ID: 1013235926

View in Genome Browser
Species Human (GRCh38)
Location 6:108197906-108197928
Sequence CCTCCTCTTTGGTGTCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013235920_1013235926 15 Left 1013235920 6:108197868-108197890 CCGAAACCGTCTGGCAGTCTCTT No data
Right 1013235926 6:108197906-108197928 CCTCCTCTTTGGTGTCTTGGTGG No data
1013235919_1013235926 20 Left 1013235919 6:108197863-108197885 CCAAGCCGAAACCGTCTGGCAGT No data
Right 1013235926 6:108197906-108197928 CCTCCTCTTTGGTGTCTTGGTGG No data
1013235921_1013235926 9 Left 1013235921 6:108197874-108197896 CCGTCTGGCAGTCTCTTTGACCT No data
Right 1013235926 6:108197906-108197928 CCTCCTCTTTGGTGTCTTGGTGG No data
1013235918_1013235926 21 Left 1013235918 6:108197862-108197884 CCCAAGCCGAAACCGTCTGGCAG No data
Right 1013235926 6:108197906-108197928 CCTCCTCTTTGGTGTCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013235926 Original CRISPR CCTCCTCTTTGGTGTCTTGG TGG Intergenic
No off target data available for this crispr