ID: 1013248683

View in Genome Browser
Species Human (GRCh38)
Location 6:108313074-108313096
Sequence CTGGCCAGTGATGCCTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013248683_1013248690 7 Left 1013248683 6:108313074-108313096 CCCCATTAGGCATCACTGGCCAG 0: 1
1: 0
2: 1
3: 11
4: 121
Right 1013248690 6:108313104-108313126 ATCACATGCTCAGTCCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013248683 Original CRISPR CTGGCCAGTGATGCCTAATG GGG (reversed) Intronic
901622012 1:10596211-10596233 CTGGCCAGTTCTGCCTAAGGTGG + Intronic
904677663 1:32208193-32208215 CTGGCCATTGGTGACTAGTGGGG + Exonic
906625022 1:47317997-47318019 CTAGCCATTTCTGCCTAATGTGG - Intergenic
907323478 1:53620230-53620252 CTAACCAGTGAGGACTAATGAGG - Intronic
908536502 1:65083385-65083407 CTGGCCGTTTTTGCCTAATGTGG - Intergenic
910534638 1:88283331-88283353 CGGACCAGAGATGGCTAATGGGG + Intergenic
912941638 1:114050133-114050155 CTGGCCAGTGATGTCTTTTTAGG + Intergenic
913229878 1:116732889-116732911 ATGGTCAGTGGTGTCTAATGAGG + Intergenic
915489238 1:156242269-156242291 CTGGCCAGCGATGCAAAGTGCGG - Exonic
921740087 1:218674396-218674418 CTGTCCAGCGATGTCTAATGTGG + Intergenic
923423476 1:233844156-233844178 CTGGCCACTGCTGGATAATGTGG - Intergenic
923443197 1:234040708-234040730 CTGGCCTTTGATGCCTCTTGAGG + Intronic
923788588 1:237091814-237091836 CAGGCCTGTGCTGCCTAATGTGG + Intronic
1062858103 10:789605-789627 GTGGCCAGTGCTGCCTCACGAGG - Intergenic
1065731842 10:28716771-28716793 CTGACAGGTGAAGCCTAATGAGG + Intergenic
1068027363 10:51663178-51663200 CTGGCCAGTGTTGCCCAATCTGG - Intronic
1068346398 10:55784826-55784848 GTGGCAAGGGAGGCCTAATGGGG - Intergenic
1068699006 10:60000352-60000374 TTGGGAAGTGATGCCTAATGAGG + Intergenic
1074861334 10:117512449-117512471 GTGGCATGTGAGGCCTAATGGGG + Intergenic
1075268287 10:121025432-121025454 CTGGCCAGTGCTGCTCCATGGGG - Intergenic
1075555400 10:123427256-123427278 CTGGCCAGAGATGACAAATGTGG + Intergenic
1075610945 10:123854134-123854156 TTCTCCAGTGATGCCTCATGGGG - Intronic
1076146280 10:128125223-128125245 GTGGCCAGGGATGCCCACTGTGG + Intronic
1082799559 11:57404631-57404653 ATGGGTAGTGATGGCTAATGGGG - Intronic
1083049520 11:59764704-59764726 CTTGCCTGTGAGTCCTAATGAGG + Intronic
1083841841 11:65309112-65309134 CTGGCCAGTGTTGCCGGAGGGGG + Intergenic
1084356259 11:68640814-68640836 TTGGACAGTGATGCCAACTGAGG - Intergenic
1085097133 11:73770412-73770434 CTGGCCAGTGAGATGTAATGGGG - Intergenic
1090551217 11:127822041-127822063 CTCGCCAGTGAGGGCTAAAGAGG + Intergenic
1092723148 12:11461531-11461553 CTGGCTGATGATGCATAATGGGG - Intronic
1096866312 12:54565733-54565755 CTGGCCTGTGATGCTTCCTGGGG + Intronic
1097838675 12:64300081-64300103 CTTTCCTGTCATGCCTAATGGGG - Intronic
1103671988 12:122624887-122624909 CTGGGCAGCAAAGCCTAATGTGG + Intronic
1103781770 12:123403438-123403460 ATCCCCAGTGATGCCAAATGAGG + Intronic
1105005693 12:132719271-132719293 CTGGTCAGTGATGCCGTGTGAGG + Intronic
1106594839 13:31127232-31127254 CTGGCCAGGGATTCCTAGGGAGG + Intergenic
1107725442 13:43294475-43294497 CATGCCAGTGCTGCCTGATGAGG + Intronic
1111115249 13:83768060-83768082 CTGACTAGAGATCCCTAATGAGG + Intergenic
1114669186 14:24399728-24399750 CTGGCCAGGGAAGTCTCATGGGG - Intronic
1118436878 14:65779647-65779669 CTTGCCAATGATGCCTGCTGGGG - Intergenic
1120177535 14:81311010-81311032 CTGTGCACTGATGCCTAATAGGG - Intronic
1121729198 14:96174557-96174579 CTGGTAACTGATGCCTTATGTGG - Intergenic
1122784108 14:104155992-104156014 CTGGCCCAGGATGCCAAATGTGG + Intronic
1124616709 15:31247532-31247554 CTGGCCAGGGATCACTGATGAGG + Intergenic
1125971114 15:43912629-43912651 CTGGGCAGTGATTCTCAATGTGG + Intronic
1127853873 15:62938919-62938941 CTGGCCAGTTATGGGGAATGTGG - Intergenic
1127969322 15:63946218-63946240 CTGGCCAGAGGTGCCTGCTGTGG + Intronic
1129303580 15:74641617-74641639 CTGGCCGGTGAAGCCAAGTGGGG - Intronic
1131733408 15:95306025-95306047 CTGGCCATTGGTGCCTAATGTGG - Intergenic
1134893982 16:17867321-17867343 ATGGCCAGTTATTCCGAATGAGG - Intergenic
1135505793 16:23034961-23034983 CTGGCCATTTCTGCCCAATGAGG + Intergenic
1139324041 16:66138033-66138055 CTGCCCAAAGATGCCTGATGGGG - Intergenic
1141410611 16:83830311-83830333 CTGGCCAGTGCTGCGTATGGGGG + Intergenic
1142442679 16:90110190-90110212 CTGCTCAGTGTGGCCTAATGCGG + Intergenic
1149256239 17:54830092-54830114 CTGCCCAGTGATAGCAAATGTGG - Intergenic
1151768868 17:76146594-76146616 CCGGCCAGAGATGCCTCGTGAGG - Intronic
1153022469 18:642590-642612 CAGGCTAGTGATTCCTGATGAGG + Intronic
1161119161 19:2515802-2515824 CTGGGGAGTGATGGCTGATGGGG + Intronic
1163400577 19:17089909-17089931 GTGGGGAGTGATGGCTAATGGGG - Intronic
1168218265 19:54942318-54942340 CCAGCCCGTGCTGCCTAATGGGG + Intronic
927072256 2:19542976-19542998 CTGGCCATCGCTGACTAATGGGG + Intergenic
928992188 2:37245018-37245040 GTGTCCACTGATGCCTGATGAGG + Intronic
932793450 2:74675094-74675116 CATGCCAGTGATGCTTAGTGGGG - Intronic
936607285 2:113971266-113971288 CTGGGGAGTGGTGGCTAATGAGG + Intergenic
936850479 2:116891567-116891589 CAGGCCAGTGATTCTTATTGTGG - Intergenic
937844760 2:126567141-126567163 ATGGCCCTTGATGCCTAATAAGG + Intergenic
939997285 2:148931787-148931809 CTGACCAGTGAGGACTCATGGGG + Intronic
947115171 2:226762224-226762246 CTGGCCAGAGATTCCAAGTGAGG - Intronic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
1172248983 20:33465715-33465737 CAGCCCAGTGATGCATGATGAGG + Intergenic
1174632039 20:51966635-51966657 CAGGCCAGGGATGCCTTAAGTGG - Intergenic
1175845675 20:62057568-62057590 CTTTCCAGTGATGCCCAGTGGGG + Intronic
1176211428 20:63924835-63924857 CTGGCCAGTGATGCCCCACCTGG + Intronic
1178341194 21:31786705-31786727 TTGTGCAGTGATGCTTAATGAGG + Intergenic
1178911546 21:36678361-36678383 CTGGCCAGTGATGCCTCACCTGG + Intergenic
1179647096 21:42782716-42782738 AGGGACAGTGATGCCTAGTGTGG + Intergenic
1180701972 22:17786012-17786034 CTCCCCAGTGATGCCCAGTGAGG - Intergenic
1180933209 22:19607405-19607427 CTGAGCAGGGCTGCCTAATGGGG - Intergenic
1183453183 22:37907334-37907356 CTGCCCAGAGCTGCCCAATGAGG + Intronic
1184514731 22:44955038-44955060 CTGGACAGTGATCCCTAGTGTGG - Intronic
1185322981 22:50210393-50210415 CTGGCCCGTGATGCTTGAGGGGG + Intronic
951896500 3:27614647-27614669 CTGGCCAGTGATGCCCCACCCGG + Intergenic
953023388 3:39130293-39130315 CTGGCCAGGGAGGCGTCATGTGG - Exonic
954410814 3:50370128-50370150 CTGGCCACTGCTGCCTGGTGCGG + Intronic
954614723 3:51963889-51963911 GGAGCCAGTGATGCCTCATGGGG - Intronic
954802007 3:53192766-53192788 CGGGCCAGTGCTGCCAAAAGTGG - Intergenic
960034572 3:113089312-113089334 CTGTCCAGTGAGGCCACATGAGG - Intergenic
961743521 3:129047997-129048019 CTGCCCAGTGATGTCCAGTGGGG + Intergenic
968362952 3:198161150-198161172 CTGCTCAGTGTGGCCTAATGCGG + Intergenic
970457836 4:16243173-16243195 CTGACCAGTGATGGCTACAGAGG + Intergenic
976277967 4:83297589-83297611 CTGCTCACTGATGCTTAATGAGG - Intronic
976656664 4:87496072-87496094 CTGGGCAGTGATGCATGATGGGG + Intronic
977295717 4:95206690-95206712 CTGCGCAGTGATGCATAGTGAGG + Exonic
979338776 4:119494749-119494771 GTGGCTAGTGATGCCTCATAAGG + Exonic
986339774 5:6779043-6779065 CTGGCCACTTTTGCCTTATGAGG + Intergenic
992783851 5:80151914-80151936 CTGCGCAGTGTTGCCTCATGGGG - Intronic
993896659 5:93543029-93543051 CTGGTCAGTAAATCCTAATGAGG - Intergenic
996083290 5:119278506-119278528 CTGGCCAATGAGGCTTAAAGAGG - Intronic
997437163 5:133883959-133883981 CTAGCCAGTGATGCATAGAGTGG - Intergenic
1010127151 6:72446269-72446291 CTGGCCAGTGAGGGATAAGGAGG - Intergenic
1010341591 6:74759857-74759879 CTGGCCAGTGTTTCCCAAAGTGG + Intergenic
1013248683 6:108313074-108313096 CTGGCCAGTGATGCCTAATGGGG - Intronic
1014479616 6:121920034-121920056 CTGGCCAGTGTGGGCTGATGGGG + Intergenic
1019252730 7:27561-27583 CTGCTCAGTGTGGCCTAATGCGG - Intergenic
1019352706 7:562411-562433 GTGGACAGAGATGCCTAATGGGG - Intronic
1020419054 7:7979748-7979770 TTGGGCAGTGATGCCTTGTGAGG + Intronic
1021153471 7:17180222-17180244 CTGGCCAAGGAAGCCTAATCAGG - Intergenic
1023303959 7:38803745-38803767 CTGGCTACTGATGGCAAATGGGG + Intronic
1026188835 7:68105864-68105886 CTGGCCATTGCTGCCCAGTGGGG - Intergenic
1029604536 7:101590680-101590702 CTGTGCACTGAGGCCTAATGAGG + Intergenic
1032534227 7:132648465-132648487 ATCCCCAGTGATCCCTAATGAGG + Intronic
1035134534 7:156688409-156688431 CTAGCAAGTGATGAGTAATGAGG + Intronic
1037730684 8:21520975-21520997 ATGCCCATTGTTGCCTAATGTGG - Intergenic
1040114809 8:43604365-43604387 CTGCCCATTGATGCCTAGGGTGG + Intergenic
1041980751 8:63856225-63856247 CAGCCCAGTGATGCCTAACCAGG - Intergenic
1042530704 8:69811865-69811887 CTGGCCAGTGGTGCAAACTGGGG - Intronic
1045421753 8:102023265-102023287 ATGGCCAGTGTTGCCTAGTTGGG - Intronic
1050252550 9:3760355-3760377 TTGGCCAGTGAAGTCAAATGAGG + Intergenic
1052978856 9:34432417-34432439 CTGTCCAGTGATGCCCAAGGTGG - Intronic
1057306331 9:93914277-93914299 GTGGCCACTGATGCTAAATGAGG - Intergenic
1058714236 9:107709217-107709239 CTGGCCATTTCTGCCTAATATGG - Intergenic
1061265088 9:129500276-129500298 CAGCTCAGAGATGCCTAATGGGG - Intergenic
1061279261 9:129587691-129587713 CTGGCTAGTTATGACGAATGGGG + Intergenic
1061285332 9:129619653-129619675 CTGGCCACTCATGCCAGATGTGG - Intronic
1061512400 9:131069104-131069126 CTGGGCAGAGATGACTGATGGGG + Intronic
1062747639 9:138224813-138224835 CTGCTCAGTGTGGCCTAATGCGG + Intergenic
1187176939 X:16904470-16904492 TTGGCCAGTGTTGGGTAATGTGG + Intergenic
1187940886 X:24380012-24380034 ATGGACAGTGTAGCCTAATGCGG + Intergenic
1189721089 X:43919118-43919140 CTGGTCATTGATCACTAATGAGG - Intergenic
1192469861 X:71388610-71388632 TTGGCCAGTCATGCCAACTGTGG + Intronic
1193553260 X:82924920-82924942 CTGGCCTCTGATGACTCATGGGG - Intergenic
1196245278 X:113392168-113392190 CTGCCCAGTGATGAGTAGTGGGG + Intergenic
1197260177 X:124308955-124308977 ATGGCAGGAGATGCCTAATGGGG + Intronic
1200529388 Y:4316479-4316501 CTAGGCAGTGCTGCCTAGTGGGG - Intergenic