ID: 1013251843

View in Genome Browser
Species Human (GRCh38)
Location 6:108342176-108342198
Sequence CAGGACAGAGGGCATAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013251843_1013251852 18 Left 1013251843 6:108342176-108342198 CCCTTTCTATGCCCTCTGTCCTG 0: 1
1: 0
2: 2
3: 40
4: 410
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251843_1013251850 4 Left 1013251843 6:108342176-108342198 CCCTTTCTATGCCCTCTGTCCTG 0: 1
1: 0
2: 2
3: 40
4: 410
Right 1013251850 6:108342203-108342225 CTGCAAGGAATGCCTCCCACAGG 0: 1
1: 0
2: 0
3: 31
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013251843 Original CRISPR CAGGACAGAGGGCATAGAAA GGG (reversed) Intronic
900090216 1:917015-917037 GAGGACAGAGGGCTCAGGAAGGG + Intergenic
901056247 1:6449831-6449853 CAGGACAGAGTGCCTAGATGTGG + Intronic
901874942 1:12162059-12162081 CAGGACTGAGGGACAAGAAAAGG + Intergenic
902058360 1:13620904-13620926 CTGGGCAAAGGGCATAGCAAAGG + Intergenic
902247052 1:15127934-15127956 AAGGACAAGGGGCATGGAAAAGG - Intergenic
902337634 1:15762969-15762991 CAAGAGAGAGGACATAGGAAGGG + Intronic
902666083 1:17939509-17939531 CAGGACAAATGGCAAGGAAATGG - Intergenic
902739254 1:18423403-18423425 CAGTGGAGAGGGCATAGAAGAGG - Intergenic
903677957 1:25077151-25077173 CAGGTCAGAGCACAGAGAAATGG - Intergenic
904237879 1:29125598-29125620 CAGGACAGTGGCCATGGGAAAGG - Intergenic
904585297 1:31576672-31576694 CAAGACAGATGGCAGAGAGAGGG + Intronic
904682844 1:32240957-32240979 CAGGACTGAGGGGCTGGAAAGGG - Intergenic
904973318 1:34435733-34435755 CAGGAAAGGGGCCATAGAAATGG - Intergenic
905719695 1:40186581-40186603 AAGGACAGAGTGCATACAGATGG - Intronic
905963590 1:42067497-42067519 CAGGATAGAGAGTGTAGAAATGG + Intergenic
906123990 1:43415263-43415285 AAGGACAGAGGGCAGAGAGGAGG + Intronic
906728399 1:48060598-48060620 CAGGACTGGGGCCATTGAAATGG - Intergenic
906744014 1:48208902-48208924 CAGGGCAGAGGGCATGGAAGGGG - Intergenic
907090960 1:51724914-51724936 CAGGATAAATGGCATAAAAATGG - Intronic
908052869 1:60251502-60251524 CAGGGCAGAGGGTGTAGGAATGG + Intergenic
908111139 1:60898680-60898702 CAGGACTGAGGGGAGAGAATGGG + Intronic
908625299 1:66033653-66033675 CAGGAAAGAAGCCAGAGAAAGGG + Intronic
908627928 1:66067762-66067784 CAGGACATAGGACATAGGCATGG - Intronic
910273944 1:85428323-85428345 CATGGCAGAAGGCAAAGAAAAGG + Intronic
910594828 1:88969183-88969205 CTGGACATATGGCAGAGAAAAGG - Intronic
911002226 1:93178926-93178948 CAGTACAGGGGGGAAAGAAAAGG - Intronic
911708463 1:101041717-101041739 CAGGAGAGAGGGGGTAGAAGGGG + Intergenic
911739068 1:101367775-101367797 CAGGACAGAGGACATACACTGGG + Intergenic
912037647 1:105340907-105340929 AAGGATAAAGGGCAAAGAAAGGG - Intergenic
912475506 1:109932112-109932134 CAGGGGTGAGGGCACAGAAAGGG - Intergenic
913438336 1:118870783-118870805 CTGCACAGAGGGCATGGGAAGGG - Intergenic
913635674 1:120758135-120758157 CAGGAAAGAGGGCATAAACTGGG + Intergenic
914283038 1:146194853-146194875 CAGGAAAGAGGGCATAAACTGGG - Intronic
914361652 1:146940884-146940906 CATGAAAGAGGACATATAAATGG - Intronic
914544068 1:148645571-148645593 CAGGAAAGAGGGCATAAACTGGG - Intronic
914622557 1:149425439-149425461 CAGGAAAGAGGGCATAAACTGGG + Intergenic
915135827 1:153730788-153730810 AAGGACAAAGGGCAAAGAAGGGG - Intronic
915489632 1:156243974-156243996 CAGGAGAGAGGGCAGAGAAGAGG - Exonic
916326334 1:163564199-163564221 CAGGACAGAGGGGCAAGACAGGG - Intergenic
916473792 1:165149040-165149062 CAGGAAAGATGCTATAGAAATGG + Intergenic
917047180 1:170874116-170874138 CAGGACAGATGGGAAAGAATAGG - Intergenic
917251435 1:173066350-173066372 CTGGAGAGAGTGCAGAGAAAAGG + Intergenic
918673237 1:187247592-187247614 CAGAATAGAGAGCCTAGAAATGG + Intergenic
919775824 1:201193351-201193373 CAGGACAGAGAGGAGAGAAGTGG + Intronic
919970643 1:202575291-202575313 CAGGACTGAGATCATAGAATGGG + Intronic
921222529 1:212983385-212983407 CATGACAGAGGGCAAAGAGAGGG + Intronic
921426268 1:215004405-215004427 CAGAAAAGAGGGCATAGGAAGGG + Intergenic
922155633 1:223038159-223038181 CAGGACAGAGGACAGAGAAGGGG + Intergenic
922387316 1:225099826-225099848 CATGACAGAGGGCATGCAAGAGG + Intronic
922479389 1:225928457-225928479 CAGGACAGAGGGGAGTGAAGAGG - Intergenic
922619135 1:226979793-226979815 GAGGACGGAGGGCTTAGCAAGGG + Intronic
922919275 1:229287779-229287801 CAGGGCAGAGGGTAGATAAATGG - Intronic
923041584 1:230323623-230323645 GAGGACAGAGGGAATAAGAACGG + Intronic
923361164 1:233212550-233212572 CAGGGAAGAGGGCAGTGAAATGG + Intronic
923376909 1:233373319-233373341 CAGGAAAGAGGGCAGAGGAGTGG - Intronic
923500647 1:234560952-234560974 CAGGCCTGAGGTCATGGAAAGGG + Intergenic
923793990 1:237135860-237135882 CAAGAGAGAGGGCAGAGAAGAGG + Intronic
923910851 1:238442166-238442188 CAGCACAGAGGACATAGGATGGG + Intergenic
924099361 1:240587928-240587950 CAGGCTGGAGGGCACAGAAATGG - Intronic
924736253 1:246759479-246759501 AAGGAGAGAGGGGACAGAAAGGG - Intronic
1062862132 10:818678-818700 AAGGACACATGGCACAGAAAGGG + Intronic
1063572660 10:7230504-7230526 CAGGACAAAGGGCCTGGAACTGG + Intronic
1064268241 10:13842223-13842245 CAGGAAGGAGAGCATAGAAATGG - Intronic
1064285725 10:13989740-13989762 CAAGACAGAGGGCAGAGAGATGG + Intronic
1064804332 10:19113514-19113536 GAGGACAGAGGGGAGAGGAATGG - Intronic
1065134570 10:22655135-22655157 CAGGACAGAGGACATACACAAGG + Intronic
1068478296 10:57556422-57556444 TTGGAGAGAGGGCATAGAAAAGG + Intergenic
1069904006 10:71721739-71721761 CAGGACAGGGAGTATAGACATGG - Intronic
1070596868 10:77838583-77838605 AGGGAGAGAGGGCATAGAGAAGG + Intronic
1070721555 10:78760716-78760738 CAGGGCAGAGGGCAAACAGAGGG + Intergenic
1071904030 10:90153269-90153291 CAGGACATCAGGCATACAAATGG - Intergenic
1072354576 10:94594719-94594741 CAGGATAGATGTCATAGAATTGG + Exonic
1072787155 10:98291714-98291736 AGGGGCAGAAGGCATAGAAATGG + Intergenic
1072866184 10:99064507-99064529 AAGGAGAGAGGGCATAGAGGAGG - Intronic
1073762673 10:106647534-106647556 CAGAATAGAGTGCCTAGAAATGG + Intronic
1073867554 10:107822341-107822363 CAAGACAGATGGCATTGAATTGG + Intergenic
1074260717 10:111850801-111850823 CAGGACATATGGCATAGAGTTGG - Intergenic
1074942674 10:118250285-118250307 CTGGACAGAGGGGAGAGAGAGGG - Intergenic
1075846431 10:125548751-125548773 AAGGAGAGAGGGTATAGCAAGGG - Intergenic
1076084346 10:127612155-127612177 CAGGAGAGAGAGCACAGAAGGGG - Intergenic
1076233415 10:128842070-128842092 CAGGTTAGAGAGCAAAGAAAGGG + Intergenic
1077340692 11:2025071-2025093 GAGGAGAGAGGGCACAGGAACGG - Intergenic
1077451861 11:2653247-2653269 CAGGGCAGAGGGCAGGGAGAAGG - Intronic
1077776753 11:5280651-5280673 CAGGGCAGATGGCAAAAAAAAGG - Intronic
1078049300 11:7947822-7947844 CAGGAGAGAAGGCAGAGTAAAGG + Intergenic
1078520125 11:12056173-12056195 CAGGCTTGAGTGCATAGAAATGG + Intergenic
1078623081 11:12926662-12926684 CTGCAGAGAGGGAATAGAAAGGG + Intronic
1078898412 11:15618779-15618801 GAGGAAAGAGCCCATAGAAAGGG - Intergenic
1081206437 11:40280998-40281020 AAGGACAGAGGGAGGAGAAAAGG + Intronic
1081646840 11:44796003-44796025 AAGGCCAGAGGGCACAAAAAAGG - Intronic
1081845471 11:46237935-46237957 GAGGACAGAGGGGGAAGAAACGG + Intergenic
1082229540 11:49746183-49746205 CAAGAGAGAGGGCATAGGCAAGG + Intergenic
1083629225 11:64087254-64087276 CTGCACAGAGGGCATGGAACTGG - Intronic
1083641194 11:64146296-64146318 CAGGACTGAGGTCATAGGCAAGG + Intronic
1083901246 11:65644562-65644584 CCGGGAAGAGGGCACAGAAATGG + Intronic
1084148762 11:67278471-67278493 CAGGGCAGGGGGCATGGAACGGG - Intronic
1084283884 11:68119329-68119351 AAAGACAGTGGGCACAGAAAAGG + Intronic
1085346349 11:75770471-75770493 AAGGACACAGGGAACAGAAAAGG - Intronic
1085571119 11:77558793-77558815 CAGGTCAAAGGGGATAGAAAGGG - Intronic
1086194215 11:84117523-84117545 GAGGAAAGAAGGCTTAGAAATGG - Intronic
1086431650 11:86742266-86742288 CAGGACAGAGGTCCCACAAAGGG - Intergenic
1086620540 11:88882938-88882960 CAGGAGAGAGAGCATAGGCAGGG - Intronic
1086907918 11:92438707-92438729 CAGGACAGTTGCAATAGAAATGG + Intronic
1087597087 11:100267945-100267967 TATGACAGAGGTCATAAAAATGG + Intronic
1088814074 11:113409813-113409835 AAGGCCAGAAGGAATAGAAAAGG + Exonic
1089221585 11:116876441-116876463 CAAGCCAGAGGGCATGGAACAGG - Intronic
1089495041 11:118903456-118903478 CAGGAGAGAGGACAGGGAAAGGG + Intronic
1089534354 11:119151408-119151430 GAGGGCAGGGGGCAGAGAAAGGG - Intronic
1090263109 11:125335894-125335916 CAGGGCAGAGGACATGGAAGTGG + Intronic
1090268246 11:125368294-125368316 CAGGACACAGGGCGAGGAAAGGG - Intronic
1090456635 11:126855825-126855847 GAGCCCAGAGGGCATAGAGATGG - Intronic
1091134090 11:133172331-133172353 CAGCACCGAGTGCTTAGAAAAGG + Intronic
1091160009 11:133411447-133411469 CAGGCCAGAGGTCATGGGAAAGG + Intronic
1202823677 11_KI270721v1_random:80260-80282 GAGGAGAGAGGGCACAGGAACGG - Intergenic
1091538389 12:1435497-1435519 CAGGACAGAAGGCACTAAAAGGG - Intronic
1091645422 12:2269005-2269027 CAGGACAGTGGGCAGAGAGCCGG - Intronic
1092458897 12:8669707-8669729 CAGGACAGAAGGAAGAGACATGG + Intergenic
1093133579 12:15421409-15421431 AAGGAGAGAGGGAATAGGAAGGG + Intronic
1093746911 12:22752439-22752461 CAGGAAAGAGGGCAATAAAAAGG + Intergenic
1096008101 12:48188323-48188345 GAGGACAGTGGGCATAAGAAGGG - Intergenic
1096312990 12:50537935-50537957 CGGGAATGAGGACATAGAAATGG + Intronic
1096530831 12:52241806-52241828 CAGGGCAGAGGAAATAGATATGG + Intronic
1096568943 12:52507756-52507778 CAGCACAGAGGGGAAACAAAGGG - Intergenic
1097388935 12:58985124-58985146 CAGGACAGAAGGGATAGAGATGG + Intergenic
1097470092 12:59979062-59979084 CAGGACAAAGGGATTACAAAAGG - Intergenic
1098928862 12:76385915-76385937 AAGGGCAGGGGGCATAGCAAAGG + Intronic
1099017057 12:77356585-77356607 CAGCTCAAAGGGCATAGAAGTGG + Intergenic
1099321378 12:81154465-81154487 CAAGCCAGAGGGCAGAGAAAAGG - Intronic
1099636036 12:85212958-85212980 CAGTACAGATGGCATATAGAAGG + Intronic
1100238987 12:92691261-92691283 CAGGTCAGAAGGCACACAAATGG - Intergenic
1101772240 12:107761664-107761686 GAGAACTGAGGGCAGAGAAAAGG - Intergenic
1102173528 12:110859971-110859993 CTGGAGAGGGGGCACAGAAAAGG - Intronic
1102898115 12:116614824-116614846 CTGGTCAGAGGAAATAGAAAAGG + Intergenic
1104387892 12:128366536-128366558 CAGGAAACAGGGCATGGAAATGG + Intronic
1105056683 12:133107032-133107054 CAGGACAGAAAGCATGGACAAGG + Exonic
1106323493 13:28664747-28664769 CAGGTAAGAACGCATAGAAAGGG - Intronic
1107189438 13:37561561-37561583 CAGCACAAAGGACCTAGAAAGGG - Intergenic
1108145354 13:47471131-47471153 AAGGACAGAGGGGAAACAAAAGG - Intergenic
1108326288 13:49334873-49334895 CATGAAAGAGTGCACAGAAATGG - Intronic
1109022771 13:57119338-57119360 CAGGAGATAAGGCCTAGAAAAGG + Intergenic
1109371468 13:61425656-61425678 CAGGACAAAGTGCAGAGAAATGG - Intronic
1109404819 13:61883919-61883941 CAGCAGAGAGGTCATAGAGAAGG - Intergenic
1109691382 13:65895215-65895237 AATTACAGAGGGCAGAGAAAAGG - Intergenic
1109928203 13:69175773-69175795 CAGGAGAGTGGGGAGAGAAAGGG + Intergenic
1110879088 13:80548285-80548307 CAGAACAAAGGGCATACGAAGGG - Intergenic
1113619077 13:111700933-111700955 CAGGCCAGAGGGCAAGGAGAGGG + Intergenic
1113624606 13:111786194-111786216 CAGGCCAGAGGGCAAGGAGAGGG + Intergenic
1114189319 14:20428983-20429005 CAGGACAGTAGGCATGGATAAGG + Exonic
1115620344 14:35134581-35134603 CAGGAGCTAGGGCCTAGAAAAGG + Intronic
1116556654 14:46319335-46319357 CAGAACAAATGGCAGAGAAAGGG + Intergenic
1116556886 14:46322417-46322439 CAGAACAAATGGCAGAGAAAGGG + Intergenic
1117118214 14:52538543-52538565 AAGGACAGAAGACATACAAAAGG + Intronic
1117940089 14:60954028-60954050 CAGAACAGAGAACCTAGAAAGGG - Intronic
1118319037 14:64742656-64742678 CAGAGCAGAGGGCATCAAAAGGG - Intronic
1119603882 14:75997842-75997864 CAGGACAGTGGGAATATAAGAGG - Intronic
1120430303 14:84404610-84404632 AAAGACAGATGGCACAGAAATGG - Intergenic
1121774509 14:96581994-96582016 CAGGAAAGAGGCCATTGGAATGG - Intergenic
1122145758 14:99688023-99688045 GAAGACAGAGGGCACAGAGAGGG - Intronic
1122601082 14:102922372-102922394 CAGCACACAGGACAGAGAAAGGG + Intergenic
1123780873 15:23627128-23627150 CAGGTAAGATGGGATAGAAATGG - Intronic
1123798699 15:23799158-23799180 CAGAATAGAGAGCTTAGAAATGG + Intergenic
1124982062 15:34575829-34575851 CAGGAGGGAGGGCATGGAAGGGG - Intronic
1127362788 15:58259815-58259837 GAGGACAGTGGGCACAGAAAGGG - Intronic
1127520560 15:59739336-59739358 CAGGGAAGAAGGCATAGAAATGG + Intergenic
1127651138 15:61008929-61008951 AAAGACACGGGGCATAGAAAGGG + Intronic
1127863717 15:63014765-63014787 AGGGTCAGAGGGCAAAGAAAAGG + Intergenic
1128267312 15:66278239-66278261 GAGCACAAAGGGCAGAGAAAAGG + Intergenic
1128730585 15:70018238-70018260 CAGGGCAGAGGGGATAGGAGGGG + Intergenic
1130909846 15:88263430-88263452 CAGGGCAGAGGCCACAGTAATGG - Intergenic
1130916097 15:88305954-88305976 AAGGAGAGAAGGCAAAGAAATGG + Intergenic
1130956411 15:88630277-88630299 CAGGACAGAAGGAATTGAGAAGG + Exonic
1131666467 15:94576404-94576426 GAGGAGAGAGAGCAAAGAAAGGG + Intergenic
1132477859 16:150927-150949 CAGAACAGAGAGCCCAGAAATGG + Intergenic
1133247988 16:4461875-4461897 CGGGTCTCAGGGCATAGAAACGG + Exonic
1133600792 16:7338235-7338257 GAGAAAAGAAGGCATAGAAACGG - Intronic
1133720623 16:8491157-8491179 CAGCTCCGAGGGCATACAAAAGG - Intergenic
1134003718 16:10803407-10803429 CAGGTCAGAGGGCAGTGAACAGG + Intronic
1135879511 16:26240521-26240543 CAGGAGCTAGGGCATAGAACAGG - Intergenic
1139591785 16:67936972-67936994 CAGCACAGAGGGCACAGCAAGGG - Exonic
1140304159 16:73787045-73787067 GAGGACAAAAAGCATAGAAAAGG - Intergenic
1140835802 16:78792513-78792535 CACGGCAGAGGGCATGGATAAGG + Intronic
1141119222 16:81338343-81338365 GGGGACAGAGAACATAGAAAAGG + Intronic
1141853310 16:86663123-86663145 CGAGACACAAGGCATAGAAAAGG - Intergenic
1142407464 16:89898734-89898756 CAGCACAGAGAGCAGAGCAAAGG - Intronic
1143346560 17:6253824-6253846 TAGGACAGATGGCGTAGACACGG + Intergenic
1144521722 17:15957111-15957133 CAGGGCAGAGGCCATGGAGATGG + Intronic
1145763174 17:27439432-27439454 CAGGAGAGAGGACATAGGAGGGG - Intergenic
1147765239 17:42830635-42830657 CAGGAAGGAGAGCACAGAAAGGG + Intronic
1148625162 17:49063646-49063668 CAGTGAAGAGGGCAGAGAAAAGG + Intergenic
1148808959 17:50278533-50278555 CTGGTCAGAGGGCACAGAAAAGG - Intronic
1149684673 17:58528536-58528558 CAGGACAGCAGGCATAGACTGGG - Intronic
1149871565 17:60186703-60186725 AAGGACAGAGAGCAAAGAATGGG + Intronic
1151497517 17:74467409-74467431 TGGGACAGAGGGGACAGAAAAGG + Intronic
1152812319 17:82387843-82387865 CAAGACAGAGGGGACAGAAGGGG + Intergenic
1152838119 17:82548437-82548459 CACTACAGATGACATAGAAATGG - Intronic
1155240181 18:23857246-23857268 CAGGACAGAGGGGCTGGACACGG - Intronic
1156458191 18:37306457-37306479 CAGGACAGGGGACACAGAATGGG + Intronic
1157116103 18:44864103-44864125 GAGGACAGAGGGGAAAAAAATGG + Intronic
1157496208 18:48159181-48159203 TAGGACAAGGGGAATAGAAAAGG - Intronic
1158239394 18:55360092-55360114 CAGGAGAGAGGACAAAGAAATGG + Intronic
1158806288 18:60977673-60977695 CAAGACAGAGTGCCTAGCAAAGG - Intergenic
1158924744 18:62243843-62243865 CAAGACAGATGGGAAAGAAATGG + Intronic
1159668892 18:71198800-71198822 CAAGACAGACTGCATTGAAATGG + Intergenic
1160210695 18:76875586-76875608 CAGGACAGAAGGCACAGGCATGG - Exonic
1160406111 18:78647342-78647364 CAGGACCCAGGGCTCAGAAATGG - Intergenic
1161730591 19:5958374-5958396 CAGGCCAGAGGGCAAAAAAAAGG + Intronic
1162792561 19:13070558-13070580 CAGGACAAAAGGCAGAGACATGG - Intronic
1163190941 19:15676111-15676133 CAGGACAAAAGGCAGAGGAAAGG - Intronic
1163477262 19:17533670-17533692 CAGGGCAGAGAGCATCCAAAAGG - Exonic
1164737121 19:30549744-30549766 CTGTACAGAAGGCATGGAAAAGG + Intronic
1166084285 19:40464931-40464953 CAGGAGAGAGGGCAGAAAAGGGG - Intronic
1166647498 19:44543036-44543058 CAGGCCAGAGGGAAGAGGAAAGG + Intergenic
1167535968 19:50051685-50051707 CAGGACATAGTGCATAGTTAAGG + Intronic
1168327663 19:55546430-55546452 CAGGCCTGAGGGCAGAGGAAAGG + Intergenic
925376855 2:3392342-3392364 CAGGACAGACGGCCTAGACAAGG + Intronic
925904164 2:8529423-8529445 CAGGAAAGAAGGCACAGAATGGG - Intergenic
925931254 2:8709771-8709793 AAGGACAAAGGGCATAGGAAAGG - Intergenic
926608242 2:14918910-14918932 CAGGACAGAAGGAATAGGGATGG + Intergenic
927518785 2:23687190-23687212 CAGGACAGAGGTCCCAGAGAAGG - Intronic
928243133 2:29603834-29603856 CAGGAAAGAGTGGATAGAAAAGG - Intronic
928986050 2:37182722-37182744 CAGGAGAGAGGAAACAGAAAGGG + Intronic
929298073 2:40270972-40270994 CAGGAGAGAGGGCATAGGCCAGG - Intronic
929779381 2:44948022-44948044 AAGGTCTGAGGGCATACAAAAGG + Intergenic
930135409 2:47898737-47898759 TAGGACAGATGGTATAGAACAGG + Intronic
932295231 2:70618699-70618721 CAAGTCAGAGGGCACAGCAATGG + Intronic
932388587 2:71362699-71362721 CAGGAGAGAACTCATAGAAAGGG - Intronic
933295815 2:80489955-80489977 CAGGTCCGAGGGGATGGAAAAGG + Intronic
934919536 2:98331761-98331783 CTGGATAGAGGGCTTAGAACAGG + Intronic
935156937 2:100491720-100491742 GAGGGCAGAGGGCATAGCAGAGG + Intergenic
935222080 2:101023815-101023837 GTGGACAGAGGACATTGAAATGG - Intronic
935363638 2:102268062-102268084 CAGGACAGAGGTCACATGAAGGG - Intergenic
937284452 2:120741416-120741438 CAGGACAGAAGAGAGAGAAAGGG - Intronic
937965781 2:127508672-127508694 CAGCACAGAGAGCTTAGAAAAGG + Intronic
938105103 2:128524719-128524741 CAGGACACAGGCCATATAGAGGG + Intergenic
938332423 2:130457234-130457256 TAGAACAGAGGCCACAGAAATGG - Intergenic
938357384 2:130663434-130663456 TAGAACAGAGGCCACAGAAATGG + Intergenic
939103558 2:137924129-137924151 CAGGGGAGAGGGCATCCAAAGGG + Intergenic
939663073 2:144914579-144914601 CAGGACAGAGGTGGTAGAAAGGG + Intergenic
939904878 2:147900223-147900245 GGGGACAGAGGGCAAAGACAGGG - Intronic
940498919 2:154469929-154469951 CAGGTCATAGGGGATATAAAAGG + Intergenic
941071437 2:160959268-160959290 AAGGTCAAAGGGCAGAGAAAGGG + Intergenic
941786121 2:169500441-169500463 CAGGACAGAGAGGACAGCAAGGG - Intronic
942013200 2:171785588-171785610 CAGCACAGATGCCATGGAAATGG - Intronic
944319283 2:198318601-198318623 CAGCAAAGAGGGTATAGATAAGG + Intronic
946306757 2:218860590-218860612 GACGACAGAGGGAATATAAAGGG + Intronic
946348816 2:219134187-219134209 CAGGAGAGAGGCCAAAGAGAAGG - Intronic
947646646 2:231746864-231746886 CAGGACAGAAGGCAACAAAAAGG + Intronic
948458282 2:238117318-238117340 CAGGACAGAGGGCATGTGACAGG + Intronic
1168956028 20:1834951-1834973 CAGGACAGAGAGCAAGGAGAAGG + Intergenic
1169152118 20:3297594-3297616 CAGCACAGATGGCATAGATGAGG - Intronic
1169349542 20:4856949-4856971 CAGGCCACAGGGCACAGCAAAGG + Exonic
1170056535 20:12211197-12211219 GAGGACAGAGGAGATAGCAAGGG - Intergenic
1170198008 20:13710628-13710650 AAAGACACAGGCCATAGAAAAGG + Intergenic
1170875683 20:20247838-20247860 CAGGATAGACCTCATAGAAAAGG - Intronic
1171981459 20:31632114-31632136 CAGGACAGGTGGCCTAGAGATGG - Intergenic
1172610846 20:36251442-36251464 CAGGACACAGGGCATAGTCTGGG - Intronic
1173524436 20:43721308-43721330 CAGGAGAGAGGACAGAGAAAGGG - Intergenic
1174152720 20:48497276-48497298 CAAGACAGAAGTTATAGAAAGGG + Intergenic
1174872304 20:54194415-54194437 GAGAACAGAGGGCATAGCATGGG + Intergenic
1174983198 20:55420602-55420624 TAGGACAGAGGGAATAGCCAGGG - Intergenic
1175457163 20:59124163-59124185 CAGAACCGAGGGAAAAGAAACGG - Intergenic
1175553150 20:59829837-59829859 CAGCACAGATGTCACAGAAAAGG - Intronic
1175710399 20:61216194-61216216 CAGGACAGAACACAAAGAAATGG - Intergenic
1175757013 20:61536300-61536322 CAGGGCTGAGGGCACAGACATGG + Intronic
1176159305 20:63640481-63640503 CAGGGCAGAGGGCACAGGAGGGG + Exonic
1177499455 21:21933512-21933534 CATGGCAGAAGGCAAAGAAAAGG - Intergenic
1177538003 21:22454296-22454318 AATGACAGAGGGCATTGAAAAGG + Intergenic
1177659918 21:24069328-24069350 CAGACTAAAGGGCATAGAAAAGG + Intergenic
1177995986 21:28098403-28098425 CAGGACAGGAGCCATTGAAATGG - Intergenic
1178387956 21:32170576-32170598 AAGGACATAAGGAATAGAAAGGG + Intergenic
1179972347 21:44843143-44843165 CAGGGCAGAAGACACAGAAACGG - Intergenic
1180911883 22:19456403-19456425 CAGGAGAGAGTGGATACAAAAGG + Intronic
1181032733 22:20156190-20156212 CAGGTTAGAGGGCACAGAGATGG - Intergenic
1181386049 22:22546631-22546653 CAGGACAGAGGCCTCAGAACAGG + Intergenic
1181482024 22:23206115-23206137 CAGGAAACAGGGAAGAGAAAGGG - Intronic
1181911439 22:26241412-26241434 CTGGACAGAGGCAAAAGAAAGGG + Intronic
1181935837 22:26437793-26437815 CAGGAAGGAGGGTAGAGAAAGGG - Intronic
1182072618 22:27474387-27474409 CAGGAGGGAGGGCAGAGGAAGGG + Intergenic
1182450119 22:30415044-30415066 CAGGAGAGGGGACAAAGAAAGGG - Intronic
1183111171 22:35649661-35649683 CAGGTCAGAGGGGATGGAATGGG + Intronic
1183343458 22:37294526-37294548 CAGGACAGAGGTCAGGGAGAGGG + Intronic
1183836464 22:40458138-40458160 TAGGACAGATGGCAGAGATAGGG - Intronic
1184580336 22:45412987-45413009 CAGGAGTGAGGGCAGAGAACAGG + Intronic
949285935 3:2404512-2404534 CAGGACAGATGAGGTAGAAAGGG - Intronic
949506188 3:4730147-4730169 TAGGTAAGAGGGGATAGAAAAGG - Intronic
950014813 3:9748037-9748059 CAGGGCAAAGGGGATACAAAGGG + Intergenic
950989062 3:17412148-17412170 TAGTACAGAGGGGAAAGAAATGG + Intronic
950989072 3:17412280-17412302 TAGTACAGAGGGGAAAGAAATGG + Intronic
952255118 3:31688324-31688346 CAGGAGAAAGGGCAGAAAAAGGG - Intronic
952870513 3:37896333-37896355 CAGGACAGAGGGCATCACCAAGG + Intronic
953235840 3:41105401-41105423 CAGAACATAGGACCTAGAAATGG - Intergenic
953679259 3:45027264-45027286 TAGGACCAAGGGCACAGAAAAGG + Intronic
953747609 3:45587046-45587068 CAGGAAAGAGGACATAGGGAGGG - Intronic
953927209 3:46988548-46988570 GTGGACAGAGGGCATGGACAAGG - Intronic
954903859 3:54043221-54043243 CATGGCAGAGGGCTTAAAAATGG - Intergenic
955339273 3:58112362-58112384 CAGCACCGACTGCATAGAAAGGG - Intronic
956808522 3:72841554-72841576 CTGGAGAGAGGGCAAAGTAATGG + Intronic
957946218 3:87066784-87066806 CAGGTCTGTGGGCATAGTAAGGG + Intergenic
960245341 3:115394061-115394083 AAGGACAGAGGGGAAAGAACTGG - Intergenic
960548465 3:118946005-118946027 GAGGGCAGAGGGCGTAAAAAAGG + Intronic
961083381 3:124045114-124045136 CTGGACAGTGGGCCTAGAAGGGG + Intergenic
961091696 3:124118252-124118274 CAGGACAGAGGGACTACAGATGG + Intronic
961703621 3:128766420-128766442 TAGGACAGAAGGCATAAAATTGG + Intronic
962581342 3:136800587-136800609 CCAGAGAGAGGGTATAGAAAGGG + Intergenic
963045506 3:141100029-141100051 CAGCACAGAGGGCAGAGCCATGG - Intronic
964737948 3:159935309-159935331 CAGGCAAGAGGGCATATGAAGGG + Intergenic
965517291 3:169635036-169635058 CACTACAGAGGGCACAGAAGAGG + Intronic
965663690 3:171069184-171069206 AAGGACAAAGGGTAGAGAAAGGG - Intronic
966898251 3:184461818-184461840 CGGGGAAGAGGGCAGAGAAAGGG + Intronic
967120054 3:186374698-186374720 CAGGACAGAAGGTATAGATTAGG - Intergenic
967246987 3:187497838-187497860 CAAAACAGAGGGAACAGAAAGGG - Intergenic
969157742 4:5226549-5226571 TAGCACAGATGGCATAGATACGG - Intronic
970499334 4:16661370-16661392 AAGTACAGAGGGCATAGAACTGG + Intronic
970528514 4:16957640-16957662 CAGGACAGAGGGTAAAGGATGGG + Intergenic
970938916 4:21608139-21608161 GAATACAGAGGGAATAGAAAGGG - Intronic
971422131 4:26482877-26482899 CAGAACAGCTGGCACAGAAAAGG + Intronic
971955229 4:33408874-33408896 CTAGACAGAGGCCATAGTAATGG + Intergenic
973313836 4:48739075-48739097 CAGAACAGAGAGCCCAGAAATGG + Intronic
973776658 4:54248640-54248662 CAGGACATAGGGCATGGGCAAGG + Intronic
974910229 4:68108713-68108735 GAGGACAGAGAGCAAATAAATGG - Intronic
975416419 4:74110303-74110325 GAGGACAGAGGCTATAGTAAGGG - Intergenic
975747815 4:77492076-77492098 CAGGAGAGAGGACCTGGAAATGG + Intergenic
975813127 4:78190383-78190405 CAGTTCAGAGAGCATAGACAGGG - Intronic
976530444 4:86146118-86146140 CAGAGTAGAGTGCATAGAAATGG + Intronic
976961236 4:90977914-90977936 TAGCACATAGGGCATTGAAAAGG - Intronic
977151695 4:93520651-93520673 CAGGATGGAGGCCATTGAAAAGG + Intronic
977527872 4:98166378-98166400 CAGGAGCTAGGGCTTAGAAAGGG + Intergenic
978467673 4:109026772-109026794 CAGGACATAGAGAAAAGAAATGG + Intronic
978734002 4:112064605-112064627 CAAAACATAGGGCACAGAAAAGG - Intergenic
980001584 4:127495813-127495835 CAGTAAAGAGGGATTAGAAAAGG + Intergenic
980168227 4:129253711-129253733 TAGAAGAGAGAGCATAGAAAGGG - Intergenic
980427600 4:132646639-132646661 CATGACAGAGAGCATAGAAAGGG + Intergenic
981168499 4:141592177-141592199 GAGTACAGAGGACAGAGAAAAGG + Intergenic
981325481 4:143441795-143441817 CAGAACTGAGGCCATAGAAGGGG - Intronic
983331998 4:166341986-166342008 CATGACAAAGAGAATAGAAAGGG - Intergenic
983387967 4:167090418-167090440 CACCAAAGAGGGCATAAAAATGG - Intronic
984522557 4:180818863-180818885 CAGAACAGAAGGAAGAGAAAGGG - Intergenic
985018791 4:185665600-185665622 CCTGACAGATGGCATAGAATTGG + Intronic
986652752 5:9980453-9980475 CATCACAAAGGGGATAGAAATGG + Intergenic
986757968 5:10855576-10855598 TAGGACTGAGTGCAGAGAAATGG - Intergenic
987034260 5:14004468-14004490 TAGGAAAAAGGGAATAGAAAAGG - Intergenic
990094437 5:52094476-52094498 CAGGGCAGAAGGCAAAGAGAAGG - Intergenic
990154700 5:52862419-52862441 AAGGACAGAGGGAATCAAAATGG - Intronic
990525300 5:56619771-56619793 TACGGCTGAGGGCATAGAAATGG - Intergenic
991344386 5:65647553-65647575 CAGGACAGAGTGCATATACCTGG - Intronic
991399640 5:66239549-66239571 CAGGCCAGAGGGCCTGGAACAGG + Intergenic
991907590 5:71527319-71527341 CAGGCCAGACGGCATAGAGATGG - Intronic
994187529 5:96831672-96831694 TAGGACTGATGGCAGAGAAAAGG - Intronic
995640218 5:114247979-114248001 CAGGACGGAAAGCAAAGAAAAGG - Intergenic
995947882 5:117671785-117671807 CAAGACAGAGAGCATAGAGGAGG + Intergenic
997356054 5:133263676-133263698 CATGATAGAGAGCAGAGAAATGG + Intronic
997663062 5:135604100-135604122 CTGCACAGAGGGCATAATAACGG - Intergenic
997881635 5:137597235-137597257 CAGGAAAAAGGGAAAAGAAAGGG + Intronic
998014055 5:138718257-138718279 AAGGAAAGAGGACATAGAATTGG + Intronic
998156869 5:139792114-139792136 CAGGAGAGGGGACATAGAATAGG + Intergenic
998367739 5:141641612-141641634 CAGGGCTGAGGGAATAGACAGGG - Intronic
998396812 5:141823976-141823998 AAGGACAGGAGGGATAGAAAGGG + Intergenic
999050207 5:148515418-148515440 CAGGACAGAGTGCAGAGCACTGG - Intronic
1000432484 5:161167115-161167137 AGGGAGAGAGGGCAGAGAAAGGG + Intergenic
1000441611 5:161270605-161270627 CAGGAGAGAGAGCACACAAAGGG - Intergenic
1001774082 5:174315678-174315700 CAGGAGAGAGGGCATTGAGGTGG + Intergenic
1002107831 5:176888894-176888916 GTGGACTGAGGGCTTAGAAAAGG - Intronic
1002571557 5:180142552-180142574 CAGCACAGATGGCAAACAAAGGG + Intronic
1005309565 6:24546499-24546521 AAGGACTGAGGCAATAGAAAGGG - Exonic
1006109795 6:31737610-31737632 GAGGACAAAGGGCACAGGAAGGG - Intronic
1006677868 6:35776953-35776975 CAGGACTGAGGCCATCGGAAGGG - Intronic
1006826630 6:36940627-36940649 CAGGAGAGAGGGAGAAGAAAAGG + Intergenic
1010794932 6:80107188-80107210 AAGGACGGAGGACAGAGAAAAGG - Intronic
1012289329 6:97433325-97433347 CAAGAAAGAGGGAATAGTAAAGG - Intergenic
1013251843 6:108342176-108342198 CAGGACAGAGGGCATAGAAAGGG - Intronic
1014397916 6:120949388-120949410 CTGGGCAGAGGGAACAGAAAGGG - Intergenic
1014846767 6:126287315-126287337 TATGACACAGGGCAGAGAAATGG - Intergenic
1015413102 6:132916951-132916973 CAAGATAAAGGGCAGAGAAAAGG - Intergenic
1016036284 6:139386849-139386871 CAGGACAGAGGTAACAGGAAGGG - Intergenic
1016160547 6:140874098-140874120 CAGGGTAGAGGTCTTAGAAAGGG - Intergenic
1016284770 6:142461250-142461272 CAGGACAGACTTCATGGAAAAGG - Intergenic
1019601981 7:1889394-1889416 CAGTACAGAGGCCAGGGAAATGG - Intronic
1019654150 7:2179567-2179589 CAGGACAGAGGGAACAGAATGGG + Intronic
1020654466 7:10912814-10912836 CAACACAGAGGGCAAAGAAGAGG - Intergenic
1020898799 7:13976201-13976223 AGGGACTGAGGGCAGAGAAATGG + Intronic
1022994950 7:35745877-35745899 CATGGCAGAGGGAAGAGAAAGGG - Intergenic
1023714951 7:43034574-43034596 GAGGACACAGTTCATAGAAAAGG - Intergenic
1028128938 7:87147476-87147498 CAGAAGAGAGGGCATGAAAAGGG - Intergenic
1028954358 7:96672721-96672743 CAGGACAGAGGACAGGGAAAAGG - Intronic
1032300794 7:130684712-130684734 CAGGTCAGAGGTCTTAAAAACGG + Intronic
1032786630 7:135205882-135205904 GAGCACAGAGGGCAAAGAAAAGG + Intronic
1032997624 7:137465475-137465497 CAGGACAGAGCTCTTAAAAAGGG + Intronic
1033783757 7:144704639-144704661 CAGAACAGAGGCTATAGAGATGG + Intronic
1034009303 7:147510385-147510407 CAGGACAGAGGACATAGTCAAGG + Intronic
1034241834 7:149616868-149616890 CAGGACTGAAGGCAGAGAAGGGG + Intergenic
1034419673 7:150982851-150982873 CAGGTCAGAGGTGATGGAAAAGG + Intergenic
1036447611 8:8836099-8836121 CAAGACAGAGAGGAAAGAAAAGG + Intronic
1036959118 8:13224719-13224741 CAGGACAGTGTGCACAGGAAGGG + Intronic
1037372045 8:18190672-18190694 CAAGACAGAAGGCATAAAACTGG - Intronic
1037658868 8:20910247-20910269 CAGCAGAGAAGGCATAGAGAGGG - Intergenic
1037690518 8:21177779-21177801 CAGGACAAAGGAAAAAGAAATGG - Intergenic
1037750099 8:21676021-21676043 CAGGGCAGAGAGCATGGAACTGG + Intergenic
1038295238 8:26286321-26286343 CAGGTCAGAAGGCATAGCTATGG + Intergenic
1040545847 8:48397249-48397271 GAGGGCGGAGGGCAGAGAAATGG - Intergenic
1041440661 8:57892774-57892796 CTTTACAGAGGACATAGAAAAGG + Intergenic
1042838309 8:73097728-73097750 CAGGGTCAAGGGCATAGAAATGG - Intronic
1045517560 8:102873735-102873757 CAGAACTCAGGGAATAGAAAGGG - Intronic
1047354181 8:124104479-124104501 CAGGACAAAGGACAATGAAAAGG + Intronic
1047355654 8:124119296-124119318 CAGGAAAGACTTCATAGAAAAGG + Intronic
1048210627 8:132451450-132451472 CAGGCCAGTGGGCATAGAGGAGG - Intronic
1048234661 8:132677850-132677872 CATGACAGAAGGGATAGAAAAGG + Intergenic
1050799975 9:9598382-9598404 CAGGATAGAGAGAATAGTAAAGG - Intronic
1051793563 9:20837016-20837038 AAGGGCAGAGAGCAGAGAAAAGG - Intronic
1053102360 9:35381530-35381552 CAGGAGACAGAGCAGAGAAAGGG - Intronic
1054735439 9:68745545-68745567 CATGACACACAGCATAGAAAAGG + Intronic
1054938615 9:70715729-70715751 CAGGTCAGAGGGGTTAGGAAGGG - Intronic
1054940306 9:70733722-70733744 CAGGTCAGAGGGGTTAGGAAGGG - Intronic
1055600083 9:77907365-77907387 CAGGAAAGGAGGCAAAGAAAGGG + Intronic
1055680482 9:78710224-78710246 CAGAAAAGAGGAGATAGAAATGG - Intergenic
1055744108 9:79423884-79423906 CAGAACAGAGGACACAGGAAGGG + Intergenic
1056623500 9:88234939-88234961 CAGGAGAGAGGGCAGAGGCAGGG + Intergenic
1057261768 9:93588466-93588488 GAGGTCAGAGGGCATAGACCTGG + Intronic
1057267864 9:93630793-93630815 CAGGACAGATGGTATGGATATGG + Intronic
1057594939 9:96407699-96407721 CAGGAAAGAAGGCATGGAAGAGG + Intronic
1057740686 9:97708869-97708891 TAGGGCAGAGGGCATAGATATGG + Intergenic
1058699689 9:107589907-107589929 CCAGAGAGAGGGGATAGAAAAGG - Intergenic
1058803539 9:108567791-108567813 CAGGTCAGAGGGCATGGCCAAGG + Intergenic
1059942456 9:119370923-119370945 CAGGACTGAGGGGAGAGGAAAGG + Intergenic
1059989563 9:119852568-119852590 CAAAACAGGGGGCAGAGAAAGGG - Intergenic
1061378565 9:130240611-130240633 CAGGACAGTGGGCATGGAAAGGG + Intergenic
1061400231 9:130364582-130364604 CAGGACTGAAGGCAGAGGAAGGG + Intronic
1062206133 9:135338468-135338490 CAGGACAGAGGCCACAGCAAAGG + Intergenic
1062723987 9:138060923-138060945 CAGGACAGGGGCTCTAGAAAGGG - Intronic
1203367675 Un_KI270442v1:272891-272913 CAGAACAGAGGCCCTAGAAGAGG - Intergenic
1186565413 X:10656940-10656962 CAGGCTACTGGGCATAGAAATGG - Intronic
1189331778 X:40148609-40148631 CAGGAGAGAGGGAGTATAAAGGG + Intronic
1189724901 X:43958598-43958620 CAGCAGGGAGAGCATAGAAAAGG + Exonic
1189862634 X:45289363-45289385 CAGGACAGAAGGGACAGAAGGGG + Intergenic
1190317498 X:49160752-49160774 CAGGAAAGAGGAAATACAAAGGG - Intergenic
1191700068 X:64032931-64032953 CAGGAGAGACTGCATGGAAAAGG + Intergenic
1191852984 X:65599771-65599793 GAGGGCAGAGGGCATGAAAAAGG + Intronic
1192263597 X:69523842-69523864 CAGGACACAGGGCATGGGGAGGG - Intronic
1192589621 X:72349156-72349178 CAGTGCAAAGGGCATAGACAGGG - Intronic
1193713226 X:84903684-84903706 CAGGTCAGAGGCTATTGAAAGGG - Intergenic
1195091386 X:101463017-101463039 CAGGACAGAGGGCTTTGCAAGGG - Intronic
1195319557 X:103710569-103710591 CCGGACAGAGGTTCTAGAAATGG + Intronic
1195425615 X:104726201-104726223 CAGAACAGAGGCCTCAGAAATGG - Intronic
1195502047 X:105613176-105613198 CAGGAGAGATGGCCTGGAAATGG - Intronic
1195574240 X:106431892-106431914 TAGCATAGAGGGCAGAGAAAGGG + Intergenic
1195963636 X:110410301-110410323 GAGGACAGAGGGCATCTTAAAGG + Intronic
1196738669 X:119004663-119004685 CAGGAAGGAGGGCTTACAAAGGG + Intronic
1196823721 X:119724422-119724444 CAGGAGTGAGGAAATAGAAAGGG + Intergenic
1199015147 X:142806333-142806355 CAGGAAAAAGGGCATACAAAGGG - Intergenic
1199268857 X:145859136-145859158 AAAGATAGAGGGCAGAGAAATGG - Intergenic
1199293761 X:146134534-146134556 CAGGAGAGAGAGAATAGCAAAGG + Intergenic
1199645711 X:149909080-149909102 CAGGACCTAGGGCCTAGAAGGGG - Intergenic
1202087013 Y:21148949-21148971 CAGCTCAGAGGAAATAGAAAGGG + Intergenic
1202099966 Y:21296984-21297006 CAGTAGAGAGGGCATAGAGAAGG - Intergenic