ID: 1013246796

View in Genome Browser
Species Human (GRCh38)
Location 6:108294799-108294821
Sequence CAGTCTGGGCAGTGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 2, 1: 2, 2: 7, 3: 77, 4: 663}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013246796_1013246811 24 Left 1013246796 6:108294799-108294821 CCTCCCTCCCACTGCCCAGACTG 0: 2
1: 2
2: 7
3: 77
4: 663
Right 1013246811 6:108294846-108294868 GCCCCACCCCACTGCATGCTGGG 0: 1
1: 0
2: 3
3: 34
4: 617
1013246796_1013246810 23 Left 1013246796 6:108294799-108294821 CCTCCCTCCCACTGCCCAGACTG 0: 2
1: 2
2: 7
3: 77
4: 663
Right 1013246810 6:108294845-108294867 CGCCCCACCCCACTGCATGCTGG 0: 1
1: 0
2: 3
3: 32
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013246796 Original CRISPR CAGTCTGGGCAGTGGGAGGG AGG (reversed) Intergenic
900368256 1:2320246-2320268 GCGCCTGGACAGTGGGAGGGTGG + Intergenic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
901053222 1:6436118-6436140 TGGTCTGTGCGGTGGGAGGGAGG + Intronic
901125358 1:6925098-6925120 CACACTGGGCAGTGGGCAGGGGG + Intronic
901239643 1:7685554-7685576 CAAGCAGGGGAGTGGGAGGGAGG - Intronic
901469847 1:9448640-9448662 CAGCCCAGGGAGTGGGAGGGAGG + Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902466260 1:16620436-16620458 CAGTGAGGGGAGTGGGAGAGAGG + Intergenic
902481030 1:16711969-16711991 TGGTCTGTGCAGTGGGAGGGAGG - Intergenic
902508422 1:16952867-16952889 CAGTGAGGGGAGTGGGAGAGAGG - Intronic
902604505 1:17561361-17561383 CAGTGGGGGCACTGGGAGGTGGG + Intronic
902615339 1:17620598-17620620 CAGGCAGGGCAGTGGGAAGATGG + Intronic
902974649 1:20080151-20080173 CAGTGTGGTGGGTGGGAGGGAGG + Intronic
903455616 1:23484565-23484587 CAGCCTGGGCCGTGCAAGGGAGG - Intronic
903670411 1:25031992-25032014 TAGGATGGGCAGTGGGAGGCTGG + Intergenic
904041163 1:27586039-27586061 CTGTCTGGGCACTGGGGTGGGGG + Intronic
904068865 1:27777186-27777208 GAGTCAGGGAAGAGGGAGGGTGG + Intronic
904442746 1:30542213-30542235 GAGGCTGGGCTGTGGGTGGGGGG + Intergenic
904494642 1:30879706-30879728 TAGGCTGGGCAGTGGCTGGGAGG + Intronic
904872184 1:33625689-33625711 CATTCTGGGCGGCAGGAGGGAGG - Intronic
905037289 1:34926439-34926461 CAGACTGGGGAGGGGCAGGGTGG + Intronic
905399573 1:37691886-37691908 CAGTCTGGGCAGCGAGTGGGGGG - Intronic
905485381 1:38292420-38292442 CAGGCTGGGCAGCGGGCCGGTGG - Intergenic
906149169 1:43577698-43577720 CAGCCTGGGCCCTGGGAAGGTGG + Intronic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
906308871 1:44738785-44738807 CTGTCTGGGAGGTGGGGGGGGGG + Intergenic
907360101 1:53907237-53907259 CAGCCTGGTCAGGGTGAGGGAGG + Intronic
907441573 1:54481754-54481776 CAGGCTGGGCAGAGACAGGGTGG + Intergenic
908611763 1:65868918-65868940 CAGACGGGGTGGTGGGAGGGAGG - Intronic
909036970 1:70604408-70604430 CAGTCAGGGCACAGGGATGGTGG - Intergenic
910236126 1:85038141-85038163 CAGCCTAGGGAGTGGGTGGGAGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910827166 1:91421604-91421626 CAATCTGGGCTGGGGGTGGGGGG - Intergenic
910835903 1:91509851-91509873 CAGTCTGGGCAGTGGCCCTGAGG - Intronic
911123573 1:94319719-94319741 AACTCTGGGCAGTGGGGGAGGGG - Intergenic
911348085 1:96721471-96721493 CAGTCAGGGCAGAGAGAGTGTGG + Intergenic
912386144 1:109272205-109272227 CAGGCTGGGAAGAAGGAGGGTGG - Intronic
912751790 1:112293569-112293591 CAGTCCGGGAGGGGGGAGGGGGG + Intergenic
913539583 1:119805958-119805980 CAGCCTGGGCGATGGGAGTGGGG - Intronic
913993858 1:143638062-143638084 CAGTCCGGGAGGGGGGAGGGGGG + Intergenic
914899042 1:151702334-151702356 CACACTGGGAAGGGGGAGGGAGG - Intergenic
915127758 1:153678138-153678160 CAGTCTGGAAGGTGGCAGGGAGG + Intergenic
915313335 1:155015392-155015414 CAGTGGGGGCAGTGGGCCGGGGG + Exonic
916175791 1:162037205-162037227 CAGACAGGGGAGTGAGAGGGAGG - Intergenic
916353083 1:163874358-163874380 CACTTTGGGCAGGAGGAGGGAGG + Intergenic
916671996 1:167029855-167029877 CAGACGGGGCAGTGGCCGGGCGG - Intergenic
916864074 1:168837236-168837258 CAGACTGGGCAGCGGGGTGGAGG - Intergenic
916982182 1:170150169-170150191 TAATCTAGGCAGTTGGAGGGAGG - Intronic
917517692 1:175721845-175721867 CAGGCTGGTCAGTGGGGTGGGGG - Intronic
917864053 1:179176199-179176221 TAGTGAGGGCGGTGGGAGGGTGG + Intronic
918180438 1:182082288-182082310 CTGTCTGGGTGGTGGGTGGGAGG - Intergenic
918363961 1:183787162-183787184 CAGACCGGGCACTGGGAAGGAGG - Intronic
919453912 1:197801141-197801163 CAGAGTGGGCACTGGGAGTGGGG - Intergenic
919565582 1:199181342-199181364 CAGTCTTGTGAGTGGGAAGGTGG - Intergenic
919925234 1:202188685-202188707 CAGCCTGGGCCCAGGGAGGGAGG - Intergenic
919985919 1:202674854-202674876 CATGCTGGGCAGTGGGGGAGGGG - Intronic
920143870 1:203841755-203841777 CAGACGGGGCAGTGGCCGGGTGG + Intronic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920347725 1:205317450-205317472 CAGGCTGGGCAGAGTGGGGGTGG + Intronic
920367070 1:205453736-205453758 AAGGTTGGGCTGTGGGAGGGAGG + Intronic
920388041 1:205581676-205581698 CTGTCTTGGCTGTGGGATGGAGG + Intronic
920693317 1:208163371-208163393 CAGCCTGGGCTGGGGGAGGGAGG + Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921070459 1:211654131-211654153 GAGTCCAGGCAGTGGGAGGAGGG + Intergenic
922891052 1:229062242-229062264 CAGGATGGGCAGTGAGAGGTGGG + Intergenic
923042970 1:230332974-230332996 CAGCATGGACAGTGGGAGGCCGG + Exonic
923251167 1:232180668-232180690 CAGCCTGGCCCGTGGGAGGGTGG + Intergenic
923445773 1:234069861-234069883 CAGTCTGGGCAGTACGAGACTGG - Intronic
923456336 1:234168707-234168729 GAGGCTGGGCAGTGGCAGGGAGG + Intronic
923512224 1:234662357-234662379 CAGCCTGGGGAGTGGCAGGGAGG + Intergenic
1062899759 10:1134261-1134283 GAGTCTGTGGAGTGGGGGGGGGG - Intergenic
1063428129 10:5965519-5965541 CACTGCGGGCTGTGGGAGGGTGG - Intronic
1064717065 10:18187193-18187215 GAGTCTGGGCAGCAGGAGTGGGG + Intronic
1065047403 10:21756918-21756940 CGGTCTGGGCAGTGCGAGAAGGG + Intronic
1065190696 10:23205014-23205036 TAGCCGGGGCAGTGGGAGAGGGG + Intronic
1065633410 10:27706037-27706059 CACTCAGGGCTGGGGGAGGGAGG - Intronic
1066086798 10:31979248-31979270 CAGACGGGGCAGTGGCCGGGCGG + Intergenic
1066381840 10:34908518-34908540 CAGAGTGGGCAGTGGTAGGTGGG - Intergenic
1067582150 10:47452648-47452670 CAGGCTGGGAAGCTGGAGGGAGG - Intergenic
1067720411 10:48723714-48723736 CAGACTGTGCAGTGGTGGGGAGG - Intronic
1068041572 10:51831697-51831719 CATTCTGGCCAGTAGGATGGAGG + Intronic
1068526242 10:58133604-58133626 CAGTGTAGGCAATGGGAGTGAGG + Intergenic
1068969626 10:62947807-62947829 CAGTCCGGGAGGGGGGAGGGGGG + Intergenic
1069583542 10:69581417-69581439 GAGTGTGGGCAGTGGGTAGGGGG - Intergenic
1069605738 10:69737597-69737619 CAGGCTGGGCACAGGGTGGGCGG - Intergenic
1069785844 10:70987513-70987535 CAGAGTGGGCAGTGGGTAGGAGG - Intergenic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070324415 10:75378521-75378543 CTGCCTGGGCTGAGGGAGGGAGG - Intergenic
1070567361 10:77614039-77614061 AGGCCTGGGCAGTGGTAGGGAGG - Intronic
1070793335 10:79202738-79202760 CAGCCTGGGCAGTGGGAGCTGGG - Intronic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1071503489 10:86219435-86219457 TAGGCTGGGCAGAGTGAGGGAGG - Intronic
1071505715 10:86230233-86230255 CAGTCTGGGTTGGGGTAGGGTGG - Intronic
1071945252 10:90636613-90636635 TTGTCTGTGAAGTGGGAGGGAGG - Intergenic
1072798387 10:98374296-98374318 CAGTCTGAGCAGTGGAGGAGGGG - Intergenic
1073153664 10:101329412-101329434 CAGTCTGGGCATGGGGAAAGGGG - Intergenic
1073462283 10:103672853-103672875 CACTATGGGCTGTGTGAGGGAGG - Intronic
1073489677 10:103844662-103844684 CAGGCTGGGGAAGGGGAGGGAGG + Intronic
1073593221 10:104776125-104776147 TACACTGGGCAGGGGGAGGGAGG + Intronic
1074190176 10:111128718-111128740 CTGTCCGGGCAGGGTGAGGGGGG - Intergenic
1074270406 10:111947915-111947937 GAGTGTGGGGAGTGGGAGGAGGG + Intergenic
1074619006 10:115098290-115098312 CAGTCAGGGCAGAGGAAAGGAGG - Intronic
1074857459 10:117483850-117483872 CAGTCAGGGCAGCAGGAGCGTGG - Intergenic
1074876320 10:117616156-117616178 GAGTTTGGGGAGTGGGATGGAGG + Intergenic
1075015643 10:118908445-118908467 CAGTGGGGGCTGGGGGAGGGAGG - Intergenic
1075157377 10:119989417-119989439 CAGGCTTGGCAGTGAGCGGGTGG - Intergenic
1075615793 10:123890386-123890408 CAGCCAGGGCAGTGGGAAAGTGG - Intronic
1075724271 10:124603623-124603645 CAGGTTGGGCAAGGGGAGGGCGG + Intronic
1076394652 10:130129758-130129780 CAGGCTGCGCAGTGGGAGAAGGG - Intergenic
1076425271 10:130363115-130363137 CAGCATGGGGGGTGGGAGGGAGG + Intergenic
1076724398 10:132406810-132406832 CAGTCTGGGGAGTTGGGGTGGGG - Intronic
1077102781 11:829556-829578 CAGAGCGGGCAGTGGGAGCGGGG - Intronic
1077221393 11:1419204-1419226 GAGTCTGGGCACTGGCGGGGTGG + Intronic
1077322269 11:1947660-1947682 CCGCGTGGGGAGTGGGAGGGTGG + Intronic
1077351712 11:2096174-2096196 GAGGCTGGGCAGTGGGGGAGGGG - Intergenic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1077555820 11:3225550-3225572 CAGGCTGGGCAGGGGCAGGTGGG + Intergenic
1077839722 11:5961144-5961166 CAGACTGGGCGGTGGCCGGGCGG - Intergenic
1077843089 11:5995888-5995910 GAGTCTGGTAGGTGGGAGGGAGG - Intergenic
1078303246 11:10156140-10156162 CAGAGTGGGCACTGGGAGCGAGG - Intronic
1078523082 11:12078901-12078923 CATTTTGGGGAGTGGGATGGGGG - Intergenic
1078663200 11:13303770-13303792 AATTCTGGCCAGTGGGTGGGAGG - Intronic
1079110714 11:17603602-17603624 CAGTATGGGAAGGGAGAGGGAGG - Intronic
1079298033 11:19252116-19252138 CAGTAGGGGCAGTGGGAGGTCGG - Intergenic
1080244481 11:30164044-30164066 CAGACTGGGTAGTGGGGTGGGGG + Intergenic
1080540363 11:33258207-33258229 CAACCTTGGCAGGGGGAGGGGGG - Intronic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081862472 11:46341200-46341222 AAGGCTGGGCAGAGGGAGGGAGG - Intronic
1081863939 11:46349327-46349349 CAGGCTCCGCAGGGGGAGGGAGG + Intronic
1081997640 11:47375589-47375611 CAGGCTGGGCTGGGGGATGGGGG + Intronic
1082245018 11:49911695-49911717 CAGACAGGGCAGTGGCCGGGCGG + Intergenic
1083712646 11:64558716-64558738 CAAGGTGGGCAGTGGGAGGCAGG - Intronic
1083843492 11:65317412-65317434 CATTCTGGGCAGGGTGAGGGTGG - Intronic
1083886727 11:65576677-65576699 CGGTCAGGGCTGGGGGAGGGAGG + Intronic
1084008936 11:66337166-66337188 CAGGCTGGGGAGGGGGAGGTGGG - Intergenic
1084319961 11:68367711-68367733 CAGTCAGGGCCGGGGGACGGAGG + Intronic
1084410558 11:69003935-69003957 ATGTCTGGGCACTGGGAGGCTGG + Intergenic
1084421809 11:69064138-69064160 GTGTCTGGGCAGTGGGGTGGTGG - Intronic
1084546436 11:69817357-69817379 CAGCCTGCGCACTGGGAAGGCGG - Intronic
1084653539 11:70502498-70502520 GGGCCTGGGCAGGGGGAGGGAGG + Intronic
1084680184 11:70662399-70662421 CAGGCTGGGCTGGGAGAGGGCGG + Intronic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085040068 11:73321853-73321875 CAGTGGGGGCAGTGTGATGGAGG + Intronic
1085258172 11:75188923-75188945 CAGGCTCAGCAGTGGGTGGGAGG - Intronic
1085292432 11:75410074-75410096 CAGTCCGGGAGGGGGGAGGGGGG - Intronic
1085433406 11:76476823-76476845 CAATCTGGGCATTGTGGGGGTGG + Intronic
1086890529 11:92253124-92253146 CACCCTGGGCAATGGGAGAGAGG - Intergenic
1087183302 11:95160147-95160169 CAGTCAGGGGAGTGAGAAGGTGG - Intergenic
1087483729 11:98734467-98734489 CTGGCCAGGCAGTGGGAGGGTGG - Intergenic
1089536028 11:119161265-119161287 CAGCCTGGGCTCTGGGAGTGGGG + Exonic
1089602432 11:119624036-119624058 CTGTCTGGGCAGGGTGTGGGTGG + Intronic
1089693338 11:120200048-120200070 GAGCCAGGGCAGAGGGAGGGAGG + Intergenic
1090519000 11:127458789-127458811 GAGACTGGGCATTGGGAGGATGG + Intergenic
1090686730 11:129129428-129129450 CAGACGGGGCAGTGGCTGGGCGG - Intronic
1090951870 11:131480782-131480804 CAGTCTGGGTGGTGGGGGTGGGG + Intronic
1091006145 11:131955688-131955710 AGGTCGGGGCACTGGGAGGGTGG - Intronic
1202805287 11_KI270721v1_random:2973-2995 CCGCGTGGGGAGTGGGAGGGTGG + Intergenic
1091625713 12:2119338-2119360 CAAACTTGGCAGTGGGAGCGGGG + Intronic
1091628418 12:2140105-2140127 CCGTATGGGCAGTGAGAGAGGGG - Intronic
1091667593 12:2430560-2430582 CAGTCTGGGAGGTGGTGGGGGGG + Intronic
1091781219 12:3215698-3215720 CTGTCTGGGAAGTGTGGGGGTGG + Intronic
1093304753 12:17501280-17501302 TAGTCTGGGCAGTGAGAATGGGG - Intergenic
1093357866 12:18191086-18191108 GAGTCTGTGTAGTGGGAGGATGG - Intronic
1093436437 12:19140151-19140173 CCGTCTGGGGAGTGGGATGATGG + Intronic
1094174785 12:27530283-27530305 AACTCTGGGAAGTGAGAGGGTGG + Intronic
1094443624 12:30506556-30506578 CAGCCTGTGCACTGGGAGGATGG + Intergenic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1095688566 12:45063027-45063049 CAGGGTGGGAAGTGGGAGGGTGG - Intergenic
1096559297 12:52424336-52424358 CAGTCTGGGCACTGTCAGGAGGG + Exonic
1096693026 12:53332854-53332876 CGGGCTGGGCAGAGGGAGAGGGG - Intronic
1096756205 12:53802134-53802156 CAGTCTGGGAAGTGGGTGGGTGG + Intergenic
1096761590 12:53846082-53846104 CAGTGACTGCAGTGGGAGGGTGG - Intergenic
1097246874 12:57611765-57611787 CGGTCCAGGCTGTGGGAGGGGGG - Intronic
1098018358 12:66130258-66130280 CAGTCTGGGGAGAGGGTCGGGGG - Intronic
1098106116 12:67069822-67069844 CAGTTTGGGCTCGGGGAGGGAGG - Intergenic
1098166094 12:67699564-67699586 CAGTGGTGGCAGTGGGTGGGGGG - Intergenic
1098370072 12:69749350-69749372 CAGACAGGGCAGAGGGTGGGAGG - Intronic
1098563927 12:71909730-71909752 CAGTGTAGGCAGTGGGGGGCAGG - Intronic
1099186777 12:79523594-79523616 GAGTCTGGGAAGTGGAAGGCAGG + Intergenic
1099333924 12:81329570-81329592 CATTCTTGCCAGTGGGAGCGAGG + Intronic
1101968149 12:109294760-109294782 CAGTGTGGGCAGGGGGTTGGGGG - Intronic
1102002048 12:109563480-109563502 CAGCCTTGGCACTGTGAGGGCGG - Intronic
1102985291 12:117272861-117272883 CAGTCGGGGAAGGGGGAGAGAGG - Intronic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1103593656 12:122010012-122010034 CAGTCTGGCCGGTGGGCTGGGGG - Intergenic
1103636394 12:122310119-122310141 AAGTTTGGGTGGTGGGAGGGTGG - Intronic
1103800196 12:123533129-123533151 CCGTCCGGGCAGTGGGACCGCGG - Intronic
1103924097 12:124414181-124414203 CAGCCCGGGGAGTTGGAGGGAGG - Intronic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104757661 12:131279154-131279176 CAGTGTGGGGAGAGGGAGAGGGG + Intergenic
1104942226 12:132400534-132400556 CAGTCTGGGCAGGGCGTGGCCGG + Intergenic
1104946679 12:132417748-132417770 GAGGCTGGGCCGTGGGAGGAGGG - Intergenic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1105299430 13:19118906-19118928 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1105430688 13:20334550-20334572 CAGTGGTGGCAGTGGGAGGTGGG - Intergenic
1106029904 13:25990568-25990590 CAGCTGGGGCAGAGGGAGGGAGG + Intronic
1106418880 13:29569194-29569216 CTCTCTGGGCACTGGCAGGGAGG + Intronic
1106435776 13:29721875-29721897 CAGTCTGCGCAGTGTGGTGGGGG + Intergenic
1106546000 13:30731707-30731729 CTTTCTGGGCAATGGGAGGGGGG + Intronic
1106585246 13:31051602-31051624 CAGGCTGGGCTGTGGCAGAGAGG - Intergenic
1108453281 13:50588140-50588162 CTGTGTGGGCAGTGCGTGGGAGG + Intronic
1108640728 13:52380324-52380346 AAGAGTGGGCAGTGGGAGGACGG - Intronic
1109249130 13:59997209-59997231 CAGTCTGGGAAGAGTGAGTGGGG - Intronic
1110551563 13:76816462-76816484 CATTCAGTGCAGTGGGAGTGAGG - Intergenic
1112004925 13:95245793-95245815 CACGGTGGGCAGTGGGAGGCAGG - Intronic
1112883029 13:104133044-104133066 CATTCTGGGGAGTGGCTGGGAGG + Intergenic
1113789242 13:113018843-113018865 CCGCCTGGGCAGTGGGAGGGGGG - Intronic
1113823352 13:113231434-113231456 CTGTGTGGGGAGTGGGAGGTGGG + Intronic
1113947354 13:114051639-114051661 CAGTGTGGGCACAGGAAGGGCGG - Intronic
1114050937 14:18919470-18919492 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1114111622 14:19482452-19482474 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1114616596 14:24071824-24071846 GGGTCTGGGCTGGGGGAGGGGGG - Intronic
1117257844 14:53998707-53998729 GAAACTGGGCAGAGGGAGGGGGG - Intergenic
1118107245 14:62673861-62673883 CAGTAGGGGCAGTGGGAGTCAGG - Intergenic
1119721971 14:76898014-76898036 CAGACGGGGCAGTGGCCGGGCGG + Intergenic
1119731410 14:76953607-76953629 CTGCCTGGGCAGCGGGAGAGTGG - Intergenic
1120549656 14:85854444-85854466 TAATGTGGGTAGTGGGAGGGAGG - Intergenic
1121001833 14:90456652-90456674 CTGTCTGTGCAGTGGGGAGGTGG - Intergenic
1121051832 14:90824274-90824296 CATTCTGGGCAGGGGGAGATAGG - Intergenic
1121266235 14:92604230-92604252 CCAGCTGGGGAGTGGGAGGGGGG - Intronic
1121338233 14:93090090-93090112 GAGTCTGGGCAGGGGCTGGGGGG - Intronic
1121392651 14:93589422-93589444 CAGTATGGGCTGGGGGATGGGGG + Intronic
1121630052 14:95415290-95415312 AAGTCAGAGCAGTGGCAGGGTGG - Intronic
1121823948 14:96995129-96995151 CAGGCTGGGCAGTGGGATGGAGG + Intergenic
1121982794 14:98469270-98469292 AAGTCTGGCCACTGTGAGGGAGG + Intergenic
1122647915 14:103207331-103207353 CTGTCCGGGCAGGGGCAGGGAGG - Intergenic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1122805895 14:104256833-104256855 GAGTCTGGGCTCTGGGAGGCTGG + Intergenic
1122860531 14:104580454-104580476 CAGCCTGGGCAGTGGGAGAAGGG + Intronic
1122889127 14:104724506-104724528 CCGTCTGGGTCGGGGGAGGGGGG - Intronic
1124354493 15:28984810-28984832 CAGAGATGGCAGTGGGAGGGGGG - Intronic
1124981739 15:34574112-34574134 CACACCGGGCAGTGGGAGTGGGG - Intronic
1126213873 15:46132159-46132181 CAGTCTGTGCAGTGGTAGAGCGG + Intergenic
1127285228 15:57526868-57526890 CACGCTGGGCATTGGGAAGGGGG + Intronic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128108055 15:65058802-65058824 CTGGCTGGGTGGTGGGAGGGAGG - Intronic
1128475988 15:67997226-67997248 CAGGCTGGGCAATGGGCTGGAGG - Intergenic
1128551278 15:68599602-68599624 CTGTCTGGGCAGCGTGGGGGTGG - Intronic
1128552724 15:68608733-68608755 GAGTCTGGGCAGGGGAGGGGTGG - Intronic
1129052979 15:72797553-72797575 CAGGCTTGGCACTGGGAGGGCGG + Intergenic
1129121400 15:73399042-73399064 CAGTCTGGAGTGTGGGAGGAGGG + Intergenic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129234709 15:74217211-74217233 CAGGCTGGGCTGTGGGTGAGAGG + Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1130067276 15:80615196-80615218 TAGTGTGGGCAGTGGGTGGAGGG + Intergenic
1130924519 15:88375144-88375166 GAGGCTCTGCAGTGGGAGGGAGG - Intergenic
1131189416 15:90301645-90301667 CATTCTTGGCAGGGGGTGGGAGG + Intronic
1131536179 15:93239874-93239896 CAGTCCAGGCAGGGGGAGGCAGG - Intergenic
1131885545 15:96907998-96908020 CAGGATGGGCGGGGGGAGGGGGG + Intergenic
1132022035 15:98371120-98371142 CAGAATGGGCAGTGGGAATGAGG - Intergenic
1132549345 16:547967-547989 CAGTCGGGGCAGTGGGTGGGGGG - Exonic
1132583820 16:697226-697248 CAGGCTGGGTGGTGGGAGGGTGG + Exonic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG + Intergenic
1133230472 16:4364314-4364336 CAGGCTGGGCTGTGTCAGGGAGG + Exonic
1133297687 16:4762879-4762901 ACGGCTGGGCAGAGGGAGGGAGG - Intronic
1133309546 16:4835202-4835224 GAGGCTGGGTAGTGGGAGGCAGG - Intronic
1133768121 16:8851834-8851856 CTGTTGGGGCAGTGGGAGTGAGG - Intergenic
1134016369 16:10891263-10891285 GAGTCTTGGCAGGGGGAGTGGGG + Intronic
1134118432 16:11566741-11566763 CAGCCTGGGCAGGGGTAGGGGGG + Intronic
1134222580 16:12366582-12366604 CAGGCTGGTGAGTGGGTGGGAGG - Intronic
1135992066 16:27224334-27224356 CACCCTGAGCAGTGGGTGGGGGG + Intergenic
1136005584 16:27326814-27326836 CAGCCCAGCCAGTGGGAGGGAGG - Intronic
1136514874 16:30762082-30762104 CAGGCTGGGAAGTGGGAGCGCGG + Exonic
1137394099 16:48104912-48104934 GAGTCTGGGCTATGGGATGGAGG - Intronic
1137603931 16:49774724-49774746 CAGTCTGGGCAAGGGGAGGAGGG + Intronic
1138436698 16:57004806-57004828 CAGCGAGGGCAGTTGGAGGGAGG + Intronic
1139337367 16:66242167-66242189 CAGTATGAGGTGTGGGAGGGTGG + Intergenic
1139576658 16:67846606-67846628 CAGTCTGTGCACTGGGGTGGGGG - Intronic
1139672119 16:68499087-68499109 CAGTAGGGGAAGAGGGAGGGAGG - Intergenic
1139864281 16:70051313-70051335 CAGTCCGGGAGGGGGGAGGGGGG + Intergenic
1140136596 16:72211267-72211289 GAGTCTGGGAGGTGGGAGGAAGG - Intergenic
1140212684 16:72983301-72983323 TAATCTGGGCAGAGGAAGGGTGG + Intronic
1140274516 16:73496795-73496817 GAGTCTGGGGGGTGGGAGTGAGG + Intergenic
1140418559 16:74796406-74796428 CAGTCTGGCCAGTGGAATGTTGG - Intergenic
1140651686 16:77095105-77095127 CAGTCCTGGCAGTGTGAGGAAGG - Intergenic
1140851872 16:78942509-78942531 CTCTCTGGGCAGTGGGATGGGGG + Intronic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1141920552 16:87132845-87132867 CAATCAGGGCATTGGGAAGGCGG - Intronic
1142153698 16:88523727-88523749 CAGTGGGGGCCGTGGCAGGGTGG + Intronic
1142323768 16:89401096-89401118 CCCTCTGGGGAGGGGGAGGGCGG - Intronic
1142397284 16:89839437-89839459 GAGTGTTGGCAGTGGGTGGGGGG + Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142805550 17:2369484-2369506 CAGGCTGGACGGGGGGAGGGGGG - Intronic
1142903845 17:3029483-3029505 GAGTCTGGGGAGAGGCAGGGTGG + Intronic
1143114927 17:4576925-4576947 CAGAGTGGGCAGTGGGGGTGGGG - Intergenic
1143158510 17:4853674-4853696 AAGTCTGGGCAGTTGGGTGGTGG + Intronic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143554710 17:7652759-7652781 CACCCTGGGCAGAGGCAGGGAGG - Intronic
1144734757 17:17548877-17548899 CTGTCTGGGCAGTGTGTGGAGGG + Intronic
1145087151 17:19951289-19951311 CAGACGGGGCAGTGGCCGGGCGG - Intronic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147544865 17:41393529-41393551 CAGGCAGGCCAGTGGGAAGGAGG - Intronic
1147965527 17:44192491-44192513 CAGTCTGGGGAGTGGGCTGAAGG - Exonic
1148135133 17:45287125-45287147 GGGTCTGGGCAGTGGGTGGAGGG + Intronic
1148615113 17:48996047-48996069 CCGTCTGGGCGGTGGGGGAGGGG - Intergenic
1148759312 17:49991306-49991328 GTGTCTAGGCAGAGGGAGGGAGG + Exonic
1148809011 17:50278715-50278737 CAGTGTGGGCGGCGGGAGCGGGG + Intronic
1149500814 17:57150951-57150973 CAGGCTGGGCAGTGGGAGTTGGG - Intergenic
1149553416 17:57556509-57556531 CAGTCTTTGGGGTGGGAGGGAGG + Intronic
1149567172 17:57648634-57648656 CACTCTGGGCAGTGGGGTGCTGG + Intronic
1149635777 17:58168135-58168157 GAGACAGGGCAGGGGGAGGGGGG + Intergenic
1150124481 17:62627620-62627642 CAGCCCGGGCGGAGGGAGGGCGG - Exonic
1150130641 17:62666990-62667012 CAGTCTGGGGAGGGGGGTGGAGG - Intronic
1150431342 17:65120224-65120246 CAGGGTGGTCAGTGGGATGGAGG + Intergenic
1150495802 17:65607065-65607087 GAGTCTGGGTTGTGGGATGGTGG + Intronic
1151553585 17:74835655-74835677 CAGTGGGGCCAGTGGCAGGGTGG - Intronic
1151820234 17:76493082-76493104 CAGTCAGGACAGAAGGAGGGCGG + Intronic
1151829371 17:76540583-76540605 GAGTCTGGGCTGGGGGAGGGAGG + Intronic
1151995751 17:77607917-77607939 AAGTCCAGGCAGTTGGAGGGCGG + Intergenic
1152097064 17:78278499-78278521 GGGTGGGGGCAGTGGGAGGGAGG + Intergenic
1152123250 17:78431697-78431719 GAGTCTGTGGAGGGGGAGGGAGG + Intronic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152301193 17:79495922-79495944 CAGCCTGAGCAGTGGCAGCGTGG + Intronic
1152492851 17:80649420-80649442 GAGTTTGGGCAGGAGGAGGGAGG - Intronic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1152498240 17:80690212-80690234 CAGCCAGGGGAGTGGGAAGGGGG - Intronic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152588089 17:81197968-81197990 GAGGCTGGGCTCTGGGAGGGAGG + Intronic
1152607775 17:81301681-81301703 CCGTCTGGGAAGAGGGATGGAGG + Intergenic
1152727081 17:81952775-81952797 CTGGCTGGGCTGTGGGAGAGGGG + Exonic
1154162960 18:11993660-11993682 CAGCCAGGGCAGTGGGCGGACGG + Intronic
1154411322 18:14143624-14143646 CACTGTGGGCAGCGGGAGCGGGG + Intergenic
1154485034 18:14866456-14866478 CAGCCTGAGCTGTAGGAGGGTGG + Intergenic
1155045137 18:22096648-22096670 CATTCTGGGCACTGGGGGGCAGG + Intronic
1155089112 18:22488977-22488999 AAGACTGGGAAGTGGGAGGAGGG + Intergenic
1157269851 18:46264686-46264708 CAGGCTGGGCAGGTGGAGGCAGG - Exonic
1157522878 18:48357279-48357301 GAGGCTGGGAAGGGGGAGGGAGG + Intronic
1158602134 18:58864145-58864167 CTGTCTGGGGAGGGGGCGGGGGG - Intronic
1158882238 18:61791608-61791630 GGGTCTGGGAAGAGGGAGGGAGG - Intergenic
1159387186 18:67741880-67741902 CTGTCTTGGCTGGGGGAGGGAGG - Intergenic
1160584205 18:79903803-79903825 CAGGGTGGGCAGTGGGGGTGGGG - Exonic
1160906461 19:1453793-1453815 CGGGCTGGGGAGGGGGAGGGAGG - Intronic
1160948519 19:1654607-1654629 CCATCTGGACAGTGGAAGGGGGG + Intergenic
1160992965 19:1868194-1868216 CACACTGGGCAGGGGGTGGGGGG - Intergenic
1161349461 19:3784057-3784079 CAGACTGGGCTGTGGAGGGGGGG + Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161614260 19:5261170-5261192 CCCTCTGGGCTGAGGGAGGGAGG + Intronic
1161749791 19:6087282-6087304 AATACAGGGCAGTGGGAGGGAGG - Intronic
1162141804 19:8589696-8589718 CAGCTTGGGCAGAGGGAGTGGGG + Intronic
1162247157 19:9410906-9410928 CGGGCTGGGGAGAGGGAGGGAGG + Intergenic
1162532007 19:11241576-11241598 CAGGCAGGGCAGTTGGATGGGGG + Intronic
1162583839 19:11546983-11547005 CAGGCTGGGCAGGGGGTGGTGGG + Intronic
1162740493 19:12771053-12771075 CAGGCTGGAGAGTGGCAGGGAGG - Exonic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1163646785 19:18494071-18494093 CACTCTGGGCAGTGGAGAGGAGG - Intronic
1163758102 19:19118944-19118966 CAGTTTGAGGAATGGGAGGGCGG - Intergenic
1163830999 19:19547140-19547162 CTGTCTGGACAGTGGGGGTGTGG - Intergenic
1164574680 19:29398829-29398851 CTGTCTGGGCAGTGGGATTGGGG - Intergenic
1165072257 19:33262132-33262154 CAGTATGGGCAGGGCCAGGGAGG + Intergenic
1165135899 19:33668433-33668455 CTGTCTGGGCTTTGTGAGGGGGG + Intronic
1165258106 19:34592188-34592210 CATTTTGGGCAGTGGGAGTGAGG + Intergenic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165407510 19:35639786-35639808 GAGACTGTGCAGTGGGAAGGGGG + Intergenic
1165894256 19:39131901-39131923 CTCTCAGGGCTGTGGGAGGGCGG + Intronic
1165898713 19:39158445-39158467 GAGGCTGGGCAGGGGGAAGGGGG - Intronic
1165903506 19:39179571-39179593 CATTCTGGGGAGTGGCAGGCTGG - Intronic
1166047693 19:40238991-40239013 CAGGGTGGGAGGTGGGAGGGAGG + Intronic
1166091171 19:40510044-40510066 CAGTGTGGGGAGTGCGAGTGTGG + Intronic
1166334298 19:42096043-42096065 CAGGCTGGGCGGTGGGCGTGGGG - Intronic
1166668706 19:44697324-44697346 CTGTTTGTGCAGTGGGTGGGGGG - Intergenic
1166898526 19:46040119-46040141 CAGTCCAGGCTGTGGGAGGGGGG - Intronic
1167253005 19:48410848-48410870 TAGGCTGGGTAGCGGGAGGGAGG + Intronic
1167263591 19:48472474-48472496 GGGTCTGGGGGGTGGGAGGGAGG - Intronic
1167455890 19:49596633-49596655 TAGACTGGGCCGTGGGAGGTGGG - Exonic
1167613269 19:50517472-50517494 TGGGCTGGGCTGTGGGAGGGAGG + Exonic
1167959488 19:53094924-53094946 CAGCCTGGGCTGTGGGAAGCGGG - Intronic
1167959553 19:53095111-53095133 CGGTCTGGGCAATGGGAAAGGGG - Intronic
1168213482 19:54908589-54908611 CAGACGGGGCAGTGGCCGGGCGG + Intronic
1202715067 1_KI270714v1_random:37873-37895 TGGTCTGTGCGGTGGGAGGGAGG - Intergenic
925737240 2:6974119-6974141 CAGCCTGTAAAGTGGGAGGGTGG + Intronic
926310332 2:11670152-11670174 GACTCCGGGCAGTGAGAGGGAGG - Exonic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
926714509 2:15913573-15913595 GAGGCTAGGCAGAGGGAGGGAGG + Intergenic
926717405 2:15935840-15935862 CAGCCTGGGGAGTGGGAGCAGGG - Intergenic
926971648 2:18472886-18472908 GAGGCTGGGTAGTGGGTGGGAGG - Intergenic
927707395 2:25304900-25304922 CAGTCTAGGCAGGGGATGGGAGG - Intronic
927875849 2:26654720-26654742 CAGTCTGGGGTGGGGGATGGGGG + Intergenic
927877135 2:26665471-26665493 CAGACGGGGCAGTGGCCGGGCGG + Intergenic
928318647 2:30266117-30266139 GAGTCATGGCAGTGGGAGAGAGG + Intronic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
928558020 2:32447659-32447681 CAGTCCGGGAGGGGGGAGGGGGG - Intronic
929779773 2:44949956-44949978 CCGTCTGGCCCGAGGGAGGGCGG + Intergenic
930103151 2:47618312-47618334 CAGTGTGGGGAGTCGGAGAGAGG - Intergenic
931681027 2:64750347-64750369 GCGTCTGGGCTGTGGGCGGGGGG + Intronic
931906733 2:66850662-66850684 CAGGCTGGGGGATGGGAGGGAGG + Intergenic
932322031 2:70829398-70829420 CAGCCAGGGCTGTGGGAGGCAGG + Intergenic
932356062 2:71069084-71069106 CAGGGTGGGGAGTGGGAGTGGGG + Intronic
932418691 2:71588721-71588743 CAGTTTGGGTAGTGGGCAGGAGG + Intronic
932487325 2:72092065-72092087 CAGTGTGGAAACTGGGAGGGAGG - Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
934708685 2:96501812-96501834 CTTTCTGGGCTGGGGGAGGGAGG + Intronic
934735629 2:96688453-96688475 CAACCTGGGGAGTGGGCGGGCGG + Intergenic
936713808 2:115162089-115162111 CAGCCTGGGAAGCGGGAGGCGGG - Intronic
937258097 2:120568882-120568904 GAGAAGGGGCAGTGGGAGGGAGG - Intergenic
937932485 2:127218106-127218128 CTGTCTGAGCAGTGGGCAGGAGG + Intronic
938287018 2:130127576-130127598 AAGTCTGGGGACTGGGAAGGGGG - Intronic
938428575 2:131211294-131211316 AAGTCTGGGGACTGGGAAGGGGG + Intronic
938533890 2:132221352-132221374 CAGTCCGGGAGGGGGGAGGGGGG + Intronic
938838272 2:135130963-135130985 CTGTCTGGGCAGTGGGAATCAGG + Intronic
941111997 2:161426413-161426435 AAGACTGGGCAGGGGTAGGGTGG + Intronic
943439106 2:187903889-187903911 CACTCGGGCCTGTGGGAGGGTGG + Intergenic
943484784 2:188465539-188465561 CAGTGTGGGCTGAGGGAGAGAGG - Intronic
944571771 2:201052266-201052288 CAGCCTGGGCAACAGGAGGGGGG + Intronic
944592740 2:201233354-201233376 CACTCTCCGCAGTGGGCGGGAGG + Intergenic
944661902 2:201928566-201928588 CAGGCTGGGCCAGGGGAGGGAGG - Intergenic
945182930 2:207110522-207110544 CAGGCTGGTACGTGGGAGGGAGG - Intronic
946246965 2:218393313-218393335 CCATCTGGGGGGTGGGAGGGGGG - Intronic
946411605 2:219517893-219517915 CAGAGTGGGGAGTGGGAAGGAGG - Intronic
946525436 2:220514219-220514241 GAATCTGGGCTTTGGGAGGGTGG + Intergenic
946530446 2:220564483-220564505 CAGCCTAGGCAGTGTCAGGGTGG - Intergenic
946751371 2:222896930-222896952 CAGTCCGGGAGGGGGGAGGGGGG - Intronic
946921620 2:224585791-224585813 CATGGTGGGGAGTGGGAGGGGGG + Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947709606 2:232304613-232304635 CAGTCCTGGCAGTGAGAAGGAGG - Intronic
948350459 2:237335954-237335976 CAGGATGGGGAGTGGGAGGCTGG + Intronic
948398377 2:237664009-237664031 CCCTCAGGGCACTGGGAGGGAGG + Intronic
948399742 2:237674966-237674988 GAGCCTGGGCAGTGGGAGGAGGG + Intronic
948594928 2:239073790-239073812 CAGTCTAGTCAGTGGCAGGATGG + Intronic
948612051 2:239176187-239176209 AAGGCCGGGCAGAGGGAGGGAGG - Intronic
948612080 2:239176271-239176293 GAGGCCGGGCAGAGGGAGGGAGG - Intronic
948612088 2:239176290-239176312 AAGGCCGGGCAGAGGGAGGGAGG - Intronic
948660093 2:239501703-239501725 CAGTGTGGGGAGTGGGAGATTGG + Intergenic
948745420 2:240089389-240089411 CCGTCTGGGGAGTGGGGGTGGGG - Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1168742196 20:201248-201270 CCGACAGGGCAGTGGGAGTGGGG + Intergenic
1169112262 20:3041853-3041875 GGGTGTGGGCAGTGGGAGGCAGG - Intergenic
1169198653 20:3697044-3697066 CAGCCTGGGGACTTGGAGGGTGG - Intronic
1169415428 20:5412082-5412104 CTGTCTGGGAAGTGGGAGTGGGG - Intergenic
1169912014 20:10654751-10654773 GTGTCTGGGCAGGGAGAGGGAGG + Intronic
1170315021 20:15032121-15032143 CAGAGTGGGCACTGGGAGTGAGG + Intronic
1171127290 20:22613624-22613646 AAGATTGGGCAGTGGGTGGGTGG - Intergenic
1171180770 20:23088908-23088930 AAGCCCAGGCAGTGGGAGGGAGG + Intergenic
1171235868 20:23524151-23524173 GAGTCTGGGGAGTGAGAGGGTGG + Intergenic
1172029980 20:31975039-31975061 AGCTCTGGGGAGTGGGAGGGCGG + Intronic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1172384144 20:34521694-34521716 CACTCTGGGCAATGGGATGATGG - Intronic
1173194071 20:40899609-40899631 GAGTCAGGGGGGTGGGAGGGAGG - Intergenic
1173196131 20:40914094-40914116 AACTCTGGGCACTGGGAGAGTGG - Intergenic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174062984 20:47845597-47845619 CGGTCTGCACAGTGGGAGGTTGG + Intergenic
1174173071 20:48628944-48628966 CTGTCTGGGGAGTGGGGGTGAGG + Intronic
1174311472 20:49658727-49658749 CAGTCTGGGTAGTGGGACCTAGG - Intronic
1174484534 20:50852874-50852896 CAGGCTGGGCAGGGAGAGGTGGG - Intronic
1175681816 20:60994794-60994816 GTATCTGGGCAGTGGGATGGGGG - Intergenic
1175876999 20:62235090-62235112 CAGCCTGGGCAGTCAGAGAGGGG - Intronic
1176139394 20:63538353-63538375 CAGTAGGGTCAGTGGGAGGGTGG - Intergenic
1176289869 21:5038099-5038121 CAGCATGGGGAGTGGGAGGGGGG - Intronic
1176796294 21:13373019-13373041 CAGCCTGAGCTGTAGGAGGGTGG - Intergenic
1178272022 21:31199480-31199502 AGGCCTGGGCAGGGGGAGGGTGG - Intronic
1178926653 21:36780931-36780953 CAGCCTGGGGGGTGGGGGGGTGG - Intronic
1179317188 21:40254287-40254309 CACTCCAGGCAGGGGGAGGGTGG + Intronic
1179376396 21:40853306-40853328 CAGTGATGGCAGTGGGAGGGTGG - Intergenic
1179546886 21:42118606-42118628 CAGTCTGGGGAGAGGTAGGGAGG + Intronic
1179867382 21:44225540-44225562 CAGCATGGGGAGTGGGAGGGGGG + Intronic
1179875206 21:44263452-44263474 GAGGCTGGGCTGTGGGTGGGGGG - Intergenic
1179898407 21:44376335-44376357 CATTTTAGCCAGTGGGAGGGCGG + Intronic
1179951321 21:44710336-44710358 CGGGCTGTGCAGTGGGAGGTAGG - Intronic
1180069135 21:45427450-45427472 CAGTCTGGTCAGTGCCAGGCGGG - Intronic
1180102376 21:45594901-45594923 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180102408 21:45594998-45595020 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180102421 21:45595031-45595053 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180144017 21:45909765-45909787 GTATCTGGGCAGTGGGTGGGGGG - Intronic
1180144031 21:45909795-45909817 GTATCTGGGCAGTGGGTGGGGGG - Intronic
1180144140 21:45910101-45910123 GTATCTGGGCAGTGGGTGGGGGG - Intronic
1180144172 21:45910184-45910206 GTATCTGGGCAGTGGGTGGGGGG - Intronic
1180304931 22:11066525-11066547 CAGCCTGAGCGGTAGGAGGGTGG + Intergenic
1180469414 22:15641845-15641867 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1181108459 22:20588124-20588146 CACTCTGGTCAGTGGGAGAAGGG - Intergenic
1181590029 22:23878343-23878365 CAGTGTGGGGCGGGGGAGGGGGG + Intronic
1181806033 22:25374986-25375008 CACTTGGGGCAGTGTGAGGGAGG - Intronic
1181809451 22:25394582-25394604 CAGTCTGGGCCATGGGAGGTTGG + Intronic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1182231261 22:28839129-28839151 GACCCTGGGCAGTGGGTGGGAGG + Intergenic
1182451951 22:30427010-30427032 CAGTTCGGGGAGTGGGAGTGTGG - Intronic
1183019791 22:35018104-35018126 GAGGCTGGGCACTGGGAGTGGGG - Intergenic
1183292695 22:37012506-37012528 CAGGTTGGGCACTGGGAGTGGGG - Intronic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183506575 22:38212590-38212612 CTGTCAGGCCTGTGGGAGGGAGG + Intronic
1183539775 22:38423307-38423329 CAGTGTGGGCACTGGGGGAGGGG - Intergenic
1183932783 22:41245808-41245830 CAGTCTGGGGAGGGAGAGGCAGG - Exonic
1184289130 22:43489009-43489031 CAGTGTGGGCAGTGAGGGGTGGG + Intronic
1184536992 22:45094195-45094217 TAGCCTGAGCAGCGGGAGGGTGG - Intergenic
1185398244 22:50603467-50603489 CAGTGTGGTCAGACGGAGGGTGG - Exonic
949419225 3:3847840-3847862 CCTAATGGGCAGTGGGAGGGTGG + Intronic
950645575 3:14374659-14374681 CACCCAGGGGAGTGGGAGGGAGG + Intergenic
950851851 3:16069747-16069769 CTCTAGGGGCAGTGGGAGGGTGG + Intergenic
951711265 3:25586576-25586598 CAGTAAGGGCAGTGGGTGGCAGG - Intronic
952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG + Intergenic
952399761 3:32952585-32952607 CAGTTTGGGCATTGGGTGTGTGG + Intronic
952564160 3:34635060-34635082 CAGGCTGTGCAGTGGGGGTGTGG + Intergenic
953759999 3:45679013-45679035 CAGTGTGGGGCGTGGCAGGGGGG + Exonic
953873248 3:46646116-46646138 CAATCTGGGGGGAGGGAGGGAGG - Intergenic
954109339 3:48425427-48425449 CAGGCTGGGCGGTGGGGAGGGGG - Intronic
954406164 3:50346109-50346131 CAGTCTGGACATAGGGAGGATGG - Exonic
954671707 3:52294489-52294511 CAGGCTGGAGATTGGGAGGGAGG + Intergenic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
955031937 3:55230538-55230560 CAGTCTAGGAAGTGGGAGAAGGG - Intergenic
955056423 3:55459657-55459679 CAGTCTGGGCAGGGGTAGCAGGG - Intergenic
955673620 3:61427807-61427829 AAGTGTGGGCGGTGGGAGAGTGG + Intergenic
955907843 3:63826358-63826380 TAGTCAGGGCAGTGGGAATGGGG + Intronic
955936033 3:64103503-64103525 AGGTCAGGGCAGTGGGAGGAGGG + Intronic
956114491 3:65904590-65904612 CATTCTGGGCTGAGGGATGGTGG - Intronic
956432408 3:69200470-69200492 CCGTCTGGGAGGGGGGAGGGCGG - Intronic
956479935 3:69663150-69663172 GAGGTCGGGCAGTGGGAGGGAGG - Intergenic
956847338 3:73195671-73195693 CAGGGTGGGGAGTGGGAGGAAGG - Intergenic
957959287 3:87227955-87227977 CAGTCTCGGAATGGGGAGGGAGG + Intronic
959774127 3:110135799-110135821 CAGTCAGGGAAGTGGGGGTGGGG + Intergenic
961333004 3:126154009-126154031 CAGTCTGGGCAGTCGGCTGGGGG + Intronic
961474380 3:127137567-127137589 CAGTGTGGACAGTGGGGGTGGGG - Intergenic
961503317 3:127352779-127352801 CTGTCTTGGCAGTGAGAGGCAGG - Intergenic
961664881 3:128488849-128488871 CAGTCTGTACAATGGGAGGGAGG - Intronic
962391290 3:134974944-134974966 GAGGATGGGCAGTGGCAGGGAGG - Intronic
964006801 3:151839578-151839600 CAGCCTGGGCTGAGAGAGGGAGG + Intergenic
966334623 3:178854408-178854430 CGGTCTGGGGAGTGGGGGTGTGG - Intergenic
966583992 3:181601335-181601357 GATTCTGGGCAGTGGCAGGGAGG + Intergenic
966783945 3:183608327-183608349 CAGTCCGGGAGGGGGGAGGGGGG + Intergenic
966817085 3:183898085-183898107 CAGTCTGGGGAAGTGGAGGGCGG - Intergenic
966905750 3:184525147-184525169 CAGTCAGGGACGGGGGAGGGGGG - Intronic
967891446 3:194367038-194367060 CATGCTGGGCAGGGGGAAGGTGG - Intronic
967891938 3:194369802-194369824 CAGTGTTGGCCCTGGGAGGGGGG + Intergenic
968065611 3:195757422-195757444 TTGTCTGGGGAGGGGGAGGGTGG - Intronic
968068080 3:195770060-195770082 CAGTGGTGGCAGTGGGGGGGTGG + Intronic
968567579 4:1322304-1322326 GAGGCTGGGGTGTGGGAGGGTGG + Intronic
968952527 4:3702368-3702390 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
968952546 4:3702416-3702438 CAGTCCGGGCAGTGGGAGGAGGG - Intergenic
968952554 4:3702440-3702462 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
969323344 4:6426245-6426267 CCAGCTGGGCAGTGAGAGGGAGG + Intronic
969433902 4:7172988-7173010 CGGGCTGGGAAGTGGGAAGGTGG + Intergenic
969517275 4:7654707-7654729 CAGGCTGAGCAGTGGAAGGGGGG - Intronic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
969936432 4:10686565-10686587 CACTAAGGGCAGTGGGAGAGGGG + Intergenic
970152717 4:13106898-13106920 CAACCTGGGGAGTGGGAGTGGGG + Intergenic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
973263451 4:48186825-48186847 CAGACGGGGCAGTGGGTGGGCGG - Intronic
977578142 4:98696458-98696480 CAGGCTGGGGAGTGGGAAGAGGG + Intergenic
977654160 4:99503024-99503046 TAGGCAGGGCAGTGGGAGAGGGG - Intergenic
977955031 4:103017024-103017046 CAGCCAGGGCGGTGGGAGGGGGG - Intronic
980080277 4:128337048-128337070 CAGTCTGGGGAGTTTGAGGTGGG + Intergenic
981265044 4:142772536-142772558 CAGTGTGGGCAGTAGCAGGAAGG + Intronic
981730158 4:147888414-147888436 AAGTCTTGGGAGTGGGAGTGGGG + Intronic
982068025 4:151671814-151671836 CTGTGTGGGCAGGGGGAGTGAGG + Intronic
982200330 4:152954099-152954121 CAGTCTGGGAAGGAGGTGGGTGG + Intronic
982680294 4:158419830-158419852 CAGACAGAGCAGTGTGAGGGGGG - Intronic
983417103 4:167471309-167471331 CACTCAGGGCAGTGGGAGCTGGG + Intergenic
984803834 4:183736066-183736088 CTGTCCGGGAAGGGGGAGGGGGG - Intergenic
984942904 4:184950124-184950146 CAGGCTGCGGAGTGGGGGGGGGG + Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985789817 5:1919508-1919530 GAGTTAGGGCAGTGGGTGGGTGG + Intergenic
985861312 5:2472867-2472889 AACTCTGGGCAGTGGGAGTGCGG - Intergenic
985922090 5:2985440-2985462 GGGTCTGGGCAGTGGAAGGAAGG - Intergenic
985965168 5:3333932-3333954 CAGTCAAGGCAGAGGCAGGGTGG + Intergenic
986224654 5:5801498-5801520 TTGTCTGTGCAGTGGGATGGAGG + Intergenic
989160309 5:38384645-38384667 CAGTCTGTGCAGTGACAGAGTGG + Intronic
989547212 5:42688539-42688561 CAGTCAGGGAATGGGGAGGGTGG - Intronic
989587911 5:43088128-43088150 CAGTCCGGGAGGGGGGAGGGGGG - Intronic
991202289 5:64008475-64008497 CAGTTTGTGCACTGGGAGGATGG + Intergenic
991214838 5:64149721-64149743 CACTGTGGGGATTGGGAGGGTGG + Intergenic
991398920 5:66233888-66233910 AAGTCTGGGCAGTGAGTGGGAGG + Intergenic
992366092 5:76091447-76091469 CATTCTGGGCAGTGAGAGGCAGG - Intronic
992775396 5:80084528-80084550 CAGCCTGGGCAATGAGAGTGAGG + Intergenic
993277738 5:85883223-85883245 AAGGCAGGGGAGTGGGAGGGAGG - Intergenic
994267094 5:97730405-97730427 CACTCTGGGAAGTGGGAGATAGG + Intergenic
994601287 5:101908622-101908644 CAGTCTGCTCAATGTGAGGGTGG + Intergenic
994923684 5:106085729-106085751 CAGTTTGGGTTGTGGCAGGGTGG - Intergenic
997416309 5:133731513-133731535 GAATCTGGAAAGTGGGAGGGAGG + Intergenic
997630169 5:135361381-135361403 TACTCTGGGAAGTGGGAGGAGGG - Intronic
997702273 5:135911100-135911122 CGACCTGGGCAGTGGGAAGGAGG + Intergenic
997992527 5:138557337-138557359 CAGTCTTGACAGTGGGAGTTTGG - Intronic
998230890 5:140360874-140360896 GAGGCTGGGCAGTGCCAGGGTGG - Exonic
998523278 5:142819318-142819340 GAGTCTGGGCTGTGGGTGGGTGG + Intronic
999282281 5:150373756-150373778 CAGACTGGGCTGTGGGGAGGGGG - Intronic
999380510 5:151117930-151117952 CAGTATTGGCAGGGGGAGGTGGG + Intronic
999435321 5:151559158-151559180 CAGTCATGGCAATGGGAGTGTGG + Intronic
999828715 5:155299002-155299024 TAGCCAGGGCTGTGGGAGGGGGG - Intergenic
999981068 5:156958241-156958263 CAGCCTCGGCAGGGTGAGGGAGG + Intronic
1000103321 5:158036967-158036989 CAGACGGGGCAGTGGCCGGGCGG + Intergenic
1001255978 5:170183888-170183910 CAGCCTGGGAAGTGGCAGGGTGG - Intergenic
1001571260 5:172732152-172732174 GAGGTAGGGCAGTGGGAGGGGGG - Intergenic
1002495318 5:179607677-179607699 GACTCAGGGCACTGGGAGGGTGG - Intronic
1002528933 5:179832223-179832245 GAGTTTGGGGAGTGGGATGGGGG + Intronic
1002712730 5:181204874-181204896 CGGACAGGGCAGTGGGAAGGGGG + Exonic
1003047442 6:2746877-2746899 CAGGCTTGGCAGCGGGTGGGTGG - Intronic
1003062931 6:2876422-2876444 CAGTCTGCACAAGGGGAGGGAGG + Intergenic
1003577060 6:7306910-7306932 CTGTCTGGGTGGTGGGGGGGTGG + Intronic
1005140663 6:22627888-22627910 AAGTGTGGGCAGTGGGAGCTGGG + Intergenic
1005812737 6:29529410-29529432 CAGGCTGGGCAGTGGCAGTTGGG - Intergenic
1005823951 6:29621059-29621081 CAGTCTGGCACCTGGGAGGGTGG - Intronic
1005968128 6:30741985-30742007 CAGTCTGGGCCTTGGAATGGTGG + Intronic
1006407945 6:33856063-33856085 CAGTCTGGGGCCAGGGAGGGAGG - Intergenic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1006799133 6:36748305-36748327 GAGGCAGGGCTGTGGGAGGGGGG + Intronic
1007312927 6:40961061-40961083 CAGCCTGGTCAGTGGGCAGGAGG + Intergenic
1009935791 6:70233007-70233029 GAGTCAGGGCACGGGGAGGGAGG + Intronic
1010603084 6:77854973-77854995 CATTGTGGGGGGTGGGAGGGGGG + Intronic
1010680399 6:78792470-78792492 GAGTGTGGACAGTGGGAGGAGGG + Intergenic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1012987157 6:105887316-105887338 CAGCCTGGGAACTGTGAGGGAGG + Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015533088 6:134240832-134240854 CAGTGAGGGCAGAGGAAGGGTGG + Intronic
1017018316 6:150118953-150118975 CAGTGCGGGGAGTGGGAGGCTGG + Intergenic
1018053254 6:160030053-160030075 CAGACTGGGAAGAGAGAGGGAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018634730 6:165850638-165850660 CAGTCTGGGAAGTGGCTGGCTGG + Intronic
1018743515 6:166747616-166747638 GAGGCTGGGCAGGGGGAAGGGGG + Intronic
1018816907 6:167339977-167339999 GAGACTGCACAGTGGGAGGGTGG + Intronic
1019284896 7:218521-218543 AAGCCTGGTCAGAGGGAGGGCGG + Intronic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019523871 7:1472142-1472164 CACGCTGGGCTGTGGGTGGGTGG - Intronic
1019539807 7:1546533-1546555 CAGGCTGGGCAGCTGGAGGGAGG - Exonic
1019665861 7:2252144-2252166 CTGGCGGGGCCGTGGGAGGGGGG - Exonic
1019698209 7:2459744-2459766 CAGTCTCTGCAATGGGAGGGTGG + Intergenic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1020444402 7:8254373-8254395 CAGTCCAGGCAGGGGAAGGGAGG + Intronic
1020914153 7:14170986-14171008 AAGTCTGGGCAGTAGGAGACAGG + Intronic
1021116229 7:16748953-16748975 GAGTCTGCGCAGGGGGAGAGAGG - Intergenic
1021420903 7:20443661-20443683 CAATCTGGGCAGTGGGGTGAGGG - Intergenic
1021735456 7:23637010-23637032 CCGTCCGGGAAGGGGGAGGGGGG + Intronic
1022605852 7:31813268-31813290 CAGTCTGGGATGTGGGTGGCTGG - Intronic
1025606459 7:63043347-63043369 CAATCGGGGCAGAGGGAGTGTGG - Intergenic
1026205545 7:68254491-68254513 CACTCTGGGCAGTGGCAGACAGG + Intergenic
1026877613 7:73888384-73888406 TGGACTGGGCAGGGGGAGGGAGG + Intergenic
1028762564 7:94510723-94510745 CAGTCTGGGCTGTTGGACAGCGG + Intronic
1029257227 7:99277752-99277774 CAGCCTGGACCCTGGGAGGGAGG + Intergenic
1029519382 7:101050481-101050503 CAGTCTTGGCAGTGTGGTGGTGG + Exonic
1029706697 7:102280132-102280154 CAGCCTGGGCAGGGGAGGGGAGG + Intronic
1029996655 7:105013718-105013740 CAGACTGGGCTGGGGGAGGAGGG + Intergenic
1030632463 7:111910708-111910730 CGGTCTGGGCTATGAGAGGGAGG - Intronic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032087570 7:128891816-128891838 CAGTCTGGGCAGTGGATGGTGGG + Exonic
1032319161 7:130868903-130868925 CAGCCTGGGCGATGGGAGTGAGG + Intergenic
1032329259 7:130962498-130962520 CAGCCTGTGCACTGGGAGGAGGG - Intergenic
1032791059 7:135242729-135242751 CAGTCTCTGCAGTGAGAGGCTGG + Intronic
1032825205 7:135561944-135561966 CAGCCTGGGCAGAGTGAGGGAGG - Intronic
1033578475 7:142709759-142709781 CATTCTGGGCGGTGGGGGGAAGG - Intergenic
1033662671 7:143413145-143413167 CCGTGTGGGCTGTGGGAGGGAGG + Intergenic
1033943233 7:146681496-146681518 AAGGGTGGGGAGTGGGAGGGTGG + Intronic
1034203059 7:149294435-149294457 CAGTTTGGGCTGCTGGAGGGGGG + Intronic
1034404154 7:150891136-150891158 AAGCCTGGACAGTGGGAGTGAGG - Intergenic
1034468192 7:151242082-151242104 GATTCTGGCCTGTGGGAGGGTGG + Intronic
1034961777 7:155367670-155367692 CAGTCCGGGAGGGGGGAGGGGGG - Intronic
1034968784 7:155407042-155407064 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1034968808 7:155407117-155407139 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1034968843 7:155407241-155407263 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1035106012 7:156441930-156441952 CGGTCTGGGCCCTGGGAGGCTGG - Intergenic
1035289707 7:157830060-157830082 CAGAAAGGACAGTGGGAGGGAGG - Intronic
1035324002 7:158052986-158053008 CAGCCTGGGCAGGGAGAAGGCGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1036621147 8:10425127-10425149 CAGTTTTGGCGGTGGGTGGGGGG + Intronic
1036673866 8:10812821-10812843 CAGGCTGGGCGGTGTCAGGGAGG - Intronic
1036735838 8:11315377-11315399 CAGTCGGGGAAGGGGGAGTGGGG + Intronic
1036749047 8:11431734-11431756 CAGCCTGGACAGTTGGAGGGTGG + Intronic
1037109995 8:15154395-15154417 CACTCTGGCCACTGGAAGGGAGG - Intronic
1038103905 8:24412132-24412154 CAGTGGGGCCAGTTGGAGGGTGG + Intergenic
1038344886 8:26723307-26723329 CAGTAGGGGTAGTGGGAGAGAGG + Intergenic
1038688597 8:29741173-29741195 CAGCCTTGGCTTTGGGAGGGTGG - Intergenic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1040484607 8:47857953-47857975 CTGCCTGGGCTGTGGGAGTGTGG - Intronic
1040969099 8:53114507-53114529 CTGTGTGGGCAGTGGGCTGGGGG - Intergenic
1041664405 8:60428793-60428815 GAGTCTGGGTTGTGGGAGAGAGG - Intergenic
1041714818 8:60923337-60923359 CAAACTGGGCGGTGGGGGGGGGG + Intergenic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1042824286 8:72964424-72964446 CAGGCAGGTCAGTGGGAGGGAGG - Intergenic
1047762295 8:127963181-127963203 CAGCCTGGGCAGGGGCAGGAAGG - Intergenic
1048000788 8:130377888-130377910 AAGTGTGGGCAGTGGGCAGGGGG - Intronic
1048329415 8:133461847-133461869 CCCTGTGGGCAGGGGGAGGGTGG + Intronic
1048550904 8:135432917-135432939 CAGCCTTGGGAGAGGGAGGGAGG + Intergenic
1048927527 8:139284200-139284222 CAGTGAGGGCAGTGGTTGGGGGG - Intergenic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1048994220 8:139781728-139781750 CTGTGTGTGCGGTGGGAGGGAGG + Intronic
1049128764 8:140817238-140817260 AAGTATGGGCAGGGGGTGGGGGG + Intronic
1049592184 8:143467771-143467793 CTGCCTGGGCAGAGGGCGGGAGG - Intronic
1049610743 8:143553638-143553660 CAGCCTGGGAGGAGGGAGGGAGG - Exonic
1049642971 8:143723664-143723686 CAGGCTGGGCAGTGTGTGGTGGG + Intergenic
1049700492 8:144009191-144009213 AAGTCTGAGCAGTGAGTGGGAGG - Intronic
1049795576 8:144495965-144495987 GAGACTGGGCAGTGAGAGGCTGG + Intronic
1050161025 9:2718601-2718623 CACTCGGGGCAGGGCGAGGGCGG + Exonic
1050183175 9:2942465-2942487 CAGTTGGGGCAGGGGGACGGTGG - Intergenic
1050714277 9:8504044-8504066 CAGTGTAGGAAGTGGGAAGGTGG + Intronic
1052345730 9:27407744-27407766 CTATCTGGGCACTGGGAAGGTGG + Intronic
1053282102 9:36827047-36827069 CCCACTGGGCAGTGGGAGGGTGG + Intergenic
1053439569 9:38105176-38105198 AAGGCTGGGCAGTGGTGGGGTGG - Intergenic
1053885925 9:42645209-42645231 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1054224943 9:62452658-62452680 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1055459480 9:76504579-76504601 GGGGCTGGGGAGTGGGAGGGGGG + Exonic
1056443834 9:86645542-86645564 CAGTTTGTGCAGTGGAGGGGAGG - Intergenic
1056587830 9:87939871-87939893 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1056609037 9:88113074-88113096 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057182138 9:93035957-93035979 CAGGCTGGGCAGAGGCGGGGTGG - Exonic
1057371796 9:94480230-94480252 CAGGCTGGCCACTGGGTGGGAGG - Intergenic
1057548988 9:96038425-96038447 GTGTCTGGGCACTGGGAGAGAGG + Intergenic
1057711875 9:97452964-97452986 CAGTCTGGGGACTGGGAGAGGGG + Intronic
1058146794 9:101421426-101421448 CAGTCTTAGCAGTGGTAGGTTGG - Exonic
1058645371 9:107127121-107127143 AAGTCAGGGAAGGGGGAGGGAGG + Intergenic
1059713461 9:116890790-116890812 CAGGCTGGTAAGTGGCAGGGGGG + Intronic
1060026008 9:120172110-120172132 CACTCTGGGCAGTGTGGAGGGGG - Intergenic
1061264669 9:129497963-129497985 CACTATGGCCAGTGGCAGGGAGG + Intergenic
1061679690 9:132236808-132236830 GATTCTGGGCAGTGGAAGGCAGG + Intronic
1061823199 9:133239879-133239901 CACTCTGGGCGGTGTGGGGGAGG + Intergenic
1061838025 9:133342051-133342073 CAGTCAGGGAGGAGGGAGGGTGG - Intronic
1062012089 9:134272837-134272859 GGGTCTGGGCAGTGGCAGGCAGG - Intergenic
1062215301 9:135385894-135385916 CAGGGTGGGCACGGGGAGGGTGG - Intergenic
1186186635 X:7026752-7026774 CATTCTTTGCTGTGGGAGGGGGG - Intergenic
1186442403 X:9597555-9597577 CAGTCTGGCCAGTGGGCAGCTGG - Intronic
1186496635 X:10016162-10016184 GAGTCGGGGTATTGGGAGGGTGG - Intronic
1187429721 X:19211179-19211201 GTGTCAGGGCAGGGGGAGGGGGG - Intergenic
1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG + Intronic
1187549753 X:20290377-20290399 CAGTGTGGCCAGTGGGATAGTGG + Intergenic
1187731943 X:22264286-22264308 CAGTCTGGAGAATGGGAGGGAGG - Intergenic
1188137189 X:26504844-26504866 CACTCTGGGGAGTGGGGGCGGGG - Intergenic
1189252589 X:39612990-39613012 CACTCTGGGGAGTGGGACGTGGG - Intergenic
1190580871 X:51892592-51892614 CACACAGGGCAGGGGGAGGGTGG + Intronic
1190585138 X:51932376-51932398 CACACAGGGCAGGGGGAGGGTGG + Intergenic
1191189984 X:57656261-57656283 CAATCTGTGCACTGGGAGGATGG + Intergenic
1192535503 X:71923704-71923726 CAGCCTGGGCATCTGGAGGGTGG - Intergenic
1192555170 X:72083303-72083325 CAGTCTGCGAAGTGGCAGGGAGG + Intergenic
1193867869 X:86759048-86759070 CAGTCTGGGCATGGGAATGGGGG - Intronic
1194212277 X:91083094-91083116 CATTGTGGGCAGTGAGAAGGAGG + Intergenic
1194464836 X:94220812-94220834 TAGTCTGGGCAATGGTAGCGGGG - Intergenic
1194998894 X:100622773-100622795 CTCTCTGGGCAGTGGGAGTGAGG + Intergenic
1195670021 X:107461859-107461881 GAGTCTGGGCATTGGGAAGTGGG - Intergenic
1196766747 X:119252895-119252917 CTTCCTTGGCAGTGGGAGGGAGG - Intergenic
1196812535 X:119640148-119640170 AAGACTGGATAGTGGGAGGGTGG - Intronic
1197256663 X:124270621-124270643 AGGTCTGGGCAAAGGGAGGGTGG + Intronic
1197318000 X:124992213-124992235 CAGTCTTGGCAGTGGGGAGCAGG - Intergenic
1197525091 X:127551437-127551459 GAGGCTGGGCAGAGGGTGGGAGG - Intergenic
1197800590 X:130343674-130343696 CAGACTGGGCAATGGGAGGGAGG + Intronic
1198567153 X:137916383-137916405 CAGGCAGGGCAGTGGGGGGATGG + Intergenic
1199599359 X:149532771-149532793 CACTCTGGGCAGGGGGCTGGGGG - Intronic
1199767266 X:150950256-150950278 CAGGCTGGCCAGTGGTAGAGTGG - Intergenic
1200036524 X:153334790-153334812 CAGTCTGGGAGCTGGGAGGGTGG + Intronic
1200075583 X:153549092-153549114 CAATGTGGGCAGTAGGACGGAGG + Intronic
1200097906 X:153672704-153672726 CAGACGGGGCGGTGGGAGGTGGG + Intronic
1200906350 Y:8486544-8486566 CAGTCTGGTCAATAGGAGTGAGG + Intergenic
1201010226 Y:9544433-9544455 AAGGCAGGGCAGTGGGAGTGAGG + Intergenic
1201540766 Y:15102675-15102697 CAGTCTGGGGAGGAGGAGAGAGG + Intergenic
1201581878 Y:15518292-15518314 TAGTTAAGGCAGTGGGAGGGGGG - Intergenic