ID: 1013244431

View in Genome Browser
Species Human (GRCh38)
Location 6:108273401-108273423
Sequence CTTCAAAACCTGGTTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013244428_1013244431 11 Left 1013244428 6:108273367-108273389 CCAGTTCCTTGTAAACTTGAGCA No data
Right 1013244431 6:108273401-108273423 CTTCAAAACCTGGTTGAGCATGG No data
1013244429_1013244431 5 Left 1013244429 6:108273373-108273395 CCTTGTAAACTTGAGCAGTGCGT No data
Right 1013244431 6:108273401-108273423 CTTCAAAACCTGGTTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013244431 Original CRISPR CTTCAAAACCTGGTTGAGCA TGG Intergenic
No off target data available for this crispr