ID: 1013241972

View in Genome Browser
Species Human (GRCh38)
Location 6:108254584-108254606
Sequence CAACACTGCTTGGCACATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 12, 3: 65, 4: 426}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013241972_1013241975 -9 Left 1013241972 6:108254584-108254606 CCACTATGTGCCAAGCAGTGTTG 0: 1
1: 0
2: 12
3: 65
4: 426
Right 1013241975 6:108254598-108254620 GCAGTGTTGGATATTGAGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 121
1013241972_1013241976 -8 Left 1013241972 6:108254584-108254606 CCACTATGTGCCAAGCAGTGTTG 0: 1
1: 0
2: 12
3: 65
4: 426
Right 1013241976 6:108254599-108254621 CAGTGTTGGATATTGAGTAAGGG 0: 1
1: 0
2: 2
3: 24
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013241972 Original CRISPR CAACACTGCTTGGCACATAG TGG (reversed) Intronic
900204692 1:1426985-1427007 CAGCACTGCCTGGCCCACAGCGG + Intronic
901350124 1:8588039-8588061 TTACAGTGCATGGCACATAGTGG - Intronic
901448103 1:9320214-9320236 GAACAATGCTTGGCACACAGTGG - Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
903022547 1:20404290-20404312 AAACAGTGCCTGGCACATAGTGG - Intergenic
903285437 1:22273933-22273955 AGACACTCCTGGGCACATAGTGG + Intergenic
904088272 1:27926478-27926500 TCACAGTTCTTGGCACATAGAGG + Intergenic
904208159 1:28868439-28868461 CCAAAGTGCCTGGCACATAGTGG + Intergenic
904699026 1:32347357-32347379 CCACAGTGCCTGGCCCATAGGGG + Intergenic
904956194 1:34285847-34285869 AAACAGTGCTTGGCCCATAGTGG + Intergenic
905524822 1:38628520-38628542 GAACAGTGTGTGGCACATAGAGG + Intergenic
905770185 1:40632750-40632772 CAACAGCGCCTGGCACCTAGAGG - Intronic
905877751 1:41443799-41443821 CCACAGTGCTGAGCACATAGTGG - Intergenic
905971301 1:42144517-42144539 CAATCCTGCTTGGCAAATCGGGG + Intergenic
906610887 1:47201476-47201498 GCACAGTGCCTGGCACATAGTGG - Intergenic
907447379 1:54517329-54517351 ACACAGTGCTTGGCACAAAGTGG + Intergenic
907502082 1:54887936-54887958 CAACACTGCCTGGCACAGAGCGG - Intergenic
907576496 1:55530874-55530896 CATCACTCCTTGGGACTTAGAGG - Intergenic
907898211 1:58713173-58713195 GAACAGTGTCTGGCACATAGTGG - Intergenic
907925950 1:58955347-58955369 GAACAGTGCCTGCCACATAGTGG + Intergenic
907939959 1:59078051-59078073 CAAGACTGTCTGGCACCTAGAGG - Intergenic
908261780 1:62344719-62344741 AAGCTCTGCCTGGCACATAGTGG - Intergenic
908406801 1:63822238-63822260 TAACAGTGTCTGGCACATAGTGG + Intronic
908411040 1:63865726-63865748 GTACAGTGCTTGGCACATAGCGG + Intronic
908530087 1:65026065-65026087 TAAAAGTGCCTGGCACATAGAGG + Intergenic
910259029 1:85278114-85278136 GAACAGTGTCTGGCACATAGTGG - Intergenic
910263754 1:85316547-85316569 CAACATTGGTTGGAACATTGAGG - Intergenic
910448055 1:87318829-87318851 GAACATTGGTTGGCACATAATGG + Intergenic
911056674 1:93714410-93714432 GAACACTGCCTGGCACATAGTGG + Intronic
911244448 1:95501205-95501227 CAACACTGCATGGGACAGACTGG - Intergenic
911389220 1:97217791-97217813 CAACAATGATTGGCACATCAGGG - Intronic
911632279 1:100196730-100196752 GAAGAATACTTGGCACATAGTGG - Intronic
911692631 1:100851663-100851685 TCACAATGCCTGGCACATAGTGG - Intergenic
912180128 1:107209314-107209336 CTACAGCTCTTGGCACATAGTGG - Intronic
912246883 1:107968875-107968897 GAAGAGTGCTTGACACATAGTGG - Intergenic
912739952 1:112185105-112185127 CAACAGTGCTTGGCATATAGTGG + Intergenic
913001464 1:114584660-114584682 CCACAGTGCATGGCACATGGTGG + Exonic
913130560 1:115834818-115834840 GAACAATGTTTGGCACACAGTGG + Intergenic
913264319 1:117029608-117029630 GCACAGTGCCTGGCACATAGGGG + Intronic
914418392 1:147505743-147505765 AAAGAATGCCTGGCACATAGCGG - Intergenic
914935574 1:151976657-151976679 CAACACTGCCCTGCCCATAGTGG + Intergenic
915890812 1:159772113-159772135 GAACAATGCTTGGCACAGTGAGG - Intergenic
917033486 1:170720911-170720933 GAACACTACTTGGCATATAAGGG - Intronic
917625019 1:176836899-176836921 TAACAATGCCTGGCACATATAGG + Intronic
918200900 1:182265952-182265974 GAACACTGTCTGGCAAATAGTGG - Intergenic
918557202 1:185817007-185817029 GAACAGTGCCTGGCACATAGTGG + Intronic
919102225 1:193108836-193108858 CTACAGTGCTTGGCACATAGTGG - Intergenic
919517458 1:198544606-198544628 GAACAGTGCTTTGCACATAGTGG + Intergenic
919777400 1:201203187-201203209 AAACAGTGCCTGGCACACAGTGG + Intronic
919827522 1:201514007-201514029 GCCCAGTGCTTGGCACATAGTGG - Intergenic
920179997 1:204126723-204126745 CAACAGTGCCTGGCACGTAGTGG - Exonic
920503962 1:206503513-206503535 GAACAGTGCTTGATACATAGTGG + Intergenic
921055957 1:211542675-211542697 TAACAGTGTTTGGCACATGGTGG - Intergenic
921070809 1:211656147-211656169 AAACAGTGCCTGGCTCATAGTGG + Intergenic
921348946 1:214215911-214215933 CCACATTTCTTGGCACATAGTGG + Intergenic
921848543 1:219909257-219909279 GAACAGTACCTGGCACATAGTGG - Intronic
922567287 1:226608914-226608936 GAACCCTGCTTGGCCCCTAGAGG - Exonic
1064133862 10:12733463-12733485 CAACACTTCCTGGCATAGAGTGG + Intronic
1064371924 10:14759604-14759626 GAACAATGCCTGGCACCTAGAGG + Intronic
1065537912 10:26732668-26732690 GAACAGTGCCTAGCACATAGTGG + Intronic
1066379840 10:34891913-34891935 CTACAGTGCCTGGCACATTGTGG - Intergenic
1069908300 10:71745117-71745139 CTCCAGTGCCTGGCACATAGTGG - Intronic
1070005149 10:72417040-72417062 GAAGACTGCTTGGCACATAGTGG + Intronic
1070392408 10:75982847-75982869 GAACAATGCCTGCCACATAGTGG - Intronic
1070566884 10:77610346-77610368 AGACAGTCCTTGGCACATAGAGG + Intronic
1070730034 10:78820512-78820534 TAACACTGCCTGTCACAGAGTGG - Intergenic
1071792983 10:88975687-88975709 AAACAGTGCCTGGCACATATTGG + Intronic
1072316219 10:94205921-94205943 GAACAGTGCATGGCACACAGTGG - Intronic
1072905498 10:99449511-99449533 GAACAGTGCCTGGCACATAGTGG + Intergenic
1073498611 10:103916868-103916890 GAACAGTGCCTGGCATATAGTGG - Intronic
1074153102 10:110776061-110776083 CAACAGTGATTGGCTCATGGGGG - Intronic
1074256775 10:111810934-111810956 CCACAATGCCTGGCACTTAGTGG + Intergenic
1074373350 10:112918716-112918738 CGACACTGCCTGGCACAGAGGGG - Intergenic
1074480895 10:113819689-113819711 GAACAGTGCCTGGCACATAGTGG - Intergenic
1074956491 10:118395929-118395951 GAAGAGTGCTTGGCACATCGTGG + Intergenic
1074960007 10:118435780-118435802 GAGTACTGCCTGGCACATAGGGG - Intergenic
1074983246 10:118636219-118636241 CAACAAAGCCTAGCACATAGCGG + Intergenic
1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG + Intronic
1078969597 11:16392338-16392360 GAACAGTGCCTGGCATATAGTGG - Intronic
1079443242 11:20535998-20536020 GAACATTGCTTGGAACATATAGG + Intergenic
1079639629 11:22788995-22789017 CCACAATTCCTGGCACATAGAGG - Intronic
1079853477 11:25568907-25568929 CTACAAAGCCTGGCACATAGTGG + Intergenic
1080043335 11:27782708-27782730 AAACAGTGCCTGGCTCATAGTGG - Intergenic
1080526521 11:33126787-33126809 CAATAATGCTTGGCATATAATGG - Intronic
1081662753 11:44898070-44898092 GAGCAGTGCCTGGCACATAGTGG - Intronic
1081738352 11:45420928-45420950 CAACAGTGGCTGGCACAAAGAGG - Intergenic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1084457532 11:69277006-69277028 CACCACTGCTTAGCCCAGAGAGG - Intergenic
1084687631 11:70706279-70706301 CAACACAGCCTGGTGCATAGCGG + Intronic
1084929328 11:72541940-72541962 CAACACTGATTTTCACAAAGAGG - Intergenic
1085045457 11:73350276-73350298 GAACAGTGCCTGGCACATAGTGG - Intronic
1085226011 11:74921825-74921847 GCACAGTGCTTGGCACACAGTGG + Intronic
1085496547 11:76975276-76975298 ACACATTACTTGGCACATAGTGG + Intronic
1085779730 11:79397210-79397232 GAACACTGCCTGGTACATAGTGG - Intronic
1085839141 11:79990542-79990564 GCACAATGCTTGGCACAGAGTGG - Intergenic
1086034594 11:82401428-82401450 CTACAGTTCTTGGCACATATAGG - Intergenic
1086239175 11:84668905-84668927 GAACAGTGCCTGGCACATTGTGG - Intronic
1087043242 11:93821846-93821868 GTACAATGCCTGGCACATAGTGG + Intronic
1087703920 11:101467410-101467432 CAACAGGGCCTGGCACATAGTGG - Intronic
1088079899 11:105899319-105899341 CAACAGTGCTTGACACATAGTGG - Intronic
1088571833 11:111230316-111230338 CTACATAGCATGGCACATAGAGG - Intergenic
1089040439 11:115443724-115443746 GCAGACTGCTTGGCACATACTGG - Intronic
1089252671 11:117176339-117176361 CAACAGTACCTGGCACATCGTGG + Intronic
1090117718 11:123992524-123992546 AAACACTCCCTGGCACAAAGGGG - Intergenic
1090470580 11:126977621-126977643 GCACAATGCCTGGCACATAGTGG + Intronic
1090816567 11:130302110-130302132 GAACAATACTTGGCACATATTGG - Intronic
1091180836 11:133603070-133603092 AAACATTGGTTGGCACATAATGG + Intergenic
1091888722 12:4035594-4035616 TAAAAGTGCTTGGCACAAAGTGG - Intergenic
1094072291 12:26431104-26431126 TAACAGTGCCTAGCACATAGCGG + Intronic
1095127094 12:38492678-38492700 TAACAGTGCCTGGCACATGGTGG - Intergenic
1097585478 12:61510658-61510680 ACACAGTGCTTGGCACATATGGG + Intergenic
1097659303 12:62411393-62411415 GAATAGTGCCTGGCACATAGTGG - Intronic
1098219817 12:68257239-68257261 GAACAGTGCCTGGCATATAGTGG + Intergenic
1098646276 12:72905375-72905397 GAAGAGTGCCTGGCACATAGGGG + Intergenic
1098845348 12:75528518-75528540 CATCTCTGCTTGGCACAGACTGG + Intergenic
1101098947 12:101372431-101372453 ACGCAGTGCTTGGCACATAGAGG + Intronic
1101219255 12:102619236-102619258 AACCAATGATTGGCACATAGAGG - Intergenic
1101549709 12:105750563-105750585 GAACAATCCTTGGCACATATTGG - Intergenic
1101740604 12:107497081-107497103 GAACAGTGCCTGGCACATAGTGG + Intronic
1101857789 12:108458281-108458303 CAACAGTGCCTGGCCCAGAGTGG + Intergenic
1102143033 12:110632382-110632404 CAGTGCTGCTTGGCACATTGTGG + Intronic
1102157821 12:110744463-110744485 GAACAATGCCTGGCACAGAGTGG - Intergenic
1102221426 12:111197455-111197477 GAACAGTGCCTGGCACAGAGGGG + Intronic
1102914000 12:116739358-116739380 GGACACTGTTTGGCACAGAGTGG - Intronic
1105553211 13:21418085-21418107 CCACACTATCTGGCACATAGTGG - Intronic
1106207991 13:27617307-27617329 CAACACTGCTTCCTAAATAGAGG + Intronic
1106433854 13:29707088-29707110 CAAGACTGCTTCCCACAGAGGGG + Intergenic
1106722438 13:32449670-32449692 GCACAATGCTTGACACATAGTGG + Intronic
1108086900 13:46803290-46803312 CAACACTTCTTATGACATAGTGG + Intergenic
1109245731 13:59952872-59952894 GAAGAATGCTTGGCACATATGGG - Intronic
1109673562 13:65641522-65641544 AAACACTGCTTAGGACATAGTGG - Intergenic
1110138173 13:72094512-72094534 CTTCAGTGCTTTGCACATAGTGG - Intergenic
1111515284 13:89323084-89323106 AAAAAAAGCTTGGCACATAGTGG + Intergenic
1111968634 13:94886895-94886917 GCACATTGCCTGGCACATAGGGG + Intergenic
1112133122 13:96545956-96545978 GCACAGTGCCTGGCACATAGTGG + Intronic
1113436374 13:110294856-110294878 GAATAGTGCCTGGCACATAGTGG + Intronic
1113697792 13:112359485-112359507 CCACTCTGCTTGTCACACAGTGG + Intergenic
1114401674 14:22416016-22416038 CAACAGTGCTGGGCACTTAGTGG - Intergenic
1115126751 14:30004189-30004211 CAATAATGCCTGGCACTTAGTGG - Intronic
1116041231 14:39688335-39688357 GAATACTGCTTGCCACATAATGG + Intergenic
1116767967 14:49095300-49095322 CATCAGTGCTAGGCACAGAGTGG - Intergenic
1116784976 14:49277706-49277728 GGAAACTGCTTGGCACATAGTGG - Intergenic
1116802734 14:49460120-49460142 CTACATTGCTTGACACATGGTGG - Intergenic
1117780602 14:59227763-59227785 CATCAGTGCTGGGCACACAGAGG + Intronic
1118166834 14:63344952-63344974 CGCCAGTGCCTGGCACATAGCGG + Intergenic
1118838824 14:69496002-69496024 GAGCAGTGCTTGGCACACAGTGG + Intronic
1119172664 14:72546710-72546732 CTTGACTGCTTGGCACATTGGGG - Intronic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121263027 14:92580428-92580450 GAACAGTGCCTGGCACAGAGTGG - Intronic
1121843875 14:97156320-97156342 GAACAGTGCCTGGCACAGAGCGG - Intergenic
1122516786 14:102314523-102314545 AAACAGTGCTTGGCACACAGCGG - Intergenic
1124015987 15:25876347-25876369 CTACAGAGCATGGCACATAGTGG - Intergenic
1124427333 15:29572699-29572721 CTTCAGTGCCTGGCACATAGTGG - Intergenic
1125356471 15:38821683-38821705 CAACTTTGTGTGGCACATAGTGG + Intergenic
1125596982 15:40893672-40893694 GAACAGTGCTTGGCACAGAGTGG + Intergenic
1126238031 15:46408359-46408381 ATACAATGCCTGGCACATAGTGG + Intergenic
1126892570 15:53222271-53222293 CAAAAGTGCCTGTCACATAGAGG - Intergenic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1128933804 15:71728416-71728438 GATCATTGCCTGGCACATAGTGG + Intronic
1129238379 15:74237252-74237274 GAACAGTGCCTGGCACATAGTGG + Intronic
1129693748 15:77728876-77728898 GCACAGTGCCTGGCACATAGCGG + Intronic
1130151018 15:81311721-81311743 GAACAGTGCTTGCCACAGAGCGG + Exonic
1130184439 15:81666419-81666441 CATCACTTCTTGTCACATAAAGG + Intergenic
1133465667 16:6024830-6024852 CAATAGTGCTTGGCACACAGTGG - Intronic
1133861909 16:9603999-9604021 GAACACTGCTTAGCACATATAGG - Intergenic
1134586486 16:15416046-15416068 GGACAGTGCCTGGCACATAGTGG + Intronic
1134617827 16:15665217-15665239 TCACACTGCCTGGCACATATAGG - Intronic
1134796220 16:17039461-17039483 CAACAGTGCCTGGCACAGAGAGG + Intergenic
1135642471 16:24133071-24133093 AAACTCTGCTTAGCACTTAGAGG - Intronic
1135748280 16:25036080-25036102 CAGCAGTGCTTGGCATATATAGG + Intergenic
1136048156 16:27631764-27631786 GAACTGTGCCTGGCACATAGTGG - Intronic
1137274823 16:46926524-46926546 CAACACTGCTTCCCACACACTGG - Intronic
1137858491 16:51821301-51821323 GAACACTGCCTGGCGCAGAGGGG - Intergenic
1138066744 16:53949311-53949333 CCACACTGATGGTCACATAGAGG + Intronic
1138209297 16:55149721-55149743 AAACAGTGTTTGGCAAATAGAGG + Intergenic
1138239990 16:55419616-55419638 GAACACTGTCTGGCACAGAGTGG + Intronic
1138265151 16:55655307-55655329 GAACAGTGCCTGGCACACAGCGG + Intergenic
1139740493 16:69031298-69031320 TCACAGTGCTTGGCACATAGTGG + Intronic
1139814238 16:69654703-69654725 GAACAGTGCCTGGCACATGGAGG - Intronic
1139829886 16:69788809-69788831 GAACAGTGCCTGACACATAGTGG + Intronic
1141177771 16:81732032-81732054 GGACACTGCTTGGCACAAGGAGG - Intergenic
1141792631 16:86246919-86246941 CAACGGTGCTTGGCACATGTAGG - Intergenic
1142076540 16:88121147-88121169 CCACAATGCATGGTACATAGCGG - Intergenic
1142477282 17:196455-196477 CAGCAGTGCTTGGCACATGCAGG - Intergenic
1143551946 17:7635706-7635728 CAACAGTGCCTAGTACATAGCGG - Intergenic
1143948393 17:10614260-10614282 GAACAGTGCTTGGCACATAGAGG + Intergenic
1145296988 17:21599855-21599877 CAACAGGGCTGGGCACACAGAGG + Intergenic
1146702743 17:34975650-34975672 GCAAACTGCTTGGCACTTAGAGG - Intronic
1147243282 17:39104851-39104873 CAACAGTGCCTGGAACATAGTGG + Intronic
1147771450 17:42870932-42870954 GAACAGTGCCTGACACATAGTGG + Intergenic
1147907364 17:43832121-43832143 ACACAATGCTTGGCACATCGAGG - Intronic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1149424663 17:56543488-56543510 GAACAGTGCCCGGCACATAGTGG + Intergenic
1149530286 17:57389594-57389616 ATGCAGTGCTTGGCACATAGTGG + Intronic
1150851285 17:68705959-68705981 GAACAGTGCCTGACACATAGTGG + Intergenic
1151339982 17:73464978-73465000 GAACAGTGCTTGGCATATGGGGG + Intronic
1155082375 18:22423544-22423566 GAACGCTGCTTGGCACATATGGG - Intergenic
1156030806 18:32709766-32709788 GAAAAATGCTTTGCACATAGTGG + Intronic
1157539682 18:48491548-48491570 GAACAGTGCCTAGCACATAGTGG - Intergenic
1158131017 18:54152748-54152770 GCACAGTGCCTGGCACATAGTGG - Exonic
1159004295 18:62999015-62999037 CAACAGTGCCAGGCAGATAGCGG + Intergenic
1160058085 18:75504899-75504921 CAACAATGCTTTGCACATTGTGG - Intergenic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1161881172 19:6954045-6954067 AAACAGTGCCTGGCACATAGCGG + Intergenic
1162306895 19:9880304-9880326 GAACAGTGCCTGGCACATAGTGG - Intronic
1165726051 19:38113707-38113729 GCACAGAGCTTGGCACATAGTGG + Intronic
1166015419 19:39975927-39975949 CAACACATCCTGGCACATAGTGG - Intronic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
1166562046 19:43739343-43739365 CAATACTGCCTGCCTCATAGGGG - Intronic
1166985215 19:46655745-46655767 GAACAGTGCCTGGCACAAAGTGG + Intronic
1167038290 19:47007261-47007283 CAACCCAGCTTAGCACAGAGCGG - Intergenic
1167517517 19:49931770-49931792 CCCAAATGCTTGGCACATAGTGG + Intronic
1167747736 19:51362595-51362617 GAACAGTGCCTGGCACACAGTGG - Intronic
926808761 2:16737901-16737923 CAACACAAGTGGGCACATAGTGG - Intergenic
927668901 2:25052474-25052496 GAATTCTGCCTGGCACATAGTGG - Intronic
928023847 2:27723912-27723934 CAACAGTGTCTGGCACACAGTGG - Intergenic
928151634 2:28835563-28835585 GAACAGTGCCTGGCACATAGTGG + Intronic
928945695 2:36770168-36770190 GAACAGTGCCTGACACATAGTGG - Intronic
929077878 2:38093349-38093371 AAACAGTGCCTGGCACTTAGGGG - Intronic
930554956 2:52883953-52883975 CCACACTGTGTGGCACCTAGTGG + Intergenic
931216857 2:60253290-60253312 GAACAGTGCCTGGCACACAGTGG - Intergenic
932219550 2:69989409-69989431 GGACAGTGCTTGGCACAGAGGGG + Intergenic
932621551 2:73267520-73267542 GAACAGTGCCTGGCACCTAGAGG - Intronic
932782822 2:74572892-74572914 CAACAGTGCTTGGCATACAGTGG + Intronic
933059803 2:77723605-77723627 CAAGATTGCTTGGCACTAAGTGG + Intergenic
934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG + Intronic
935658276 2:105443460-105443482 GCACAATGCTTGGCACATGGAGG - Intergenic
936960589 2:118069795-118069817 CACAATTGCTTGGCACATTGGGG - Intergenic
936985424 2:118307800-118307822 TAAAAGTGCTTGGCATATAGTGG + Intergenic
937399427 2:121569071-121569093 AAACAGTGCTTGGGACATGGTGG - Intronic
939003321 2:136759716-136759738 CAACAGTGCCTGGCAAATGGCGG - Intergenic
939884950 2:147671455-147671477 GAACACTGCCTGGCATATATTGG - Intergenic
939994770 2:148909516-148909538 GAACAGTACTTGGCACATGGAGG + Intronic
940623614 2:156145310-156145332 GGAGAATGCTTGGCACATAGAGG - Intergenic
941279768 2:163535405-163535427 GAACAGTGCTTGGCACAGAGTGG + Intergenic
942114279 2:172712760-172712782 CACCCCTGCTTGCCACATTGTGG - Intergenic
942255296 2:174091075-174091097 GCACAATGCCTGGCACATAGTGG + Intronic
943559356 2:189442269-189442291 CAACAATGCCCGGCACATAATGG + Intronic
946054259 2:216887222-216887244 GAACAGTGCTTTGCACACAGTGG + Intergenic
946581727 2:221135617-221135639 GAACAATGCCTGGCATATAGGGG + Intergenic
946667266 2:222064089-222064111 CCACAGTGTCTGGCACATAGAGG - Intergenic
947081069 2:226397686-226397708 ACACAATGCTTGGCTCATAGTGG - Intergenic
947182202 2:227421292-227421314 GTACAGTGCTTGGCACACAGTGG - Intergenic
947523077 2:230863480-230863502 ACACAATGCTTGGCACACAGGGG + Intergenic
947634091 2:231671446-231671468 CAACTCTCCTTGGCACATCTGGG - Intergenic
1168991081 20:2096131-2096153 CCAAACTGCCTTGCACATAGAGG + Intergenic
1169440704 20:5631634-5631656 CAGCAATGCTTGGCACTTATTGG + Intergenic
1169556002 20:6750684-6750706 AAACAGTGCCTGGCACATAGTGG - Intergenic
1169948324 20:11013574-11013596 CAGCACTACTTGGCTTATAGTGG - Intergenic
1171414344 20:24967486-24967508 CAACAGTGCCTGGCACATGTAGG - Intronic
1171968465 20:31548576-31548598 GCACAGTGCCTGGCACATAGTGG - Intronic
1172212585 20:33211435-33211457 GTTCACTGCTTGGCACATGGAGG + Intergenic
1172397035 20:34615308-34615330 AAACAATGCTTGGAACATAGTGG - Intronic
1173519656 20:43689789-43689811 CAATAATGCCTGGCACACAGTGG + Intronic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1173957376 20:47044341-47044363 GAACAATGCCTGGCACACAGTGG - Intronic
1174200611 20:48804192-48804214 GAACAGTGCCTGGCACATAGTGG - Intronic
1174361343 20:50030594-50030616 GAAGACTGCCTGGCACACAGGGG - Intergenic
1174412517 20:50345211-50345233 GAACACAGCCTGGCACGTAGTGG + Intergenic
1174497320 20:50957465-50957487 GAAAAGTGCTTGACACATAGCGG - Intronic
1174787863 20:53449428-53449450 CAACGGTGCCTGACACATAGTGG - Intronic
1174805976 20:53604805-53604827 GAACAATGCCTGGTACATAGTGG - Intronic
1175496511 20:59418240-59418262 GCACAGTGCTTGGCATATAGTGG - Intergenic
1175615056 20:60390716-60390738 CAACTGTGCCTGGCACATAAAGG - Intergenic
1176917186 21:14640123-14640145 TATCACTGCTTTGAACATAGTGG - Intronic
1177953031 21:27562449-27562471 CCACATTCCTTGGCTCATAGAGG + Intergenic
1178278759 21:31263009-31263031 ATACACTGTTTGGAACATAGTGG + Intronic
1178463002 21:32819954-32819976 CAACATGGTTTGGCCCATAGAGG + Intergenic
1178558808 21:33618441-33618463 CAACAATGCTGGGCACAAGGAGG - Intronic
1178993243 21:37373047-37373069 CTCCAGTGCCTGGCACATAGGGG + Intronic
1179835667 21:44030878-44030900 CAACAAGGCATGGCACATAGTGG - Intronic
1179839506 21:44062266-44062288 GAACAGTGCCTGGCACATGGTGG - Intronic
1182034989 22:27191055-27191077 CTTCAATGCTTGGCACATATAGG + Intergenic
1182309522 22:29394689-29394711 CAACGATGCTTGGCCCATGGTGG - Intronic
1182919440 22:34065801-34065823 CAATAATGCCTGACACATAGAGG - Intergenic
1183159960 22:36106242-36106264 GAACACTGCCTGGCTCATGGTGG - Intergenic
1183480194 22:38059640-38059662 GTACAGTGCCTGGCACATAGTGG + Intronic
1183592424 22:38787689-38787711 CCACAGTGGTTTGCACATAGTGG - Intronic
1183682124 22:39338076-39338098 GAACAATGCCTGGAACATAGTGG + Intergenic
1183722731 22:39571872-39571894 GCACAGTGCTTGGCACATCGTGG + Intronic
1183788774 22:40047846-40047868 GCACAGTGCTTGGCACATAGTGG + Intronic
1184267946 22:43359940-43359962 GAACAGTGCTTGGCATATAGTGG - Intergenic
1184287959 22:43482650-43482672 GCACACTGCTTGGCACATGGTGG + Intronic
1184359993 22:44010437-44010459 CAGGACTGCTTGTCATATAGGGG - Intronic
1184386756 22:44181154-44181176 GAACAATGCTTGGCACAAAGTGG - Exonic
1184525509 22:45020351-45020373 CAGCAGTCCCTGGCACATAGTGG - Intergenic
1184607682 22:45583495-45583517 CAGCAGTGCCTGGCACACAGTGG + Intronic
1184822804 22:46923405-46923427 TCACACTGCTTGCCACACAGAGG - Intronic
949312357 3:2714133-2714155 CAACACTGCCTGGCCAACAGGGG - Intronic
949582502 3:5403199-5403221 CTACCCTGCTTGGTACATATAGG - Intergenic
949650398 3:6151602-6151624 GCACAGTGCTGGGCACATAGTGG + Intergenic
949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG + Intronic
949982318 3:9509464-9509486 GCACAGTGCCTGGCACATAGTGG - Intronic
950026742 3:9825438-9825460 TCACAATGCCTGGCACATAGTGG + Intronic
950500601 3:13361229-13361251 GAACCATGCCTGGCACATAGCGG + Intronic
951882089 3:27489380-27489402 CCAGAGTGCCTGGCACATAGTGG + Intergenic
952358574 3:32606943-32606965 TAGCAATGCCTGGCACATAGTGG + Intergenic
952499033 3:33942218-33942240 CAGCACTGATTTGCACATATTGG - Intergenic
952616224 3:35276908-35276930 ACACACTGCTTGGGACACAGAGG + Intergenic
952666110 3:35906271-35906293 GCACAGTGCTTGGCACATGGAGG + Intergenic
953060320 3:39422707-39422729 CATCACTGATTGGCACTTTGTGG - Intergenic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953156521 3:40380125-40380147 GCACAGTGCCTGGCACATAGAGG + Intergenic
953375461 3:42424475-42424497 CTACAGTGCCTGGCACATGGTGG - Intergenic
953419602 3:42744198-42744220 CAACACAGCCTGGCACATGTGGG + Intronic
954123064 3:48511710-48511732 CCCCACTGCTTGGCACATGGTGG + Intergenic
954411006 3:50371072-50371094 GAACACTCCTTGGCACTTTGAGG - Intronic
954806381 3:53223357-53223379 GAACACTGCTAGGCAGATACGGG - Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955145770 3:56317658-56317680 CCCCAGTGCCTGGCACATAGGGG - Intronic
955152668 3:56383527-56383549 TCACAGTGCCTGGCACATAGTGG + Intronic
955444133 3:58991013-58991035 CAACTTTACTTGGCACATAGTGG + Intronic
955666235 3:61351902-61351924 GAACAGTGGCTGGCACATAGTGG - Intergenic
955787083 3:62552034-62552056 GAATAGTGCATGGCACATAGTGG + Intronic
956225063 3:66948016-66948038 GAACAGTGTTTGGCACTTAGTGG + Intergenic
956505068 3:69929247-69929269 GAACACAGCTTGGCACACTGTGG - Intronic
957724032 3:84041657-84041679 GAACAGTGACTGGCACATAGTGG - Intergenic
958928275 3:100182238-100182260 ACACAGTGCTTGGCACAGAGTGG - Intergenic
959055016 3:101559027-101559049 CAACAGTGCTTGGCAAGTATCGG - Intergenic
959621845 3:108407234-108407256 AGACAATGCTTGGCACAGAGTGG + Intronic
959678635 3:109066629-109066651 CAAGACAGCCTTGCACATAGTGG + Intronic
960671459 3:120158631-120158653 TCACAGTGCCTGGCACATAGTGG + Intergenic
960696044 3:120397484-120397506 CAACAGTGCCTGGCACAAAATGG + Intronic
961187982 3:124932644-124932666 GGATACTGCCTGGCACATAGGGG - Intronic
964440391 3:156702553-156702575 TAACACTCATTGGCACATACTGG - Intronic
966552435 3:181219944-181219966 GAACAGTGCCTGGCACATAGTGG + Intergenic
966621207 3:181966167-181966189 CCACACTCCTTGGCACACATGGG - Intergenic
968096165 3:195932271-195932293 CAACATTTCTAGGCACATACTGG + Intergenic
968833932 4:2949060-2949082 TGACACTGCTTGGCTCACAGTGG - Intronic
968980438 4:3846124-3846146 GCCCACTGCTTGGCACATATTGG - Intergenic
969858133 4:10016207-10016229 TAACACTGCCTGGCACAGAAAGG + Intronic
970246110 4:14065637-14065659 CACCAATGCCTGGCACATAATGG - Intergenic
970422149 4:15915298-15915320 AAACAGTGCTTGGCAGAAAGTGG + Intergenic
970955082 4:21801547-21801569 GAACACTGCTTGGAAAATGGTGG + Intronic
971120666 4:23700951-23700973 AAACAATGTTTGGCACAGAGAGG + Intergenic
971291847 4:25349947-25349969 AAACAGTGCCTGGCACACAGTGG - Intronic
971477755 4:27088330-27088352 GAACAGTGCCTGGCACATAGTGG + Intergenic
972608606 4:40636403-40636425 GAACACTGCCTGGAACATAATGG + Intergenic
973812359 4:54583923-54583945 GCACAGTGCTTGGCACACAGTGG + Intergenic
973917220 4:55647619-55647641 CAAGATAACTTGGCACATAGTGG + Intergenic
975760214 4:77612923-77612945 CACCCCTGCTTGGGACACAGTGG + Intergenic
976004669 4:80414968-80414990 AACCACTGCTTGAAACATAGAGG + Intronic
976097543 4:81525653-81525675 CAGCAGCGCCTGGCACATAGTGG - Intronic
976424980 4:84892679-84892701 AAACATTGCTGGACACATAGTGG - Intronic
977174872 4:93807799-93807821 ATACAGTGCTTGGCACATAGTGG - Intergenic
980064999 4:128177302-128177324 GAATAGTGCTTGGCAAATAGCGG + Intronic
981029969 4:140114334-140114356 CAACAGTACCTGGCACAGAGGGG + Intronic
981040925 4:140220797-140220819 AAAAAGTGCCTGGCACATAGTGG - Intergenic
982530987 4:156543552-156543574 CAATAGTACTTGGCACAGAGTGG - Intergenic
983902518 4:173151245-173151267 CAACAGTGCTTAGCACAATGTGG + Intergenic
984136370 4:175944742-175944764 CAAAACTGCTTGACTCTTAGTGG + Intronic
985693925 5:1329347-1329369 CACCTCTGCTTTGCACATGGTGG + Intronic
986120765 5:4834237-4834259 CACCAATGCTTGGCACATAGTGG - Intergenic
987879284 5:23720712-23720734 GAATAGTGCCTGGCACATAGAGG + Intergenic
989105249 5:37857157-37857179 CTACATTGCTGGGCATATAGGGG - Intergenic
989356522 5:40549748-40549770 GAACAGTGCCTGGCACTTAGTGG - Intergenic
989678039 5:43995814-43995836 ACACAGTGCTTGGCCCATAGTGG + Intergenic
991632943 5:68674983-68675005 GCACAGTGCCTGGCACATAGTGG + Intergenic
992024461 5:72656964-72656986 AAACAGTGCCTGGCACATGGTGG - Intergenic
992668609 5:79036160-79036182 GTATACTGCATGGCACATAGTGG + Intronic
992758270 5:79929646-79929668 GAACAGTGCCTGGCACACAGTGG - Intergenic
993633751 5:90319052-90319074 CGCCAGTGCGTGGCACATAGAGG - Intergenic
994458196 5:100041525-100041547 GAACAGTGCTTAGAACATAGTGG - Intergenic
995412935 5:111878920-111878942 AAACAGTGTCTGGCACATAGTGG - Intronic
995731965 5:115254935-115254957 CAACACTGCTTCCCACATAAAGG - Intronic
996030260 5:118696922-118696944 GAACAGTGCCTGGCACAGAGCGG - Intergenic
996284825 5:121777115-121777137 GAACTGTGCTTGGCAAATAGGGG + Intergenic
997201997 5:132016104-132016126 GAACAATGCCTTGCACATAGTGG - Intergenic
997851523 5:137337046-137337068 GAACAGTGCCTGGCACACAGTGG + Intronic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
998599454 5:143570210-143570232 GCACAGTGCTTGACACATAGGGG + Intergenic
999696023 5:154189825-154189847 GCACAGTGTTTGGCACATAGTGG + Intronic
999724987 5:154429751-154429773 CTCCACTGCTTAGCACATAATGG + Intergenic
1000171675 5:158708398-158708420 GCACACTGCCTGGCACACAGTGG - Intronic
1000365444 5:160486486-160486508 GCACAGTGCTTGGCACATAGTGG - Intergenic
1001008664 5:168077358-168077380 GAACAGTGCTTGGCCCATAGTGG - Intronic
1001133072 5:169080339-169080361 GCACAGTGCTTGGCACATAAAGG - Intronic
1001171445 5:169423275-169423297 GAACAGTGGTTGGTACATAGTGG + Intergenic
1001220910 5:169900095-169900117 GCACAATGTTTGGCACATAGTGG - Intronic
1001566264 5:172701388-172701410 GAACAGTGCCTGGCACGTAGTGG + Intergenic
1002806834 6:585109-585131 CAAGGCTGCTTTGAACATAGGGG + Intronic
1003430755 6:6035384-6035406 GCACAGTGCTTGGCACAAAGAGG + Intergenic
1003940302 6:11017856-11017878 GAACAATGCCTGGCACATAATGG + Intronic
1004267069 6:14157826-14157848 TAACAGTACCTGGCACATAGTGG - Intergenic
1005503162 6:26447779-26447801 TCACACTGCTAGTCACATAGGGG + Intronic
1006925123 6:37649756-37649778 GAACAGTGTTTGGCACATGGTGG + Intronic
1007456762 6:41984234-41984256 TAACACTGCTATGAACATAGAGG + Intronic
1007546587 6:42698955-42698977 CCCCATTGCTTGGCACATATTGG + Intronic
1007850544 6:44798714-44798736 GTACAGTGCTTGGAACATAGAGG + Intergenic
1007947473 6:45839259-45839281 CAACAGTGACTGGCACATAGTGG + Intergenic
1008541084 6:52546912-52546934 CAACAGCGCTTGGCACATAGTGG + Intronic
1009498250 6:64377043-64377065 GAATAATGCCTGGCACATAGTGG + Intronic
1012414816 6:99001839-99001861 GCACAATGCCTGGCACATAGTGG - Intergenic
1012533518 6:100267458-100267480 CAAGAGTGCTTCGCACAGAGAGG - Intergenic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1013642307 6:112097810-112097832 GAACAGTGCTTGTCACACAGTGG - Intronic
1014498628 6:122158501-122158523 AAGCACTGCTTGGGACATAATGG - Intergenic
1015449612 6:133350197-133350219 GAACACTGCATGGCACATAATGG - Intronic
1015570454 6:134616053-134616075 GCACAGTGCCTGGCACATAGTGG - Intergenic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1018630742 6:165819774-165819796 CAACAGTGCCTGCCACACAGTGG + Intronic
1018891173 6:167983969-167983991 CACCACTGCTTGTCACAAAGAGG + Intergenic
1019501232 7:1365739-1365761 GAACAGTGCCTGGCACACAGGGG - Intergenic
1019917638 7:4143919-4143941 CTACACTGCTAGGCACATCCAGG - Intronic
1020476821 7:8605496-8605518 CAACATTACTTGTCACAGAGAGG + Intronic
1020621455 7:10525003-10525025 AAACACTGCTCAGCACAGAGAGG - Intergenic
1021885431 7:25132964-25132986 CAAGACTGCTGTACACATAGTGG + Intergenic
1022057461 7:26753729-26753751 TCACAGTGCCTGGCACATAGTGG - Intronic
1023083453 7:36546891-36546913 GCACAGTGCTTGGCACATCGTGG + Intronic
1023705242 7:42933721-42933743 GCACATTGCTTGGCATATAGTGG - Intronic
1024633831 7:51270414-51270436 GAACAGTGCCTGGCACGTAGTGG - Intronic
1028492333 7:91425910-91425932 ACATAATGCTTGGCACATAGTGG - Intergenic
1028821831 7:95220633-95220655 GTACATTGCTTGGCATATAGTGG - Intronic
1029237399 7:99132352-99132374 CAACACTGCTTGGCACCTGCTGG - Intronic
1029923413 7:104290432-104290454 GCACAATGCTTGGCACATAATGG - Intergenic
1030299253 7:107959054-107959076 GAACGGTGCCTGGCACATAGAGG + Intronic
1030733816 7:113020092-113020114 CCACACTGCTTTTCACATGGCGG + Intergenic
1030919189 7:115359093-115359115 CAACACAGTTTGGCATATATAGG + Intergenic
1032102204 7:128990466-128990488 GAACAGTGCCTGGCACATAGTGG + Intronic
1032568766 7:132976473-132976495 CCATAGTGCCTGGCACATAGAGG + Intronic
1033822522 7:145151294-145151316 GATCAGTGCCTGGCACATAGTGG + Intergenic
1033907471 7:146223042-146223064 CAACAGTGCCTGGCACATATAGG - Intronic
1035067182 7:156114931-156114953 CAACATTGCTTAGCACATTTTGG + Intergenic
1035144192 7:156796932-156796954 GAATAGTGCTTGGCACATAAGGG - Intronic
1036208051 8:6819573-6819595 CAGCACTGCCTGGCACAGGGAGG + Intronic
1037744684 8:21633282-21633304 TGACACTGCTCGGCAGATAGAGG - Intergenic
1039165367 8:34673463-34673485 GAACAATGCCTAGCACATAGTGG - Intergenic
1040016980 8:42707869-42707891 GAACAGTGCCTGGCCCATAGTGG - Intronic
1040045081 8:42954670-42954692 CTACAGTGCTTGGTACATACTGG - Intronic
1040720533 8:50316809-50316831 GCACAGTGCTTGGGACATAGTGG - Intronic
1041115428 8:54531321-54531343 CAGGACTTGTTGGCACATAGCGG + Intergenic
1041617356 8:59923153-59923175 CCACACTACTTAGCACACAGTGG - Intergenic
1041619010 8:59943409-59943431 CAACTCTGCCTGGCACATAGAGG - Intergenic
1041914428 8:63125733-63125755 GGACACTGCCTGGCACATAAGGG + Intergenic
1042221199 8:66476463-66476485 CTATAGTGCCTGGCACATAGGGG - Intronic
1042379761 8:68100296-68100318 GAACAGTACTTGGCACATAGAGG - Intronic
1042618764 8:70679851-70679873 GCTCAGTGCTTGGCACATAGTGG + Intronic
1044835056 8:96287675-96287697 CTCCACTGCTTGCCACAGAGAGG + Intronic
1044914513 8:97098246-97098268 CAACAGTGCTTGGTTCATGGTGG - Intronic
1045003571 8:97898632-97898654 CCACAGTGCCTGGCACATGGTGG - Intronic
1045378073 8:101595135-101595157 GGACACTGCCTGGCACATAGAGG + Intronic
1045389318 8:101699971-101699993 CTCCACTGCTTAGCTCATAGTGG - Intronic
1045663196 8:104459455-104459477 CCACAATGCCTGGCACTTAGTGG + Intronic
1045710696 8:104980335-104980357 GAACAGTTCTTGGCTCATAGTGG - Intronic
1045906855 8:107355944-107355966 TTTCACTGCCTGGCACATAGTGG + Intronic
1046089138 8:109478280-109478302 CCAAAATGCCTGGCACATAGTGG - Intronic
1046336070 8:112788664-112788686 TCACAATGCCTGGCACATAGAGG + Intronic
1047981988 8:130192794-130192816 GAACACTGCCTAGCACAGAGAGG + Intronic
1048468210 8:134684990-134685012 CAAGACTTCATGGCACAAAGTGG + Intronic
1048837905 8:138538557-138538579 CAACACTGCGTGGCATTTATAGG + Intergenic
1048861514 8:138727540-138727562 CAACACTGCATGGCCACTAGAGG + Intronic
1049733068 8:144189009-144189031 TAACACCGCTTTGCAGATAGTGG - Intronic
1050162977 9:2737133-2737155 AAAGAATGCTTGGCACGTAGTGG - Intronic
1051903980 9:22074148-22074170 CCACTGTGCTTGGCACCTAGAGG + Intergenic
1052932219 9:34065223-34065245 GAACACAGCTAGGCACATAGTGG - Intergenic
1053384820 9:37678697-37678719 GAACAGTGCCAGGCACATAGAGG + Intronic
1053546085 9:39024528-39024550 CAAGACTGTTTAGCACAGAGAGG - Intergenic
1053810402 9:41846182-41846204 CAAGACTGTTTAGCACAGAGAGG - Intergenic
1054620191 9:67341257-67341279 CAAGACTGTTTAGCACAGAGAGG + Intergenic
1055100456 9:72459517-72459539 CAACAGTGCTTTATACATAGGGG - Intergenic
1055415949 9:76083249-76083271 AACCAGTGCTTGGCATATAGTGG - Intronic
1055978848 9:81980865-81980887 CACAGCTGCTGGGCACATAGAGG - Intergenic
1057424629 9:94938265-94938287 CCACAGTGCTTGGCACTGAGAGG + Intronic
1057867381 9:98692307-98692329 CACCACAGCTTGCCACACAGGGG - Intronic
1057954355 9:99395987-99396009 TAACACAGGTTGGCACAGAGGGG + Intergenic
1057974129 9:99586028-99586050 CAACCATGCTTGGCACATACTGG + Intergenic
1057999656 9:99851914-99851936 GTACAATGCTTGGTACATAGTGG - Intronic
1058008955 9:99953278-99953300 GCACAATGCTTGGCACATAATGG + Intronic
1058349220 9:104000955-104000977 CAAGACTGCTTTGTACAAAGTGG + Intergenic
1058372341 9:104284434-104284456 AAACACTGCCTGGCACATAGTGG + Intergenic
1058854093 9:109043002-109043024 TAACAGTGGTTGGCACGTAGTGG - Intronic
1059315049 9:113417164-113417186 CAACAATGCATGGCAAGTAGTGG + Intronic
1059669698 9:116480307-116480329 GACCACAGCCTGGCACATAGTGG + Intronic
1060139708 9:121199943-121199965 TAACAGTGCCAGGCACATAGTGG - Intronic
1061017849 9:127992889-127992911 CAACAGTGCCTGGCACGGAGTGG - Intergenic
1185870604 X:3662045-3662067 GAACATTACTTGGCACATAAGGG - Intronic
1185936035 X:4257888-4257910 CCCCACTGCTTGCCACATTGTGG + Intergenic
1186876241 X:13820804-13820826 GAACACTTCTGGGCACATAGCGG + Intronic
1187247180 X:17563283-17563305 CCTCAATGCCTGGCACATAGGGG + Intronic
1187956678 X:24525322-24525344 CAACACTTCCTGGCTCCTAGAGG - Intronic
1188308003 X:28582477-28582499 GAACCATGCCTGGCACATAGTGG + Intergenic
1188553556 X:31386632-31386654 ACACAGTGCTTGGCACATAATGG + Intronic
1188602954 X:31991893-31991915 GAACAGTGCTTGGAACATAATGG - Intronic
1188759820 X:34013647-34013669 CAACACTGATTCTCCCATAGTGG - Intergenic
1189131708 X:38505624-38505646 GCACAGTGCTTGCCACATAGTGG + Intronic
1189301797 X:39957687-39957709 AAACAGTACTTGGCACATGGAGG - Intergenic
1189586739 X:42469544-42469566 CAATAGTGCTTGACACATAATGG - Intergenic
1191056474 X:56246412-56246434 CAACAGTACCTGGCACAAAGAGG - Intronic
1191841828 X:65518752-65518774 GCACAGTGCCTGGCACATAGTGG + Intronic
1192276796 X:69640355-69640377 GTACACTTCCTGGCACATAGTGG + Intronic
1193397433 X:81002474-81002496 CAAGACTGCTGTGTACATAGTGG - Intergenic
1194976193 X:100398687-100398709 CCACACAGCTGAGCACATAGTGG + Intronic
1194994995 X:100582011-100582033 TAACAATGCCTGCCACATAGGGG + Intergenic
1196259828 X:113565546-113565568 TGACAGTGCTTAGCACATAGAGG + Intergenic
1197474256 X:126901110-126901132 CACCACTAGCTGGCACATAGAGG + Intergenic
1197694490 X:129536507-129536529 AAACAGTGCATTGCACATAGTGG - Intergenic
1197961909 X:132016293-132016315 AAACTCTGCTTAGCACATAAAGG - Intergenic
1198425491 X:136515729-136515751 GAACAGTGCCTGGCACATAGTGG + Intergenic
1199023180 X:142906546-142906568 GAACACAGCTTGGGACAGAGAGG + Intergenic
1199678994 X:150212588-150212610 AAACAGTGCTTGGCACATGGCGG + Intergenic
1199804823 X:151288125-151288147 CATCTCTGCTTTGCACATATTGG + Intergenic
1200793432 Y:7319085-7319107 GGACATTGCTTGGCACATAAGGG + Intergenic
1201687107 Y:16717416-16717438 CAAGACTGCTTGGCAGATATTGG + Intergenic
1202194132 Y:22278690-22278712 CCACACATCTGGGCACATAGTGG - Intergenic