ID: 1013251841

View in Genome Browser
Species Human (GRCh38)
Location 6:108342171-108342193
Sequence CAGAGGGCATAGAAAGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 375}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013251841_1013251850 9 Left 1013251841 6:108342171-108342193 CCCATCCCTTTCTATGCCCTCTG 0: 1
1: 0
2: 2
3: 46
4: 375
Right 1013251850 6:108342203-108342225 CTGCAAGGAATGCCTCCCACAGG 0: 1
1: 0
2: 0
3: 31
4: 178
1013251841_1013251852 23 Left 1013251841 6:108342171-108342193 CCCATCCCTTTCTATGCCCTCTG 0: 1
1: 0
2: 2
3: 46
4: 375
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251841_1013251847 -6 Left 1013251841 6:108342171-108342193 CCCATCCCTTTCTATGCCCTCTG 0: 1
1: 0
2: 2
3: 46
4: 375
Right 1013251847 6:108342188-108342210 CCTCTGTCCTGTTTCCTGCAAGG 0: 1
1: 0
2: 6
3: 37
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013251841 Original CRISPR CAGAGGGCATAGAAAGGGAT GGG (reversed) Intronic
901234253 1:7659119-7659141 CAGAGGGGAAGGAAAGGGAGCGG + Intronic
902783760 1:18720284-18720306 CAGAGGACAGAGAAAGGAAGGGG + Intronic
903385377 1:22922778-22922800 CATAGAGCCCAGAAAGGGATGGG + Intergenic
904922057 1:34015546-34015568 CAGAGTGCCTGGGAAGGGATGGG - Intronic
905143811 1:35870738-35870760 CAGAGGGGAAAGAATGGGAATGG - Intronic
905530757 1:38676896-38676918 CAGAAGGCATGGAAAGGCACAGG + Intergenic
905772918 1:40649866-40649888 CTGAGGGTATGGTAAGGGATGGG + Intronic
905809669 1:40902771-40902793 CAGACGGCACATACAGGGATAGG + Intergenic
906661156 1:47583318-47583340 CAGAGGGCAGAGCCAGGGCTGGG - Intergenic
907211370 1:52825852-52825874 CATATGGGATAGGAAGGGATAGG - Exonic
908697054 1:66855286-66855308 CAGAAGGCAGAGAGAGTGATGGG - Intronic
908783137 1:67709692-67709714 CTGGGAGCACAGAAAGGGATTGG - Intronic
909766612 1:79364182-79364204 AAGAAGGCATAGACAGGGAAAGG + Intergenic
909927428 1:81454774-81454796 CAGAGGCCATAGAAAAGAAAAGG - Intronic
910197145 1:84653455-84653477 CAGTGGGCATAGTGAGGGATGGG - Intronic
911274490 1:95844454-95844476 CAGAGGGCATTGGAGGGGAAAGG - Intergenic
913182649 1:116337007-116337029 GAGAGGGAAAAGAAAGGAATGGG - Intergenic
914808614 1:151009833-151009855 CAGAGGTAACAAAAAGGGATTGG - Intronic
915275004 1:154782453-154782475 CACATGGCAGAGAAAGGGAGAGG + Intronic
915492711 1:156260189-156260211 CAGAAGGCAGAGAAAGGAAGGGG + Intronic
916433595 1:164756028-164756050 CAGAGGGGAAAGCAAGGGAAGGG - Intronic
916790145 1:168117816-168117838 CAGAGGGCCTGGGAAGGGGTTGG - Intronic
918305156 1:183239507-183239529 CAGAGGGCAAAGAATGGGGCCGG + Exonic
919806299 1:201382798-201382820 CAGAGGCCCTGGAATGGGATAGG + Intronic
921490330 1:215768160-215768182 GTGAGGGGATAAAAAGGGATGGG - Intronic
921946495 1:220889398-220889420 CAGGGGGCAGAGACAGGGAAGGG - Intergenic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
1062862404 10:821284-821306 GAGAGGGCAGAGGAAGGGATGGG - Intronic
1063171621 10:3514826-3514848 CAGAGGGAAGGGAAAGGGGTGGG + Intergenic
1064010140 10:11729146-11729168 CAGAGGGAAGAGCAAGGGGTTGG - Intergenic
1065994322 10:31042292-31042314 CACAGGGAATGGAAAGGGCTAGG + Intergenic
1067032025 10:42884605-42884627 CAGGGGGCAGGGAGAGGGATGGG + Intergenic
1067272343 10:44803270-44803292 GAGATGGGATAGAAATGGATGGG - Intergenic
1067450559 10:46379646-46379668 CAGATGGCACAGACAGGGACAGG + Intronic
1067586684 10:47480105-47480127 CAGATGGCACAGACAGGGACAGG - Intronic
1068023947 10:51619160-51619182 GAAAGAGCAGAGAAAGGGATTGG + Intronic
1068345211 10:55768577-55768599 CCCAGGGTATAGAAAGGGAAAGG + Intergenic
1069788798 10:71006300-71006322 CAGTGGGCATGCAAAGGGCTGGG - Intergenic
1069864320 10:71492114-71492136 CAGAGGGCATTGAAAGCCATGGG + Intronic
1069889781 10:71645634-71645656 CAGAGGGCCTAGACATGGGTGGG + Intronic
1070596869 10:77838588-77838610 GAGAGGGCATAGAGAAGGAAAGG + Intronic
1070678302 10:78430824-78430846 CAGAAGGGAAAGAAAGGGAAGGG - Intergenic
1070824939 10:79385580-79385602 CAGAGGGGAAGGAAAGGGAGTGG + Exonic
1070831090 10:79418521-79418543 CATGGGGCATAGAAGGGCATAGG + Intronic
1070831612 10:79421341-79421363 CAGATGGCATAGCAGGGGATGGG - Intronic
1071305923 10:84298715-84298737 CTGGAGTCATAGAAAGGGATGGG + Intergenic
1071433909 10:85628835-85628857 CAGAGTGAATAGAATGGGAGTGG + Intronic
1071938812 10:90563509-90563531 GAGAGGGTATAGAAAGAGATTGG - Intergenic
1072118244 10:92384226-92384248 CAGAGGCCAGAGGAAGGGAGGGG + Intergenic
1073229800 10:101959404-101959426 TAGAGGCGAGAGAAAGGGATGGG + Intronic
1073916663 10:108412726-108412748 CATAGGGCTTAGAAAATGATGGG + Intergenic
1074280369 10:112045763-112045785 CAGAGTGCGTAGAAAAGGGTTGG + Intergenic
1074332411 10:112528783-112528805 CAGAGGAAATAGAAAGGAAGGGG + Intronic
1074452302 10:113568971-113568993 CAGAGACCATGGAAAGGGAGTGG + Intronic
1074604689 10:114949741-114949763 CAGAGGGAATGGAAAGGAAGGGG + Intronic
1074942672 10:118250280-118250302 CAGAGGGGAGAGAGAGGGTTGGG - Intergenic
1075978552 10:126718029-126718051 CAGTGGGCATTGAATGGGACAGG - Intergenic
1076721068 10:132393525-132393547 CAGAGGCCAAAGGCAGGGATGGG - Intergenic
1077006469 11:360146-360168 CAGAGAGGAGAGAAAGAGATGGG + Intergenic
1077024759 11:434107-434129 TTGGGGGCAGAGAAAGGGATAGG + Intronic
1077362587 11:2147284-2147306 AAGAGGGCAAAGAAGGGGAGAGG - Intronic
1078766235 11:14301110-14301132 CATAGGGTATAGAAAGGGGAAGG + Intronic
1079775368 11:24518811-24518833 CAGAGAGCAAAGAGAGGGTTCGG + Intronic
1079864277 11:25715951-25715973 CAGAAGGCAGTGAAAGCGATTGG - Intergenic
1080202700 11:29691939-29691961 CAGAGGCCCTAGAAAAGGATTGG + Intergenic
1080682082 11:34486524-34486546 CAGAGTGAATAGAAGGGCATGGG + Intronic
1081112331 11:39151561-39151583 CAAAAGACATAGAAAGGGCTGGG + Intergenic
1081417707 11:42835723-42835745 CTGATGGCATGGAAAGGGTTTGG - Intergenic
1083097433 11:60266187-60266209 CAGAGTGCAGAGAATGGGGTGGG - Intergenic
1084873560 11:72114223-72114245 CAGAGGGCCTAGAATGGCTTGGG + Intergenic
1085571118 11:77558788-77558810 CAAAGGGGATAGAAAGGGACTGG - Intronic
1086126242 11:83351364-83351386 CAGAGAGCAAGGAAAGGGAAAGG + Intergenic
1086503150 11:87474053-87474075 CAGATGGAATGGAAGGGGATGGG - Intergenic
1087310495 11:96536248-96536270 CAGAGGGCCTAGGAAGGCAGAGG - Intergenic
1088065240 11:105709717-105709739 GAGAGGGAAGAAAAAGGGATAGG + Intronic
1089061623 11:115630539-115630561 GAGAGGGGATGGAAAGGAATGGG + Intergenic
1090344195 11:126054785-126054807 CAGAGTGCAAAGAAAGGGGTGGG + Intronic
1090534016 11:127620654-127620676 CAGAGGGGAGAGACAGGGAGGGG + Intergenic
1090754791 11:129780316-129780338 CAGAGGAGACAGAAAGGGATGGG - Intergenic
1090997909 11:131883878-131883900 CAGATGGCATTGAATGGGAGTGG + Intronic
1091567477 12:1659787-1659809 CAGAGGACATGGACAGGGAGCGG + Intergenic
1092025521 12:5236514-5236536 CAGAGGGTATAGAGAGGAACAGG + Intergenic
1092092110 12:5812071-5812093 AAGAGGGGAGAGGAAGGGATGGG + Intronic
1093123867 12:15305549-15305571 CAGGGGTTATAGAAAGAGATAGG - Intronic
1093991218 12:25591664-25591686 CATAGGGCATAGCCAGGGAGTGG + Intronic
1094046176 12:26169418-26169440 TAGAAGGAATACAAAGGGATAGG + Intronic
1095152607 12:38813126-38813148 CAAAGGGCATGGAAAAGAATTGG + Intronic
1096125586 12:49117094-49117116 CAGAGGGCACAGCAAAAGATGGG - Intergenic
1096676836 12:53230700-53230722 CAGAGGGCATGGACAGGGTGGGG + Intronic
1097150590 12:56976538-56976560 GAGAAGGTAGAGAAAGGGATAGG - Intergenic
1099449559 12:82792416-82792438 GAGAGGGAATAGAAAGTGACTGG - Intronic
1099851474 12:88102443-88102465 CAGGGGTAAGAGAAAGGGATGGG + Intronic
1099906795 12:88780579-88780601 CAGAGGGAGAAGCAAGGGATAGG - Intergenic
1100549354 12:95632749-95632771 CAGAGGGAATATCAAGGGAAGGG - Intergenic
1100874911 12:98951653-98951675 AAGAGGGCACAGACAGGGCTTGG - Intronic
1101673606 12:106898424-106898446 TCGTGGGCATAGAAAGGGAAGGG + Intergenic
1101807082 12:108073548-108073570 TAGGGGGCAAAGAAAGGGAAAGG + Intergenic
1103175556 12:118860337-118860359 CAGAGGCAATAGACAGGCATGGG + Intergenic
1103917331 12:124382689-124382711 CTGAGGGCAGAGACATGGATGGG - Intronic
1103982656 12:124746526-124746548 CAGAGCACATAGAAAGGGTTTGG + Intergenic
1104253271 12:127116924-127116946 CAGAGGTGAAAGGAAGGGATAGG - Intergenic
1105340380 13:19517606-19517628 GAGAGGGCAGAGGATGGGATGGG + Intronic
1105748039 13:23395419-23395441 CAGAGGGGATAGGAAGGGGGAGG - Intronic
1105771582 13:23617253-23617275 CAGAGAGCAGAGGAAGGGGTGGG + Intronic
1106020012 13:25905594-25905616 CAGAGGGCATGGAGAGGGGCCGG - Intronic
1108067197 13:46590289-46590311 AAGAGGAGATAGAAAGAGATAGG - Intronic
1108634944 13:52323769-52323791 GAGAGGGCAGAGGATGGGATGGG + Intergenic
1108652860 13:52499420-52499442 GAGAGGGCAGAGGATGGGATGGG - Intergenic
1108931822 13:55834367-55834389 CAGAGGTCATAGAAAGAGAAAGG + Intergenic
1108961995 13:56246117-56246139 AAGAGGACTTAGAAAGAGATGGG - Intergenic
1109194985 13:59368835-59368857 AGGAGGGCAGAGAAAGGGTTAGG - Intergenic
1109691380 13:65895210-65895232 CAGAGGGCAGAGAAAAGGAAGGG - Intergenic
1111809125 13:93076220-93076242 CAGATTCCTTAGAAAGGGATTGG + Intergenic
1112146716 13:96708406-96708428 CAGAGGTCAGAGAAAGAGATTGG - Intronic
1112156828 13:96826650-96826672 CAAAGAGCAAAGAAAGGGAAAGG + Intronic
1112188267 13:97149136-97149158 CAGAGGGGAGAGAAAGTGATAGG + Intergenic
1113075207 13:106461337-106461359 CAGAGGACAAAGAAAGAGCTGGG + Intergenic
1113081912 13:106529225-106529247 CAGAGGGGATAGGTAGGGCTGGG - Intronic
1116231961 14:42229209-42229231 CAGAGTGCTTAGACAGGGGTGGG + Intergenic
1116423091 14:44756386-44756408 CAGAGGGTAAAGAAAGGTAGTGG - Intergenic
1117428196 14:55623031-55623053 AAGTGGGCATAGAAAGAAATTGG - Intronic
1117838993 14:59838094-59838116 TAGAGGGGAGAGAGAGGGATAGG - Intronic
1117902178 14:60546138-60546160 GGGAGGGGAAAGAAAGGGATTGG - Intergenic
1119188043 14:72658596-72658618 CAGAGGAAAAAGAAATGGATAGG + Intronic
1119476730 14:74934812-74934834 GAGAGGGCTTTGAAAGGGAGAGG + Intergenic
1119761608 14:77155623-77155645 CGGAGGGGAGAGAAAGGGAAAGG + Intronic
1119894176 14:78205947-78205969 CAGTGAGGATAGAAAGGGGTAGG + Intergenic
1119956969 14:78809100-78809122 CAGTGGGCATAGTAGGGGACTGG - Intronic
1120702464 14:87713103-87713125 CAGATGGAATGGAAAGTGATGGG - Intergenic
1120813969 14:88834023-88834045 CCAAGGGCTTAGAAAGGGAGCGG + Intronic
1121533163 14:94672718-94672740 CAGAAGGCATAAAATGGCATTGG + Intergenic
1122145755 14:99688018-99688040 CAGAGGGCACAGAGAGGGGTGGG - Intronic
1122425219 14:101601785-101601807 TAGATGGCATAGAAAGTGAATGG + Intergenic
1122447874 14:101782138-101782160 GAGAGGGGAGAGAGAGGGATGGG - Intronic
1122447958 14:101782368-101782390 CAGAGGGGAGAGAGAGGGAAGGG - Intronic
1122448074 14:101782685-101782707 CAGAGGGGAGAGAGAGGGAAGGG - Intronic
1125394360 15:39230898-39230920 CAGAGGGAAAAGACAGGAATAGG + Intergenic
1126950282 15:53873200-53873222 CAGAAGGCATTGAATGTGATTGG - Intergenic
1127175924 15:56357084-56357106 TAGGGGACATAGTAAGGGATTGG - Intronic
1127651139 15:61008934-61008956 CACGGGGCATAGAAAGGGTCAGG + Intronic
1127774104 15:62252266-62252288 CAGAGGGCTTAGACATGGAGGGG - Intergenic
1128827681 15:70735191-70735213 TAGAGGGCAGACAGAGGGATGGG + Intronic
1129220903 15:74131165-74131187 CGGGGGGCAAAGAAAGGGACAGG - Intronic
1130157429 15:81363786-81363808 CCTAGGGCATAGAGAGGGAGAGG + Intronic
1130259956 15:82346926-82346948 CAGAGGGCTTAGACAGTGAGGGG - Intronic
1130268769 15:82432511-82432533 CAGAGGGCTTAGACAGTGAGGGG + Intronic
1130281274 15:82522084-82522106 CAGAGGGCTTAGACAGTGAGGGG + Intergenic
1130472648 15:84238267-84238289 CAGAGGGCTTAGACAGTGAGGGG + Intronic
1130480139 15:84352838-84352860 CAGAGGGCTTAGACAGTGAGGGG + Intergenic
1130484369 15:84390409-84390431 CAGAGGGCTTAGACAGTGAGGGG + Intergenic
1130491630 15:84435291-84435313 CAGAGGGCTTAGACAGTGAGGGG - Intergenic
1130503245 15:84514331-84514353 CAGAGGGCTTAGACAGTGAGGGG - Intergenic
1130594943 15:85242901-85242923 CAGAGGGCTTAGACAGTGAGGGG + Intergenic
1131346793 15:91656797-91656819 CAGTGGGAATAGAAAAGGAAAGG + Intergenic
1133353986 16:5122494-5122516 CAGAGCGCACAGAAAGGACTTGG - Intergenic
1135052774 16:19205808-19205830 CATCGGGGATAGAAAGTGATAGG - Intronic
1135420560 16:22303110-22303132 CAGAGGGAACAGCAAGGGTTAGG - Intronic
1135758070 16:25114607-25114629 CAGAGGACATAGTGAGGGGTTGG - Intronic
1136230663 16:28883523-28883545 CAGAGGGAAAGGAAAGCGATTGG + Intronic
1137717096 16:50604697-50604719 CAGAGGGCATGGAACTGGAGGGG - Intronic
1139551126 16:67673719-67673741 GAGAGGGAATAACAAGGGATAGG - Intergenic
1140151056 16:72366267-72366289 CAGAGGGAATGGGAAGGGAACGG - Intergenic
1140370423 16:74410219-74410241 CAGAGGGCATGCAGAGGGAGGGG + Intronic
1143585658 17:7848985-7849007 CAGGGGGCAGAGATAGGGGTGGG - Exonic
1143688258 17:8537391-8537413 AAGTGGTCAGAGAAAGGGATGGG + Intronic
1144831953 17:18136764-18136786 CTGCAGGCACAGAAAGGGATGGG - Intronic
1146599426 17:34201705-34201727 CAAAGTGCATAGAAAGAGAGTGG + Intergenic
1147450476 17:40500953-40500975 CTGAGGTCATGGAAAGGGACTGG - Intronic
1147627599 17:41910039-41910061 CAGAGGGGAAGGAAAGGGCTTGG - Intronic
1147741350 17:42672478-42672500 CAGAGGGAATATAAGGGGATGGG + Intronic
1148847759 17:50539161-50539183 CAGAAGGCACAGAAAGAGTTAGG - Intronic
1149005993 17:51805969-51805991 CAGAGGGCATAGCAAAGGCTAGG + Intronic
1150661648 17:67085921-67085943 AAAAAGGCATAGAAAGGGATCGG - Intronic
1152074255 17:78148999-78149021 CAGATGGCATGGGATGGGATGGG + Intronic
1152405158 17:80093905-80093927 CAGAGGGCAAAGACAATGATAGG - Intronic
1152701598 17:81822480-81822502 CAGAGGGCACAGGAAGGAAAAGG + Exonic
1153016070 18:583747-583769 GAGAAGACATAGAAAGGGATAGG + Intergenic
1155776625 18:29771184-29771206 CAATGGGAATAGAAGGGGATAGG + Intergenic
1156083286 18:33366743-33366765 CAGAGGGCAAAGCAAGGCAGAGG - Intronic
1156262637 18:35459297-35459319 CAGAGGGCAGAGGAGGGGACGGG + Intronic
1156458461 18:37307818-37307840 CAGAGGGCAGGGAAAGGGTTTGG + Intronic
1157828162 18:50831282-50831304 CAGAGGGCATGGAGAGAGATTGG - Intergenic
1158444411 18:57506761-57506783 AAGAGGGTATATAAAGGGCTAGG - Intergenic
1159675892 18:71283975-71283997 CATAGGGCATAAAAATGGATTGG + Intergenic
1160124290 18:76156114-76156136 AAGATGGCCTAGAAAGTGATGGG - Intergenic
1160313238 18:77817402-77817424 CAGAGGTCTTGGAAAGGGAGTGG + Intergenic
1160570803 18:79816398-79816420 CAGAGGGCAGAGAAGGGGGAGGG - Intergenic
1161458323 19:4381196-4381218 CAGAGGGGACAGAGAGAGATGGG - Intronic
1161458329 19:4381228-4381250 CAGAGGGGACAGAGAGAGATGGG - Intronic
1161780776 19:6290491-6290513 CAGAGGGCATACGAAGGACTAGG + Intergenic
1162527683 19:11215992-11216014 AAGAGCACAAAGAAAGGGATGGG - Intronic
1163104513 19:15115727-15115749 CAGAGGACAGAGACAGGGATAGG + Intronic
1163159038 19:15454004-15454026 CACAGGTTATAGAAAGGGTTGGG - Intronic
1165422910 19:35731322-35731344 CACAGGGCAAAGAATGGGCTTGG + Intronic
1166529906 19:43535790-43535812 CAGAGGGCAGGGCAAGGGATTGG + Intronic
1166929032 19:46290058-46290080 CAGAGGGGAAAAAAAGGGTTGGG + Intergenic
1167118656 19:47503307-47503329 GAGAGGGCATACAAAGAGAAAGG + Intronic
1167419767 19:49395898-49395920 CCCAGGGCAGAGCAAGGGATAGG + Intronic
1168151816 19:54453166-54453188 AAGATGGCAAAGAAAGGGAGAGG - Intronic
1168703782 19:58456595-58456617 CAGAAGGCCAAGAAAGGGTTGGG - Exonic
925599171 2:5590547-5590569 CAGAGGTCAGAGAAAGAGAGGGG + Intergenic
926537708 2:14133663-14133685 CAGAGGGCATTGAAAGCCAGTGG + Intergenic
927132510 2:20072330-20072352 CGGAGGGAGTAGAAAGGGAAGGG + Intergenic
927421028 2:22931078-22931100 CACAGGGCAGAGAGAGGGAGGGG - Intergenic
927503051 2:23595168-23595190 CAGAGGGCCTGGGAAGGGAAGGG + Intronic
928436271 2:31256618-31256640 CTGAGGGCAGGGACAGGGATAGG + Intronic
928952622 2:36826485-36826507 AAGAGGGCATAGCCAGAGATTGG - Intergenic
930164760 2:48194213-48194235 CAGAGGGGAATGAGAGGGATGGG + Intergenic
932295232 2:70618704-70618726 CAGAGGGCACAGCAATGGAAAGG + Intronic
932682713 2:73840038-73840060 GAAGGGGGATAGAAAGGGATAGG - Intronic
932866320 2:75346907-75346929 TAGAGGGCAGAGAAGGGAATGGG - Intergenic
933769596 2:85734581-85734603 GAGAGGGGAGAGAAAGGGCTGGG + Intergenic
933885824 2:86719275-86719297 CAGACGCCATAGCAAGCGATGGG + Intronic
933924356 2:87077430-87077452 CAGACGCCATAGCAAGCGATGGG - Intergenic
934961746 2:98681903-98681925 CAAAGGGCACAGAAAGGCAGTGG + Intronic
935188889 2:100759890-100759912 CAGAGGGCTGAGAAGGGGATAGG - Intergenic
935388485 2:102525549-102525571 AAGAAGGTATAGGAAGGGATTGG + Intronic
935508428 2:103937942-103937964 CAGAGGCCATGTAAAGGGAAAGG - Intergenic
935858496 2:107301386-107301408 CAGAGGGATTAGAAAAGGAAAGG - Intergenic
936000181 2:108819779-108819801 CAGAAGGCATACAAAGGAACAGG + Intronic
938881738 2:135596527-135596549 GAGAGGGAAATGAAAGGGATTGG - Intronic
939459477 2:142480812-142480834 GCCAGGGCATAGAAAGGTATTGG - Intergenic
939676436 2:145078197-145078219 CAGAGGACATGGAAAGAGATGGG - Intergenic
941163785 2:162063783-162063805 AAGAGAGCAGAGAAAGGGAGTGG + Intronic
947936900 2:234013449-234013471 CAGAGGGCATAGAAATGAAAGGG - Intronic
1172115478 20:32571104-32571126 CAGCGGGCAGGGAATGGGATGGG + Intronic
1172258429 20:33539401-33539423 CAGAGGGCCTGAAAAGAGATTGG - Intronic
1172321176 20:33995963-33995985 CATAAGGCACAGAAAGGGGTGGG - Intronic
1174047879 20:47746598-47746620 CAGAGGGGAGAGAAAGGCCTGGG + Intronic
1174257048 20:49264548-49264570 CAAAGGTCATACCAAGGGATTGG + Intronic
1175711822 20:61227372-61227394 CAGAGGGGACAGACAGTGATGGG - Intergenic
1176733830 21:10524180-10524202 GAGAGGGCAGAGGATGGGATGGG - Intronic
1179222638 21:39422808-39422830 TAGAGGGCACAGAAAGGGAGTGG - Intronic
1180561581 22:16619655-16619677 CAGAGGGCAGAGGATGGGATGGG - Intergenic
1180793134 22:18588096-18588118 CAGAGGGCATGGCAAGGGCACGG - Intergenic
1181228603 22:21407222-21407244 CAGAGGGCATGGCAAGGGCACGG + Intergenic
1181250046 22:21527643-21527665 CAGAGGGCATGGCAAGGGCACGG - Intergenic
1182035106 22:27192298-27192320 CACAGGGGAAAGAAAGGGAGAGG + Intergenic
1182575680 22:31271342-31271364 CAGAGGACAGAGAAGGGCATTGG - Intronic
1182647518 22:31822401-31822423 CATAGGGCATAGGGAGGCATAGG + Intronic
1183055890 22:35305318-35305340 CAGAGGTCATATATAGGGACAGG + Intronic
1184690222 22:46114115-46114137 GAGAGGGCAGAGAACGGGCTGGG - Intergenic
949419258 3:3848352-3848374 CAAAGGGCAGAGGGAGGGATGGG + Intronic
952084212 3:29798018-29798040 CTGAGGACAAAGAAAGAGATGGG + Intronic
953076164 3:39572369-39572391 CAGAGGGCATAGGCAGAAATGGG + Intergenic
953926638 3:46985945-46985967 CAGAGGGCAGAGAATGGCAGGGG - Intronic
954628216 3:52034499-52034521 CCGAGGGCCTAGAGAGGGAGGGG + Intergenic
955141855 3:56277582-56277604 CAGTGGGAATAGACAGGGAAAGG - Intronic
955403035 3:58607158-58607180 GAGAGGGAATAGAAATGGACAGG - Intronic
956497188 3:69840366-69840388 CAGAGGTCTTTGAAAGGGACAGG + Intronic
956506112 3:69942086-69942108 CAGAGGAAACAGAAAAGGATTGG - Intronic
956603691 3:71050260-71050282 CAGAGGGCACATAAAGAAATGGG - Intronic
957259902 3:77887428-77887450 AAGAAGGCATTGAAAGGAATAGG - Intergenic
957349055 3:78999540-78999562 CAGAGGGGAAAGGAAGGGAAAGG + Intronic
957946219 3:87066789-87066811 CTGTGGGCATAGTAAGGGTTTGG + Intergenic
958674686 3:97252608-97252630 CACAGGGCAGGGATAGGGATTGG + Intronic
959974433 3:112442530-112442552 TAGAGGGCAGAGAGAGGGAGGGG + Intergenic
960857605 3:122119209-122119231 CAGAGGGCATGGGAAGGGCCAGG + Intronic
961993504 3:131217020-131217042 CAGAAGTCATAGAGAGGGAAGGG - Intronic
962865898 3:139447923-139447945 CAGAGGGAAGAGGAAGGGAGAGG - Intergenic
966319593 3:178686425-178686447 CACAGGGCACAGAGAGGAATTGG - Intronic
966463760 3:180205563-180205585 AAGAGGACATAGAGAGGGATAGG + Intergenic
967246985 3:187497833-187497855 CAGAGGGAACAGAAAGGGGTAGG - Intergenic
968038196 3:195566580-195566602 CAGAGGGGAGAGAAAGAGAAAGG - Intergenic
969841877 4:9888783-9888805 CAGAGGGCAGACAGAGGAATGGG + Intronic
969875585 4:10133561-10133583 CAGAGGGCATGGATGGGGGTGGG - Intergenic
971891613 4:32530641-32530663 GAGAAGGCAGAGAAAGAGATAGG + Intergenic
972074786 4:35073358-35073380 TAGAGGGGAAAGAAAGGGAGGGG - Intergenic
972953023 4:44352752-44352774 CAGAATGCATAAAAAGGTATAGG + Intronic
973619119 4:52710106-52710128 CAAAGGGAAAAGAAAGGGAGAGG + Intergenic
973943161 4:55931088-55931110 CAGAGGGGCTGGAAAGGGACAGG - Intergenic
974246255 4:59322775-59322797 CAGAGTGCATAGTATGTGATGGG - Intergenic
975258848 4:72272354-72272376 CACAGGGCCTAGAAATAGATAGG - Intergenic
976266603 4:83191040-83191062 CTGAGGGCCTGAAAAGGGATGGG + Intergenic
977263735 4:94829673-94829695 AAGAGTGCATAGAAATGGAGAGG + Intronic
978378056 4:108096167-108096189 CAGAGGTCAAATAGAGGGATGGG + Intronic
978397423 4:108296237-108296259 CAGAGGGCATAGCAAATGACTGG + Intergenic
979383467 4:120036126-120036148 CATAGGGCATAGTGAGGGGTTGG - Intergenic
981122003 4:141062823-141062845 TAGAGGGCGGAGAAAGGGAGGGG - Intronic
982884067 4:160756073-160756095 CAGATGGTATAGAAATGAATAGG - Intergenic
983730381 4:170985978-170986000 CAGAGGGCATAGTACCTGATAGG + Intergenic
984106116 4:175548470-175548492 CGGAGGACATAGAAAAGTATAGG + Intergenic
984158125 4:176217071-176217093 CAGTGGGGATAGAAAAGGAAAGG + Intronic
984242702 4:177236809-177236831 CAGAGGGAACAGCAAGGGACTGG + Intergenic
984522556 4:180818858-180818880 CAGAAGGAAGAGAAAGGGAGCGG - Intergenic
984560825 4:181267368-181267390 TAAAGGGCATAGAAAGTGCTGGG - Intergenic
984666361 4:182433548-182433570 CAGAGGGCAGAAAAAGGGTAGGG + Intronic
985018792 4:185665605-185665627 CAGATGGCATAGAATTGGTTTGG + Intronic
985706350 5:1403432-1403454 GAGAGGGGATAGAACAGGATGGG - Intronic
987165503 5:15194090-15194112 CAGAGGGCAGAGAAGCTGATTGG - Intergenic
987638531 5:20579311-20579333 CGCAAGGCATACAAAGGGATAGG + Intergenic
988065979 5:26229176-26229198 CAGAGGGCACAGCAAGGCAAAGG - Intergenic
988511711 5:31869843-31869865 CTGAGGGCAGAGAGAGGGGTGGG + Intronic
988673496 5:33407310-33407332 CAGAGGGGATAGTCAGGGATGGG + Intergenic
989240416 5:39196658-39196680 CAAAGGCCACAGAAAGGGAGAGG + Intronic
989743787 5:44803656-44803678 AAGAGGGCATAGAATCTGATAGG - Intergenic
991419296 5:66425145-66425167 CAGAAGGCAGTAAAAGGGATAGG + Intergenic
992259860 5:74958776-74958798 CAGAGAGGATGGAAAGGGTTTGG + Intergenic
993129269 5:83875178-83875200 CACAGGGCATATCAAGGGGTGGG + Intergenic
994272543 5:97798109-97798131 CAGATAGCAGAGAAAGAGATTGG + Intergenic
994510040 5:100690860-100690882 GAGAGGGCAGAGGAAGGGAGGGG - Intergenic
996160153 5:120151954-120151976 CTCAGGGCATTGAAAGGGATGGG - Intergenic
996166266 5:120227710-120227732 TAGAAGGCAGAGAAAGAGATAGG - Intergenic
996250633 5:121327105-121327127 CACAAGGCAAATAAAGGGATTGG - Intergenic
1000364265 5:160476518-160476540 CAGAGGGCAGAGAGAAGGAGTGG + Intergenic
1002074063 5:176697716-176697738 CAGATGGCAGAGAAAGGTCTCGG + Intergenic
1002823737 6:753939-753961 CAGATGGCATGGAAGGGGTTTGG - Intergenic
1004681464 6:17899405-17899427 CAGAGGGCACGGAAAGGTATAGG + Intronic
1005104419 6:22207784-22207806 CTGAAGACATAGCAAGGGATTGG - Intergenic
1005507687 6:26484035-26484057 TGGAGGGAATAGAAAGGGGTTGG + Intergenic
1005962203 6:30702396-30702418 CCTATGGTATAGAAAGGGATAGG - Intronic
1006915001 6:37588322-37588344 CAGGGGGCTTAGGGAGGGATGGG - Intergenic
1007735508 6:43979863-43979885 CAGAGGTCAGAGTAAGCGATGGG + Intergenic
1010585807 6:77657773-77657795 CAGAGAGCATATAATGGCATAGG - Intergenic
1011125931 6:84007839-84007861 CAGATGGCATGGGAAGGCATAGG + Intergenic
1011292885 6:85794760-85794782 CAGAGGCCATAGAGAGGATTTGG - Intergenic
1011541705 6:88437456-88437478 CTGATGGCATAGAAGGGAATGGG + Intergenic
1013018142 6:106180040-106180062 CAGATGGAATAGAAAGGGAGAGG + Intergenic
1013251841 6:108342171-108342193 CAGAGGGCATAGAAAGGGATGGG - Intronic
1014846766 6:126287310-126287332 CACAGGGCAGAGAAATGGTTTGG - Intergenic
1015516807 6:134090486-134090508 CAGAGGTCATACAAAGGAAGAGG - Intergenic
1016044821 6:139470312-139470334 CAGAGGACATAGAGAGGCAAAGG + Intergenic
1016219644 6:141652167-141652189 AAAAGGGGATAGAAAGGGATTGG + Intergenic
1017294925 6:152782576-152782598 AAGAGGCCACAGAAAGGAATGGG - Intergenic
1017742043 6:157415304-157415326 CAAAGGGCTTTGCAAGGGATAGG + Intronic
1018361127 6:163069710-163069732 AAGAAGGCAGAGAAAGAGATGGG + Intronic
1018566960 6:165164273-165164295 CAGAGGGCTCAGAAAAAGATAGG - Intergenic
1019309448 7:353112-353134 CAGGGGGCAGAGAGAGGGACAGG - Intergenic
1019309557 7:353461-353483 CAGGGGGCAGAGAGAGGGACAGG - Intergenic
1019309588 7:353579-353601 CAGGGGGCAGAGAGAGGGACAGG - Intergenic
1019372284 7:668866-668888 AAGAGGGCACAGAAAGGAATGGG + Intronic
1019446278 7:1073262-1073284 CAGAGGGCAGCGGAAGGGAAGGG + Intronic
1019853592 7:3583044-3583066 CAGAGGGCAGGGGTAGGGATGGG + Intronic
1021422278 7:20459333-20459355 CAAAAGGAATAGAAAGGGTTGGG + Intergenic
1021938277 7:25653140-25653162 AAGAGGTCAAAGAAAGGGCTGGG + Intergenic
1022148727 7:27576100-27576122 AAGACAGCAGAGAAAGGGATGGG + Intronic
1023191049 7:37583470-37583492 CAGAGGGGAAAGAAAGTGATGGG + Intergenic
1024572975 7:50739830-50739852 AAGAGGGAATAGAAAGAGAAAGG - Intronic
1024585940 7:50842314-50842336 CAGTGGGCAGAGGAAAGGATAGG + Intergenic
1025109115 7:56197980-56198002 CAGAGGGCGTTGAAAAGAATTGG + Intergenic
1025149472 7:56537637-56537659 GAAGGGGCATAGAAACGGATGGG + Intergenic
1026133564 7:67640284-67640306 AAGAGGGGATAGAAAGGGATAGG + Intergenic
1026366082 7:69649942-69649964 AAAAGGGCAGAGAAAGGAATAGG - Intronic
1026618226 7:71926591-71926613 CAGAAGGATTAGAAAGAGATAGG - Intronic
1028179778 7:87705474-87705496 CAGACAGCAGAGAAAGGGAATGG - Intronic
1028598831 7:92578587-92578609 CAAAGAGCATATTAAGGGATAGG + Intronic
1028979450 7:96951184-96951206 CAGAGGGCAGAGAAGGCGAGAGG - Intergenic
1030390709 7:108924677-108924699 AAGAGGGGATAGAGAGAGATGGG - Intergenic
1030743657 7:113139256-113139278 CAAAGGGCATAGATAGTGAAAGG - Intergenic
1032562987 7:132911923-132911945 AAGAGGGCATAGAAAGGACATGG - Intronic
1032786631 7:135205887-135205909 CAGAGGGCAAAGAAAAGGAAAGG + Intronic
1033242002 7:139688155-139688177 CAGAGGGCAAGAAGAGGGATGGG - Intronic
1033598333 7:142871835-142871857 CTGAGGGCATAGGAAGGGACAGG + Exonic
1034878892 7:154748956-154748978 AGGATGGCATGGAAAGGGATGGG + Intronic
1034940056 7:155224845-155224867 CACAGGGCACAGAATGGGACAGG - Intergenic
1035114666 7:156514631-156514653 CAGAGGACAAAGAATGGGAATGG - Intergenic
1035285920 7:157807226-157807248 AAGAGGGCACGGAAAGGGCTGGG - Intronic
1035990469 8:4484411-4484433 CAGAAGACACAGAGAGGGATGGG + Intronic
1036224165 8:6944119-6944141 CAGAGGGCATACAAAGGCCCAGG - Intergenic
1036962573 8:13261340-13261362 CAGAGTGTATAGAATGGGAAAGG + Intronic
1038253237 8:25925982-25926004 AAGAGGGCATATCAAGGAATTGG - Intronic
1038482678 8:27912651-27912673 CAGAGAGGAGAGAAAGGGGTGGG - Intronic
1039481429 8:37876282-37876304 CAGAGGGCTTAGAAATAGAGAGG + Intronic
1041071645 8:54131345-54131367 AAGAGGGCATGGAAAGGGGCTGG - Intergenic
1041948362 8:63472707-63472729 AAGAGGTTATAGAAATGGATTGG - Intergenic
1044138985 8:88624551-88624573 GAGAGAGCATAGAAAGGAAGGGG - Intergenic
1044562660 8:93628186-93628208 AAGAGGACATCGAAAGGAATTGG + Intergenic
1044935565 8:97290444-97290466 CAGTGGGGAAAGACAGGGATGGG + Intergenic
1045384342 8:101656963-101656985 AAGAGGCTAGAGAAAGGGATAGG + Intronic
1045702152 8:104879622-104879644 CAGAGTGCATAGAAATGAAAAGG - Intronic
1045776487 8:105809493-105809515 CTGAGGGAGTTGAAAGGGATTGG + Intergenic
1045780996 8:105863584-105863606 CAGTGGGCTTAGCAAGTGATAGG + Intergenic
1045822005 8:106349754-106349776 GAGAGGGAAAGGAAAGGGATGGG + Intronic
1047230126 8:122990779-122990801 GGGAGGCCCTAGAAAGGGATTGG - Intergenic
1048151668 8:131900901-131900923 CAGAGGGGATAGAAAGGGGAAGG + Intergenic
1048633111 8:136266036-136266058 CAGATATCACAGAAAGGGATGGG + Intergenic
1049543853 8:143220603-143220625 CAGAGGGGAGAGAAGGGGAAGGG - Intergenic
1052453255 9:28660624-28660646 GAGAAGTCAGAGAAAGGGATTGG + Intronic
1053361348 9:37488816-37488838 GAGAGGGAATAGGAAAGGATAGG - Intronic
1054938612 9:70715724-70715746 CAGAGGGGTTAGGAAGGGGTGGG - Intronic
1054940303 9:70733717-70733739 CAGAGGGGTTAGGAAGGGGTGGG - Intronic
1058142500 9:101372147-101372169 AAGAGGACAGAGAGAGGGATGGG + Intronic
1059299540 9:113300952-113300974 CAGAGGAGATAAAAGGGGATGGG + Intronic
1059778140 9:117497506-117497528 CACAGGGCATATAAAGAAATAGG - Intergenic
1060279103 9:122204106-122204128 CAGCGGGGATAGACAGGGAATGG - Exonic
1060771091 9:126332707-126332729 GAGAGGGCACATAAAGGGGTGGG - Intronic
1061378567 9:130240616-130240638 CAGTGGGCATGGAAAGGGGCTGG + Intergenic
1061623155 9:131824669-131824691 CTGAGGGCAGAGACAGGGACAGG - Intergenic
1061718301 9:132535099-132535121 CAGTGGACAGAGATAGGGATAGG + Intronic
1061844906 9:133382095-133382117 GGGAGGGCATGGAAAGGGAAGGG - Intronic
1062205000 9:135331413-135331435 GAGAGAGCAGAGAAAGAGATGGG + Intergenic
1185913065 X:4003801-4003823 CAGAAGGCCTAGAAATGGTTAGG - Intergenic
1186173147 X:6898664-6898686 CAGGCGACACAGAAAGGGATGGG + Intergenic
1186434214 X:9529204-9529226 CAGAGGACACAGAAAGCAATGGG - Intronic
1187144210 X:16622766-16622788 CAGAGGTGACAGAAAGGGGTAGG + Intronic
1187144693 X:16626767-16626789 CAGAGGTCACAGAAGGGGAAGGG - Intronic
1187144725 X:16626916-16626938 CAGAAGGTATAGAATGGGAGTGG - Intronic
1187718663 X:22129638-22129660 CAGAGGGCAAAGGAGGTGATGGG - Intronic
1188018510 X:25130800-25130822 AAGAGGCCATAGAATGGAATGGG + Intergenic
1188060763 X:25598696-25598718 CAGAGGAAATGGAAAGGGAAAGG + Intergenic
1188240906 X:27788547-27788569 GAGAGGGGATAAAGAGGGATTGG + Intergenic
1188577211 X:31666071-31666093 GAGAGGGTGTAGAAATGGATGGG + Intronic
1189143172 X:38627879-38627901 CAGAGGACTTAGCAAGGGCTGGG - Intronic
1189221585 X:39376703-39376725 CAGAGTGGGGAGAAAGGGATTGG + Intergenic
1189555807 X:42144134-42144156 GAGAGGGAATGGAAAGGGAGGGG + Intergenic
1190108111 X:47573375-47573397 AGGAGGGCATAGAAAGGGCTTGG + Intronic
1190187664 X:48250100-48250122 CAGAGGGCAGAGGAAGAGGTAGG - Intronic
1190656554 X:52617870-52617892 CAGAGGGCAGAGAAAGAGGTAGG - Intergenic
1190661908 X:52662444-52662466 CAGAGGGCAGAGGAAGAGGTAGG - Intronic
1190854551 X:54280778-54280800 GAGAGGGGAGAGAAAGGGATGGG + Intronic
1192908464 X:75578315-75578337 CACAGGAAATAGAAAGGGAGGGG - Intergenic
1195750718 X:108160368-108160390 CAGTGGACCTAGAAAGGGCTGGG + Intronic
1196013721 X:110915531-110915553 CAGAGGGAAGAGAAATGGAAAGG - Intergenic
1196265745 X:113644144-113644166 CAGTGGGAATAGAGAGGTATAGG - Intergenic
1197384151 X:125782764-125782786 CAGAGGAAACAGAAAGGGATGGG - Intergenic
1198522157 X:137463921-137463943 CACAGTGCATAGACAGGGGTTGG - Intergenic
1198785295 X:140281945-140281967 CAGAAGGTAGAGAAAGAGATAGG - Intergenic
1199230478 X:145431770-145431792 CAGTGGCCATAGAAAGGCATAGG - Intergenic
1199989080 X:152974475-152974497 CAGAGGACATAGAGATGCATGGG - Intergenic
1202087015 Y:21148954-21148976 CAGAGGAAATAGAAAGGGATGGG + Intergenic
1202366680 Y:24170595-24170617 CAGAGGGCTTAGACAGTGAGGGG + Intergenic
1202373724 Y:24214887-24214909 CAGAGGGCTTAGACAGTGAGGGG - Intergenic
1202497057 Y:25455233-25455255 CAGAGGGCTTAGACAGTGAGGGG + Intergenic
1202504102 Y:25499528-25499550 CAGAGGGCTTAGACAGTGAGGGG - Intergenic