTAAAACACAAATGGGGTCTGG + Intronic
955073748 3:55593515-55593537 TTTTGAAGACATAAGGAGCTTGG - Intronic
955712436 3:61794178-61794200 TTTTAAAGTAAAATGGAGATGGG - Intronic
956038614 3:65121924-65121946 TTGTAAAGACCAATGGGGCTAGG + Intergenic
957053024 3:75424852-75424874 TTTTAAACAAAACTGGGGCTGGG + Intergenic
957848943 3:85779881-85779903 TTTTAAATACGAAAGGAGCTAGG + Intronic
958839214 3:99183191-99183213 TTTTATACACAAATGCATCTAGG - Intergenic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
959832283 3:110878760-110878782 TTGAACACACAAATGGAACTTGG + Intergenic
960474576 3:118108325-118108347 TTTTAAATACTAATGTAACTGGG + Intergenic
960614463 3:119584265-119584287 TTTTAAAGAAAAATGCGGCTAGG + Intronic
960649647 3:119932757-119932779 TTTAAAACACAAATAGTACTTGG + Intronic
961301813 3:125926685-125926707 TTTTAAACAAAAATGGGGCTGGG - Intergenic
961324359 3:126101543-126101565 TTTCAGACACAAACAGAGCTTGG - Intronic
961886654 3:130101153-130101175 TTTTAAACAAAAATGGGGCTGGG + Intronic
962742446 3:138371771-138371793 TGTTAAACACAGGTGCAGCTAGG - Intronic
963586244 3:147192733-147192755 TTTCAAACAAAAATGAAACTAGG - Intergenic
963986510 3:151601389-151601411 TTTGAAACAAAAATGGAATTTGG + Intergenic
964144662 3:153444676-153444698 TTCTAAACAAAAAATGAGCTGGG + Intergenic
964172094 3:153782976-153782998 TTTTAAACATAATTAAAGCTCGG - Intergenic
964295756 3:155231430-155231452 TATTAAACACAAATGTATCATGG + Intergenic
964413611 3:156425100-156425122 TGTCAAATCCAAATGGAGCTGGG + Intronic
964615952 3:158665171-158665193 TTTTAAAAACAATGTGAGCTTGG - Intronic
966894336 3:184431838-184431860 TTTAAAACATTAATTGAGCTGGG + Intronic
968878452 4:3286511-3286533 TTTAAACCAAGAATGGAGCTTGG - Intergenic
968995821 4:3945170-3945192 TTTTAAACAAAAATGGGGCTGGG + Intergenic
969193078 4:5538764-5538786 TTTTAATCAGAAATGGACATTGG - Intergenic
969758160 4:9163554-9163576 TTTTAAACAAAAATGGGTCTGGG - Intergenic
969818132 4:9701085-9701107 TTTTAAACAAAAATGGGTCGGGG - Intergenic
970150467 4:13083708-13083730 TATTTAACAAAAATGGAGATGGG - Intergenic
970360235 4:15302006-15302028 TTTTTCACACAAATTGTGCTGGG + Intergenic
971033480 4:22667005-22667027 TTTTAAAAATAAATGGTGATGGG - Intergenic
971768923 4:30871076-30871098 TTTTAAAAACAAATGAAGAAGGG - Intronic
972958629 4:44423618-44423640 TTCTAAAGACAAATGGAGGGTGG + Intronic
973759767 4:54105136-54105158 TTTTAAACAGGAAAAGAGCTGGG + Intronic
976579380 4:86717544-86717566 TTATAAAAACAAAGAGAGCTAGG - Intronic
976811197 4:89103156-89103178 CTTTAAACCCAAATGTAACTGGG + Intronic
976979108 4:91203319-91203341 TTTTAAAAATAAATGTTGCTAGG + Intronic
977725936 4:100297024-100297046 CGTTAAACACAAATTGGGCTAGG - Intergenic
977806641 4:101307271-101307293 CTGTAATCACAAGTGGAGCTAGG - Intronic
979509869 4:121540229-121540251 TTTCAACAACAAATGGTGCTGGG - Intergenic
979946137 4:126833688-126833710 TTTTAAAAAAAATTGGAGCTGGG + Intergenic
980176360 4:129350269-129350291 TCTTTTACACAAATGGTGCTGGG - Intergenic
980441162 4:132846589-132846611 ATTTTAGCACAAATGGTGCTTGG - Intergenic
980570100 4:134604160-134604182 TTTTAAACTCAAATAAAGATAGG + Intergenic
980674220 4:136053728-136053750 TTTGAAACACAAATGCATTTAGG + Intergenic
980895877 4:138859721-138859743 AAATTAACACAAATGGAGCTGGG - Intergenic
981087823 4:140701868-140701890 TTTTAAACATAAATGGAAAGTGG - Intronic
981481506 4:145243510-145243532 TTTTAAACCCAAGTGGCGCCTGG - Intergenic
982174763 4:152695150-152695172 TTCTAAACACTGATGGGGCTGGG + Intronic
982287718 4:153752725-153752747 TTTGAAAGACAAATTGAACTGGG + Intronic
982641039 4:157961361-157961383 TCTTGAAAACAAATGGAACTAGG - Intergenic
982723708 4:158883535-158883557 TTTAAAACACAAAGGGAGGCTGG - Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG + Intronic
983942288 4:173547673-173547695 TTGTAAACAGACATGGAACTAGG - Intergenic
984449339 4:179878976-179878998 TCTTCCAGACAAATGGAGCTCGG + Intergenic
986682293 5:10245123-10245145 GTTTAAACACAATTCAAGCTGGG + Intronic
987120441 5:14762058-14762080 TTTTAAAGGCAAAAGGGGCTGGG - Intronic
987351649 5:17027251-17027273 TTTTAAAAACAAATGAGGCTAGG - Intergenic
987711264 5:21502586-21502608 TTTAAAAAAAAAAAGGAGCTGGG + Intergenic
987761694 5:22171857-22171879 TTTTAAAGACAAATTGTGCAAGG + Intronic
988820074 5:34874560-34874582 ATTTAACAACAAAAGGAGCTGGG + Intronic
988899766 5:35719327-35719349 TTTTTAACAAAAATGAAGATGGG - Intronic
989148441 5:38272362-38272384 TTTTAAAGACAAATGGGGGAAGG - Intronic
989433066 5:41377861-41377883 TTTACAACTCAAATGGATCTTGG + Intronic
989509559 5:42269165-42269187 CTTTAAACACCAATGAGGCTGGG + Intergenic
989782683 5:45288253-45288275 ATTTAAAAAGAAATGGAGGTAGG - Intronic
989952530 5:50316574-50316596 TTTAAAATAAAAATTGAGCTTGG - Intergenic
990252309 5:53928547-53928569 TTTTACAAACAAATAGAGCCAGG + Intronic
990617886 5:57526071-57526093 TAGTCAACACATATGGAGCTGGG + Intergenic
990815190 5:59776885-59776907 TTTAAAAAATATATGGAGCTGGG + Intronic
991064261 5:62409097-62409119 TTATAAACAAAAATGAATCTAGG + Intronic
991333067 5:65513911-65513933 TTTTAATCACAAATAGATGTTGG + Intergenic
991878166 5:71196864-71196886 TTTTAAAAAAAAAAGGAGCTGGG - Intergenic
991896480 5:71405297-71405319 TTTTAAAGACAAATTGTGCAAGG + Intergenic
992393921 5:76354629-76354651 TTTAAAACACTAATGGGGCCTGG + Intergenic
993072052 5:83177466-83177488 CTTTAAAAACATATCGAGCTTGG + Intronic
993432354 5:87847425-87847447 CTTTAAAAAAAAATGTAGCTTGG - Intergenic
994017640 5:94986809-94986831 TAACAAACACAAATGGACCTAGG - Intronic
994206234 5:97039015-97039037 TTATAAACACAAATGGGAATAGG - Intergenic
994781088 5:104090940-104090962 TTAAAAACACAAATACAGCTAGG + Intergenic
996195392 5:120600140-120600162 AATTAAACAAAAATGGAGCTGGG - Intronic
996379434 5:122848390-122848412 TTTTAAACACAAACACAGGTCGG - Intronic
996688820 5:126315198-126315220 TTCTGAACACAAAATGAGCTTGG - Intergenic
996877531 5:128255730-128255752 TTTTAAAAAAAAATGGAGGCTGG + Intergenic
997305695 5:132834531-132834553 TTTTCAATAGAGATGGAGCTAGG + Intergenic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
998007618 5:138667308-138667330 TTTTAAATAGAGATGGGGCTGGG + Intronic
998726044 5:145015928-145015950 TTTCAAATAAAAATTGAGCTGGG - Intergenic
1000414751 5:160972118-160972140 CTTTAAAAAAAAATGGAGCCAGG - Intergenic
1000837314 5:166171814-166171836 ATTTAAAAAAAAAAGGAGCTAGG - Intergenic
1001285419 5:170419519-170419541 CTTCAACCAGAAATGGAGCTTGG + Intronic
1001543239 5:172553739-172553761 TTTAAAACACAAATCTGGCTGGG - Intergenic
1002278325 5:178116982-178117004 TTTTAAAAATAAATAGAGATGGG + Intronic
1003025396 6:2550602-2550624 TTTTAAACACATAGTGAGTTGGG + Intergenic
1003165952 6:3678527-3678549 ATTTTAACACAAATGGTGGTTGG - Intergenic
1003805018 6:9718399-9718421 TTTTAAAATCAGATGGAACTGGG + Intronic
1004139172 6:12999865-12999887 TTTGAAACACTAAAGCAGCTAGG + Intronic
1004419496 6:15455517-15455539 TTTTAAACGTAATTGGAGCCAGG + Intronic
1004710134 6:18162023-18162045 TTTTAAACACAAAGAGGGCCAGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005253906 6:23979223-23979245 TTTTAAACAAAAATGGGACTAGG + Intergenic
1005637137 6:27763021-27763043 TTTTAAACACATATGAAAATGGG - Intergenic
1007334526 6:41143700-41143722 TTTAAAAAACAAATGGTGCTAGG - Intergenic
1007483684 6:42166334-42166356 TTTTAAAGACAAAAGGAGGCCGG - Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1008853561 6:56053964-56053986 TTTTCAACTGAAATTGAGCTGGG - Intergenic
1009017185 6:57919002-57919024 TTTAAAAAAAAAAAGGAGCTGGG - Intergenic
1009393891 6:63174733-63174755 TTTTTAACACAAATGTACATTGG - Intergenic
1009594055 6:65711528-65711550 GTACAAACAAAAATGGAGCTGGG - Intergenic
1009739466 6:67724688-67724710 TTTTATACACTATTGAAGCTAGG - Intergenic
1011490099 6:87882919-87882941 TTTTAAACATAACTGGAGTTTGG + Intergenic
1011530421 6:88314945-88314967 TTTTAAACACAAATGGCTCCGGG + Intergenic
1012915164 6:105162282-105162304 TTTTAAGCACAAATGCTGTTGGG + Intronic
1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG + Intronic
1013595261 6:111655029-111655051 TCTTAAAGACAAATGGAAGTAGG - Intergenic
1014939800 6:127424668-127424690 TTTTAAACATAAAAGGGGGTTGG - Intergenic
1015133708 6:129843563-129843585 TTTTGAAATCAAATGGAGCCAGG + Exonic
1015284480 6:131469664-131469686 AATAAAACACAAATGGAACTTGG - Intergenic
1015642401 6:135349593-135349615 TTTTCAACAAAAATGGTGGTGGG + Intronic
1015647770 6:135413589-135413611 TTTTACACAGATATGGAGCCAGG - Intronic
1015649350 6:135437541-135437563 TTTTATACAGAAAAGGAGGTTGG + Intronic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016333250 6:142976050-142976072 TTTTAAACATTTATGGAGCCTGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1017026284 6:150184244-150184266 TTTAAGGCACAAATGGAGCATGG + Intronic
1017126318 6:151067690-151067712 TGTTAAACATAAATGTAGATGGG + Intronic
1017633060 6:156417752-156417774 TTTTAAACCCAAGTGAAGCCGGG - Intergenic
1019234754 6:170601369-170601391 TTGTAAACAGAAATGAGGCTGGG - Intergenic
1020320098 7:6933591-6933613 TTTAAAACAAAAATGGGGCTGGG + Intergenic
1021363335 7:19744934-19744956 TTTTAATGACAATTGAAGCTTGG + Intronic
1021932416 7:25594970-25594992 TTTGAAACTCAAATTGAACTGGG + Intergenic
1021949181 7:25757704-25757726 TTCAACACACAAATGGTGCTAGG - Intergenic
1022094903 7:27133124-27133146 TCATAAACACAAACGGAGCCAGG + Intronic
1023165958 7:37343768-37343790 TTTTAAAAAGAAATGGGGCTGGG - Intronic
1023403228 7:39805915-39805937 TTTAAAACAAAAATGGGGCTGGG - Intergenic
1023895812 7:44431970-44431992 TTTTAAAAACAAATGGAAGGAGG - Intronic
1024379616 7:48681455-48681477 TTTTAGACTCAAATAGATCTTGG - Intergenic
1025818392 7:64941464-64941486 TTTAAAAAACAAATGTGGCTGGG + Intergenic
1026275734 7:68874408-68874430 TTTTAAATATAAATTGAGTTTGG + Intergenic
1026882095 7:73913463-73913485 TTTTAATCATAAAAGGAGCTGGG + Intergenic
1028839731 7:95415655-95415677 TTTAAAACACAGATTGCGCTGGG + Intronic
1030459556 7:109814992-109815014 TTTTAATCACAAACTGATCTTGG + Intergenic
1030925414 7:115447529-115447551 TTATAAACCCAAAGGAAGCTAGG - Intergenic
1031857878 7:126943598-126943620 TGTTAAAGACAAATGGAGTCTGG - Intronic
1032640335 7:133759341-133759363 TTTAAAACTCAAGTGGATCTGGG + Intronic
1032998633 7:137477954-137477976 TTAAAAATACAAATGTAGCTGGG - Intronic
1034161827 7:148999705-148999727 TTTTAAAAATAAATGTAGCGTGG - Intergenic
1035104802 7:156433270-156433292 TTTAAAACCAAAATGGGGCTAGG - Intergenic
1038042844 8:23740565-23740587 CTTTAAAAAGAAATGCAGCTGGG + Intergenic
1038224174 8:25640171-25640193 TTTAAAACAGACATGGAGCCAGG + Intergenic
1038394584 8:27237424-27237446 ATTTAAACAAAAATAGAGATGGG + Intronic
1038622377 8:29156280-29156302 TTTTAAAAGCAAATGAAGCCAGG + Intronic
1038791667 8:30673437-30673459 TCTTAAAAAAAAATGTAGCTAGG + Intergenic
1038909060 8:31941341-31941363 TTTTAGTCACAAAGGGAGATTGG - Intronic
1038923026 8:32106748-32106770 TTTTTAAAAAAAATGGAACTGGG + Intronic
1039140380 8:34380934-34380956 TATTAAAAAAAAATGGAGCCAGG + Intergenic
1039438986 8:37581595-37581617 TTTGAAACTCAAATGGGGCAAGG + Intergenic
1039717356 8:40124074-40124096 TTTTAAAAACATATGAAGCAAGG + Intergenic
1040442424 8:47457824-47457846 TATTCAGCACAAATGGTGCTGGG - Intronic
1041249009 8:55916879-55916901 TTTTAAAAACAGATGGGGCTGGG + Intronic
1041644022 8:60233099-60233121 TTTTAATCAGGAATTGAGCTTGG - Intronic
1041763974 8:61398025-61398047 TTTTGCACAAAAAAGGAGCTTGG + Intronic
1041949152 8:63480641-63480663 TTTTAATCTCTAAAGGAGCTTGG - Intergenic
1042264131 8:66891515-66891537 TTTTAATCATAAATGGATATTGG + Intronic
1045735178 8:105287694-105287716 TTTTTTAAACAAATGGTGCTAGG - Intronic
1045833614 8:106493782-106493804 ATTGAAAGAAAAATGGAGCTGGG + Intronic
1046523091 8:115350532-115350554 TGATGAAAACAAATGGAGCTTGG - Intergenic
1046588839 8:116181135-116181157 TTTTAAATACAAATTGAGGCCGG - Intergenic
1047131579 8:122026594-122026616 TCTTAAACACATCTGGTGCTGGG + Intergenic
1047660803 8:127034374-127034396 TTTTAAAAAAAAATGTGGCTTGG + Intergenic
1048940054 8:139392754-139392776 TTCTAAATTCAAATGGAGCTTGG - Intergenic
1050785393 9:9394798-9394820 TTTTAATCAAAAATGGAGCTTGG - Intronic
1051894417 9:21973355-21973377 TATTAAACACCAATGTAGTTAGG + Intronic
1052046225 9:23797487-23797509 TTTAAAACAGAAAGGGTGCTTGG + Intronic
1052872462 9:33521481-33521503 TTTTAAATAAAAATGGATATAGG + Intergenic
1055394496 9:75859642-75859664 TTTGGAAAACAAATAGAGCTTGG - Intergenic
1055452009 9:76439518-76439540 TTAAAAACACAAATGGGGCCAGG - Intronic
1055717025 9:79128923-79128945 TTGTGAACACACATGGAGATGGG - Intergenic
1055906503 9:81300540-81300562 TTTTAAACAAAATTGAAGGTTGG + Intergenic
1056079646 9:83078369-83078391 TATTAAACAGAAATGAGGCTGGG + Intergenic
1056591013 9:87966085-87966107 TTTTAAAAATAAAGGGAGCCTGG + Intergenic
1057019369 9:91684260-91684282 TTTTAAAAACAAATGCTTCTTGG - Intronic
1057685153 9:97226478-97226500 TTTTAAATAAAAATGGATATAGG - Intergenic
1058398332 9:104582466-104582488 TTTTAAAAACACATGGAGAATGG + Intergenic
1058671727 9:107366083-107366105 TTTAAAATTCAAATGGGGCTGGG + Intergenic
1059505231 9:114792661-114792683 TCTTGAACACAAATGAATCTTGG + Intronic
1060783938 9:126434227-126434249 TTTTAAACATAAATGCATTTAGG - Intronic
1061087493 9:128407756-128407778 TTTTAAAGGCAACTGCAGCTGGG + Intergenic
1061148221 9:128812998-128813020 CTTAAAACACAAATACAGCTGGG - Intergenic
1062246936 9:135573928-135573950 TTTAAAACACTAATGAAGTTGGG + Intergenic
1185981613 X:4785908-4785930 TTTAAAAGCAAAATGGAGCTGGG + Intergenic
1187021283 X:15385099-15385121 TGTTCATCACAAATGGACCTAGG + Exonic
1187667817 X:21633662-21633684 TGTTAAACACAGATATAGCTGGG + Intronic
1188895136 X:35658640-35658662 TTTTCAACCCAGATGGACCTGGG + Intergenic
1189040787 X:37540758-37540780 TTAAAAACAGAAATGGAGTTGGG - Intronic
1190081928 X:47363417-47363439 TTAGAAACACAAAAGAAGCTGGG + Intergenic
1190271791 X:48870041-48870063 TTTTAAAGACCATTGAAGCTAGG + Intergenic
1190623379 X:52311540-52311562 TTTAAAAAATTAATGGAGCTAGG + Intergenic
1192813208 X:74567421-74567443 TCTTAAAATCAGATGGAGCTGGG - Intergenic
1193448915 X:81642532-81642554 TTTAAAAGACCAATGAAGCTAGG - Intergenic
1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG + Intronic
1193804712 X:85981528-85981550 TTTTAAATATAAATAGAGCTCGG - Intronic
1194051811 X:89078587-89078609 TTTTAAATACACATACAGCTTGG + Intergenic
1194135559 X:90136548-90136570 TTTTGAACAGAAATGTGGCTTGG - Intergenic
1194366230 X:93017950-93017972 TTTAAAACAAAAATGGATGTTGG - Intergenic
1195038825 X:100994929-100994951 TTCAAAACACAACTGGGGCTGGG - Intergenic
1195375369 X:104221775-104221797 TTTTAATCAGGAATGGAGGTTGG + Intergenic
1195714501 X:107805532-107805554 TTTTAAAAAGAAATGGGGGTGGG - Intergenic
1196506433 X:116449768-116449790 ATTCAAAAACAAATGGAACTTGG + Intronic
1196521252 X:116675003-116675025 ATTAAAAAACAAATGGAACTTGG - Intergenic
1196732010 X:118950420-118950442 TTTAAAAAACAAATGGGGCCAGG - Intergenic
1197009418 X:121542968-121542990 TTTTTAAAACAAATTGTGCTGGG - Intergenic
1199171631 X:144740342-144740364 TATTAAACATAAACTGAGCTTGG - Intergenic
1200481327 Y:3706629-3706651 TTTTGAACAGAAATGTGGCTTGG - Intergenic
1201289094 Y:12405297-12405319 TTTTAAAAATATTTGGAGCTGGG + Intergenic
1202087324 Y:21152646-21152668 TTATAAACAAAAATGAAGATCGG - Intergenic