ID: 1013244431 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:108273401-108273423 |
Sequence | CTTCAAAACCTGGTTGAGCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1013244428_1013244431 | 11 | Left | 1013244428 | 6:108273367-108273389 | CCAGTTCCTTGTAAACTTGAGCA | No data | ||
Right | 1013244431 | 6:108273401-108273423 | CTTCAAAACCTGGTTGAGCATGG | No data | ||||
1013244429_1013244431 | 5 | Left | 1013244429 | 6:108273373-108273395 | CCTTGTAAACTTGAGCAGTGCGT | No data | ||
Right | 1013244431 | 6:108273401-108273423 | CTTCAAAACCTGGTTGAGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1013244431 | Original CRISPR | CTTCAAAACCTGGTTGAGCA TGG | Intergenic | ||
No off target data available for this crispr |