ID: 1013251844

View in Genome Browser
Species Human (GRCh38)
Location 6:108342177-108342199
Sequence ACAGGACAGAGGGCATAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013251844_1013251850 3 Left 1013251844 6:108342177-108342199 CCTTTCTATGCCCTCTGTCCTGT 0: 1
1: 0
2: 0
3: 42
4: 391
Right 1013251850 6:108342203-108342225 CTGCAAGGAATGCCTCCCACAGG 0: 1
1: 0
2: 0
3: 31
4: 178
1013251844_1013251852 17 Left 1013251844 6:108342177-108342199 CCTTTCTATGCCCTCTGTCCTGT 0: 1
1: 0
2: 0
3: 42
4: 391
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013251844 Original CRISPR ACAGGACAGAGGGCATAGAA AGG (reversed) Intronic
900090215 1:917014-917036 AGAGGACAGAGGGCTCAGGAAGG + Intergenic
900594406 1:3473969-3473991 ACAGGGCAGAGGGTATATGAGGG + Intronic
901160446 1:7173147-7173169 AGAGGACAGAGGGCAGCCAAAGG - Intronic
902060731 1:13640424-13640446 ACATGGCAGAGGAAATAGAAGGG + Intergenic
902331901 1:15734968-15734990 ACAGGACGGAGGGCAAAGGTCGG - Intergenic
902408247 1:16198282-16198304 GCAGGATTGAGGACATAGAAAGG + Exonic
902859939 1:19237983-19238005 ACAGGACAGTCTGCAAAGAAAGG + Intronic
904377399 1:30090454-30090476 AGTGGACAGAGGGTACAGAAAGG + Intergenic
904682845 1:32240958-32240980 ACAGGACTGAGGGGCTGGAAAGG - Intergenic
904758464 1:32783291-32783313 ACAGGACACAAGGAATAAAATGG - Intronic
905020783 1:34809855-34809877 ACATGGCAGAAGGGATAGAAGGG + Intronic
905058682 1:35121064-35121086 TCAGGACAGAGGCCAGAGAACGG + Intergenic
906126896 1:43432414-43432436 ACAGGGCTGAAGGCATCGAAGGG + Exonic
906225252 1:44116750-44116772 ACAGGACAGAGGACAGAGCCTGG - Intergenic
906744015 1:48208903-48208925 CCAGGGCAGAGGGCATGGAAGGG - Intergenic
906937264 1:50225429-50225451 ACAGGCCAGGAGGCCTAGAAGGG + Intergenic
907720170 1:56964609-56964631 ACAGGGCATAGGGCCTGGAAAGG - Intronic
908063524 1:60377375-60377397 TAAAGACAGAGGGAATAGAAGGG - Intergenic
908111138 1:60898679-60898701 TCAGGACTGAGGGGAGAGAATGG + Intronic
909286010 1:73818733-73818755 ACAAGACAGAAGGCTTATAAGGG + Intergenic
911706014 1:101014068-101014090 ACAGGACAGTGGGCAAGTAAAGG - Intronic
911708462 1:101041716-101041738 GCAGGAGAGAGGGGGTAGAAGGG + Intergenic
911739067 1:101367774-101367796 GCAGGACAGAGGACATACACTGG + Intergenic
911973779 1:104466535-104466557 ACAAGACAGAGGGCATGCAAAGG - Intergenic
912037648 1:105340908-105340930 AAAGGATAAAGGGCAAAGAAAGG - Intergenic
913438337 1:118870784-118870806 ACTGCACAGAGGGCATGGGAAGG - Intergenic
913635673 1:120758134-120758156 TCAGGAAAGAGGGCATAAACTGG + Intergenic
914283039 1:146194854-146194876 TCAGGAAAGAGGGCATAAACTGG - Intronic
914544069 1:148645572-148645594 TCAGGAAAGAGGGCATAAACTGG - Intronic
914622556 1:149425438-149425460 TCAGGAAAGAGGGCATAAACTGG + Intergenic
914701418 1:150137447-150137469 ACAGGACAGAAGGCAGTGAGCGG - Intronic
914954203 1:152146382-152146404 ATATGACAATGGGCATAGAATGG + Intergenic
915001973 1:152601876-152601898 GCAGGACAGAGGCCACTGAAGGG + Intergenic
915135828 1:153730789-153730811 AAAGGACAAAGGGCAAAGAAGGG - Intronic
916080111 1:161226979-161227001 ACAGGAAAGGGGGAATAGTAAGG - Intronic
916326335 1:163564200-163564222 ACAGGACAGAGGGGCAAGACAGG - Intergenic
917843127 1:178999040-178999062 ACAGCAGAAAGGGAATAGAATGG - Intergenic
918144152 1:181741211-181741233 ACAGGACAGAGTGGCAAGAAAGG + Intronic
918993621 1:191729318-191729340 ACAGGTCAGAAGGCCTAGGAGGG - Intergenic
919641405 1:200048308-200048330 TCAGGTCAGAGGGCATAGCTTGG - Exonic
919769203 1:201146537-201146559 ACTGGAAAGAGAGCAGAGAAGGG + Intronic
919970642 1:202575290-202575312 CCAGGACTGAGATCATAGAATGG + Intronic
920171175 1:204073401-204073423 AGAGGGCAGAGGGCAGAGAGCGG + Intronic
920669878 1:207995439-207995461 ACAGGACAGAGGACATATTTAGG + Intergenic
921222528 1:212983384-212983406 CCATGACAGAGGGCAAAGAGAGG + Intronic
921425929 1:215001082-215001104 GAAGGACTGAGTGCATAGAATGG - Intergenic
921426267 1:215004404-215004426 CCAGAAAAGAGGGCATAGGAAGG + Intergenic
922155632 1:223038158-223038180 CCAGGACAGAGGACAGAGAAGGG + Intergenic
923910850 1:238442165-238442187 TCAGCACAGAGGACATAGGATGG + Intergenic
1063733025 10:8721111-8721133 ACAAGACAGAGGCTTTAGAAAGG - Intergenic
1064474383 10:15671116-15671138 ACAGGACAGAAGGGATATACAGG + Intronic
1065035349 10:21632703-21632725 ACAAAAGAGAGGCCATAGAAAGG - Intronic
1065256994 10:23880069-23880091 AGATGAGAGAGGGCATAGGAAGG + Intronic
1066386614 10:34946793-34946815 ACAAGACACAGGTCATAGACCGG - Intergenic
1069021748 10:63496244-63496266 AGAGAACAGAGGACAGAGAAGGG + Intergenic
1069956740 10:72056680-72056702 AAAGGACATAGGGCATTGAAGGG + Intergenic
1070437557 10:76408303-76408325 ACTAGACAGAGGGCCTTGAATGG + Intronic
1070913890 10:80140414-80140436 ACTGGAAAGAGAGCACAGAAAGG - Intronic
1072601116 10:96930811-96930833 ACATGGCAGAAGGCAGAGAAGGG - Intronic
1072723977 10:97800323-97800345 AAAGGACAGAGGGGAAAGGAAGG + Intergenic
1074209790 10:111319986-111320008 ACAGGGCAGAGGGCATTCAAAGG + Intergenic
1075716005 10:124555620-124555642 GCAGGACTGTGGGCCTAGAAAGG - Intronic
1075846432 10:125548752-125548774 AAAGGAGAGAGGGTATAGCAAGG - Intergenic
1076084347 10:127612156-127612178 GCAGGAGAGAGAGCACAGAAGGG - Intergenic
1077362589 11:2147290-2147312 AGACGAAAGAGGGCAAAGAAGGG - Intronic
1080525845 11:33116610-33116632 CCATTACAGAGGGCATAAAAAGG + Intronic
1080587506 11:33695099-33695121 CCAGGCCAGAGGGCAGTGAAGGG - Intergenic
1080634463 11:34111526-34111548 ACAGGACACAGGGATCAGAATGG - Intronic
1082270194 11:50162208-50162230 GCAGGGGAGAGGGCAGAGAAGGG + Intergenic
1082273790 11:50200036-50200058 ACAGCACAGAAGTCATATAAAGG + Intergenic
1083265525 11:61545089-61545111 AAAGGACTCAGGGCCTAGAAGGG + Intronic
1083323623 11:61862532-61862554 GCAGGACAGAGGGCTTGGAGGGG - Intronic
1084148114 11:67275655-67275677 GCAGGAGAGAGGGCACACAAAGG - Intronic
1084148763 11:67278472-67278494 TCAGGGCAGGGGGCATGGAACGG - Intronic
1084876122 11:72135240-72135262 ACAGGACAGAGGGAAAAGTGGGG + Intronic
1084880989 11:72171719-72171741 ACAGGACAGAGGGAAAAGTGGGG + Intergenic
1084945672 11:72637077-72637099 TCTGGACAGAGGGGAGAGAATGG - Intronic
1085033308 11:73285714-73285736 ACAGGACAGAGGGTAGCAAAGGG + Intronic
1085571120 11:77558794-77558816 ACAGGTCAAAGGGGATAGAAAGG - Intronic
1085936903 11:81157374-81157396 ACAAGGCAGAGGGCACAGGAGGG - Intergenic
1086541748 11:87921027-87921049 ACAGGACAGAAGGCATCACATGG + Intergenic
1087295809 11:96372067-96372089 ACAGGAGAGAGGGAAAAGAGAGG - Intronic
1087680006 11:101209967-101209989 ACAGGCAAGGGGGCGTAGAAAGG - Intergenic
1089692963 11:120198051-120198073 AGAGGACAGAGGGCAGAGGAAGG + Intergenic
1089906371 11:122044028-122044050 ACAAGGCAGAAGGGATAGAAAGG - Intergenic
1090130256 11:124134886-124134908 ACAGGACAGAGGTTAGAGGAAGG - Intronic
1090268247 11:125368295-125368317 ACAGGACACAGGGCGAGGAAAGG - Intronic
1092051271 12:5472292-5472314 ACAGAACAGAAATCATAGAATGG + Intronic
1092270213 12:7018031-7018053 AGAGGCCAGAGGGCATGGCAGGG + Intronic
1092290477 12:7157150-7157172 AGAGGACAGAGGGCAAGGACTGG - Intronic
1092846038 12:12586157-12586179 AAAGGACAGAGGGAGCAGAAAGG - Intergenic
1093643885 12:21559964-21559986 ACAGGATAGAGAGCAGAGAGGGG + Intronic
1093869384 12:24269643-24269665 AAAGGATAGTAGGCATAGAAAGG - Intergenic
1095871063 12:47028637-47028659 AAAATACAGAGGGCATACAAAGG - Intergenic
1096568731 12:52505138-52505160 ACAGGACAGACTTCATAGCAAGG - Intergenic
1097018469 12:56003792-56003814 ACAGCATAGAGGGCCCAGAAGGG - Exonic
1097768925 12:63557607-63557629 ACAGGTCAGGAGGCATATAATGG - Intergenic
1097785281 12:63752236-63752258 ACAGGTCAGGAGGCATATAATGG - Intergenic
1097928850 12:65162017-65162039 AAAGGAGAAAGGGGATAGAAGGG - Intergenic
1099804706 12:87504173-87504195 ACAGGGCAGAGTGAATAGGATGG - Intergenic
1101033878 12:100685806-100685828 ACAGGCCAGGAGGCCTAGAAGGG - Intergenic
1101037176 12:100717290-100717312 GCAGGAGAGAGGGCGTAGACCGG - Intergenic
1101432400 12:104637564-104637586 ACAGGAAGGAAGCCATAGAAAGG - Intronic
1102653430 12:114460320-114460342 ACACCACTGAGGGCAAAGAAGGG - Intergenic
1103341425 12:120223117-120223139 AGAGGACAGAGGGTAGGGAAGGG + Intronic
1103699092 12:122839064-122839086 AGAGCACCTAGGGCATAGAAGGG + Intronic
1105623157 13:22088316-22088338 ACAGCACAGAGGCCCTGGAAAGG + Intergenic
1106940200 13:34769756-34769778 ACAGAACAGATGATATAGAAAGG + Intergenic
1107449288 13:40493753-40493775 AGATGACAGAAGGGATAGAAGGG + Intergenic
1107614079 13:42146340-42146362 ATAGGACAGAGTGTAAAGAAAGG + Intronic
1108333238 13:49411833-49411855 ATGGAACACAGGGCATAGAAGGG + Intronic
1109261994 13:60156322-60156344 ACAGGAGAAAAGGCATACAAAGG + Intronic
1110344893 13:74434564-74434586 ACAGGAGAGAGGACAAAGAAAGG + Intergenic
1110879089 13:80548286-80548308 ACAGAACAAAGGGCATACGAAGG - Intergenic
1114255728 14:20999921-20999943 ACAGGACAAAGGGAAGAGAGCGG + Intronic
1114348404 14:21822740-21822762 AGAGGACAGAGGACAGAGAGAGG - Intergenic
1114574364 14:23699153-23699175 ACATGACAGAAGGGATAGAAGGG - Intergenic
1114657698 14:24325921-24325943 AGAGAACAGAGGGCACAGAAGGG + Intronic
1115172491 14:30525325-30525347 TCATGACAGCGGGCATAGATCGG - Intergenic
1116556653 14:46319334-46319356 ACAGAACAAATGGCAGAGAAAGG + Intergenic
1116556885 14:46322416-46322438 ACAGAACAAATGGCAGAGAAAGG + Intergenic
1117706976 14:58480431-58480453 ACAGAAAAGAGGGCAAAGCATGG - Intronic
1117834455 14:59787791-59787813 ACAGGACAAAAGGCATAAGATGG + Intronic
1117940090 14:60954029-60954051 ACAGAACAGAGAACCTAGAAAGG - Intronic
1119297268 14:73543103-73543125 TCAGGAAAGAGGCCATGGAAAGG - Exonic
1119301499 14:73574961-73574983 TCAGGAAAGAGGCCATGGAAAGG - Exonic
1119719320 14:76880541-76880563 ACAGGACAGAGGAAATGGCACGG - Intergenic
1119807410 14:77491225-77491247 ACAGAACAAAGGGCAGAGGAAGG - Intronic
1122374596 14:101249414-101249436 ACAGAACAGAGGACAGTGAAGGG - Intergenic
1122814690 14:104306699-104306721 TCAGGACTGGGGGCATAGGAGGG + Intergenic
1202940870 14_KI270725v1_random:143870-143892 ACAGGGCAGAGGGCAGAGGAGGG + Intergenic
1123836723 15:24202216-24202238 TCAGGAGAGAGGGCAGAAAAAGG + Intergenic
1124114321 15:26827208-26827230 CCAGGAGACAGGGCAGAGAAGGG - Intronic
1124340026 15:28884960-28884982 CCAGGTCAGAAGGCACAGAAGGG - Intronic
1124383880 15:29190255-29190277 GCAGGGCAGAGGGCACAGAGGGG - Intronic
1124982063 15:34575830-34575852 TCAGGAGGGAGGGCATGGAAGGG - Intronic
1125685998 15:41563668-41563690 AGGGGACAGAGGGAATACAAAGG + Intronic
1125828495 15:42694838-42694860 AATGGAAAGAGGACATAGAAGGG + Intronic
1126403540 15:48299807-48299829 TCAGGACAGAAGGCACAGATGGG - Intronic
1126697343 15:51337743-51337765 AGAGGAAAGAGGGCAGAGCATGG + Intronic
1127207812 15:56738620-56738642 ACAGGAGAAAAGGCATACAAAGG + Intronic
1127362789 15:58259816-58259838 TGAGGACAGTGGGCACAGAAAGG - Intronic
1128322869 15:66704967-66704989 ACAAGACAGAGGTCAGAGCAAGG - Intronic
1128326336 15:66726342-66726364 ACAGGACAGACTGCACAGAGAGG + Intronic
1128730584 15:70018237-70018259 GCAGGGCAGAGGGGATAGGAGGG + Intergenic
1129117861 15:73375239-73375261 AGAGGACTGAGGGCATGGCAGGG - Intergenic
1129314550 15:74733411-74733433 CTAGGACAGTGGGCAGAGAAGGG + Intergenic
1129969861 15:79768787-79768809 ACGGGACAGCAGGCAAAGAAGGG - Intergenic
1131064330 15:89424085-89424107 AGAGGACAGAGGACAGAGGAGGG + Intergenic
1131666466 15:94576403-94576425 AGAGGAGAGAGAGCAAAGAAAGG + Intergenic
1132483899 16:180560-180582 ACACGACAGAGGCCCTGGAAAGG + Exonic
1133056405 16:3147577-3147599 ACAGGAGAGGGGGCAGGGAAGGG - Intronic
1133078076 16:3295285-3295307 ACCGGCCAGAGGGCAGGGAAAGG - Intronic
1133404743 16:5514524-5514546 ACAGGGCAGAAGGCATAGTGTGG + Intergenic
1133607223 16:7399649-7399671 ACAGAACAGAAGACATAGAGGGG - Intronic
1134102527 16:11462080-11462102 ACAGAGCAGAGGGGACAGAAGGG + Intronic
1135382018 16:22003430-22003452 ACAGGGCAGAGGGAAAAGTAAGG - Intergenic
1136095637 16:27954007-27954029 ACAGGACAATGGACAAAGAAGGG + Intronic
1136631427 16:31491249-31491271 ATAGGACGGAGAGCTTAGAATGG - Intronic
1139591786 16:67936973-67936995 GCAGCACAGAGGGCACAGCAAGG - Exonic
1141011960 16:80410209-80410231 AAAGCACAGAAGACATAGAAGGG + Intergenic
1141173865 16:81706751-81706773 ACACGACAGAGGGACCAGAAGGG + Intronic
1141411896 16:83840791-83840813 AAAGGAAGGAGGGCATAAAAAGG + Intergenic
1141871553 16:86789836-86789858 AGAGGTCAGAGGGCATGGCATGG + Intergenic
1143055567 17:4159412-4159434 AGAGGAGAGAGGCCACAGAAGGG - Intronic
1143208727 17:5166862-5166884 AAAGGAGAGAGAGCAAAGAATGG - Intronic
1143872180 17:9964962-9964984 ACAGGAGAGAGGAAAGAGAATGG - Intronic
1144894652 17:18520719-18520741 AAAGGAGAGAGAGCAAAGAATGG + Intergenic
1145137573 17:20423525-20423547 AAAGGAGAGAGAGCAAAGAATGG - Intergenic
1145763175 17:27439433-27439455 GCAGGAGAGAGGACATAGGAGGG - Intergenic
1145823327 17:27857383-27857405 CCAGGAGAGAGGGCCTAGGAGGG + Intronic
1147535877 17:41323182-41323204 AGAGGACAGAGGGCAGTGAATGG - Intergenic
1147918224 17:43901030-43901052 AGAGGTCAGAGGGCATAGGGAGG - Intronic
1148792342 17:50180427-50180449 GCATGACAGAGGGCATAGGAGGG - Intergenic
1149496093 17:57118509-57118531 ACAGGAAAGAAGGCATTGAAAGG - Intronic
1149561565 17:57611349-57611371 ACAGGGCAGAGGGCAGGGCACGG - Intronic
1149684674 17:58528537-58528559 CCAGGACAGCAGGCATAGACTGG - Intronic
1149780275 17:59392013-59392035 ACTGTACAGAGGGAATAGAATGG - Intronic
1149871564 17:60186702-60186724 AAAGGACAGAGAGCAAAGAATGG + Intronic
1152015245 17:77746493-77746515 ACAGGATAGAGGGCCTGGGATGG - Intergenic
1152102747 17:78312381-78312403 ACAGGGCAGAAGGGATGGAAGGG - Intergenic
1152812318 17:82387842-82387864 ACAAGACAGAGGGGACAGAAGGG + Intergenic
1153778714 18:8476157-8476179 ACAGGACAGATGCCACTGAAAGG + Intergenic
1156458190 18:37306456-37306478 CCAGGACAGGGGACACAGAATGG + Intronic
1156647599 18:39185003-39185025 ACAGGATAGAGGGGGTTGAAAGG - Intergenic
1157351074 18:46886176-46886198 ACAGGACAGAGAGGATAAGAGGG - Intronic
1158266743 18:55667150-55667172 ACAGGACAGGGGAGAAAGAAGGG + Intergenic
1158788212 18:60740999-60741021 ACATGGCAGAGGGGATGGAAGGG + Intergenic
1160161497 18:76475587-76475609 ACAGGAGACAGGACAAAGAAAGG + Intronic
1160492074 18:79347067-79347089 ACAGGAGGGAGGCCATGGAAAGG - Intronic
1161815876 19:6499650-6499672 ACTGGCCAAAGGGCATGGAAGGG - Intronic
1162116125 19:8430612-8430634 AGAGGAGAGGGGGCAGAGAAGGG - Intronic
1162455319 19:10780479-10780501 ACAGGAAGGAAGGCAGAGAAGGG - Intronic
1162531454 19:11238476-11238498 ATAGGACAGAGGGCAGAGGGTGG + Intronic
1164072457 19:21780677-21780699 CCAGGACAGAGGGGACAGCAGGG + Intergenic
1164465398 19:28483345-28483367 AGAGGGCAGAGGGAAGAGAAAGG - Intergenic
1164563269 19:29308650-29308672 ACAGGGCTGAGGGCACAGAGAGG + Intergenic
1164902236 19:31938148-31938170 AGAGGACACAGGACATGGAATGG - Intergenic
1165396526 19:35567232-35567254 AAATTAAAGAGGGCATAGAATGG - Intergenic
1165788513 19:38476767-38476789 ATAGGAGAGAAGGCATAGAGTGG - Intronic
1165934053 19:39378448-39378470 ACATGGCAGAGGGCATACTAGGG + Intronic
1166084286 19:40464932-40464954 CCAGGAGAGAGGGCAGAAAAGGG - Intronic
1166518577 19:43464525-43464547 CCGGGACAGAGGGCATGGGAAGG - Intronic
1167631948 19:50630892-50630914 CCAGGACAGTGGGGATAGAGAGG - Intronic
1167688751 19:50972492-50972514 AGAGGCCAGAGGGCATGGCATGG - Intergenic
925055429 2:853531-853553 ACAGGAGAGAGAGAAGAGAAGGG - Intergenic
925578170 2:5381794-5381816 AGAGGTCAGAGGGAGTAGAAGGG - Intergenic
925904165 2:8529424-8529446 CCAGGAAAGAAGGCACAGAATGG - Intergenic
926509789 2:13760877-13760899 AAAGGAGAGAGGGAAAAGAAAGG - Intergenic
927267699 2:21171583-21171605 ACATGCCAGAGGGCATTGCATGG + Intergenic
927342787 2:22001686-22001708 ACAGGACAGAGGCCATGAAAAGG - Intergenic
927522271 2:23706330-23706352 CCAGGTTAGAGGGCAAAGAAGGG + Intronic
928274134 2:29883436-29883458 ACAGGGCAGAGGCCAGAGGATGG - Intronic
928691483 2:33804037-33804059 ACAGGACAGAGTACATGCAAAGG + Intergenic
932028720 2:68161329-68161351 AGAGGACATTGGGCATTGAAGGG + Intronic
932467622 2:71933703-71933725 ACAGGACAGAGGGCCTGCAAAGG + Intergenic
932958178 2:76380752-76380774 ACATGACAGAAGGTACAGAAAGG + Intergenic
934075975 2:88429114-88429136 ACAGGAGAGAGGGCTGAGATAGG - Intergenic
934864043 2:97789903-97789925 ACTGGAGAGATGGCATAGCATGG + Intronic
935363639 2:102268063-102268085 ACAGGACAGAGGTCACATGAAGG - Intergenic
938776278 2:134544212-134544234 ACAGTACACAGGGCAGAGAATGG + Intronic
939049312 2:137288858-137288880 AAAGCACAGAGGGCATGTAAAGG + Intronic
939663072 2:144914578-144914600 ACAGGACAGAGGTGGTAGAAAGG + Intergenic
939904879 2:147900224-147900246 AGGGGACAGAGGGCAAAGACAGG - Intronic
940068832 2:149661591-149661613 AAAAGACAAAGGGCAGAGAAGGG + Intergenic
940515326 2:154677222-154677244 ACATGGCAGAGGGCATCGCATGG - Intergenic
941071436 2:160959267-160959289 AAAGGTCAAAGGGCAGAGAAAGG + Intergenic
942753322 2:179312755-179312777 AAAGGAAAGAGGGGAAAGAAAGG + Intergenic
944470360 2:200046082-200046104 ACAGGCCTGAAGGCCTAGAAGGG - Intergenic
944913154 2:204329646-204329668 AGAGGACAGAGAAAATAGAATGG - Intergenic
945320153 2:208411678-208411700 ACAAAACAGAGGGGAAAGAAAGG - Intronic
945703703 2:213202922-213202944 ACAGGACTGAGGGGACAAAATGG - Intergenic
946267421 2:218558800-218558822 ACTGGACACATGGCAAAGAAGGG - Intronic
947104918 2:226659427-226659449 ACAGGACAGAGGGAATTGGATGG - Intergenic
948350453 2:237335939-237335961 ACAGGATTGAGGGCACAGGATGG + Intronic
948371771 2:237494197-237494219 AGAGGACAGAGGGCAGAGGGTGG + Intronic
1169532176 20:6497080-6497102 ACCTCACAGAGGGCAAAGAAAGG - Intergenic
1170379337 20:15739756-15739778 ACATGACAGAGATGATAGAAGGG + Intronic
1170893001 20:20391772-20391794 AGAGGGCAGAGGGCACAGGAAGG + Intronic
1171251638 20:23653466-23653488 AGAGCACAGATGGCAGAGAATGG - Intergenic
1171311738 20:24150385-24150407 ACAGCTCACAGGGGATAGAACGG + Intergenic
1171994572 20:31722099-31722121 ACAGGACTGAGGCCCCAGAAGGG - Exonic
1172127025 20:32630543-32630565 ATAGGCCAGAGGGCAAATAAAGG + Intergenic
1172506494 20:35466763-35466785 AGAGGTCAGAGGGCCTAGGATGG - Intronic
1172610847 20:36251443-36251465 CCAGGACACAGGGCATAGTCTGG - Intronic
1173524437 20:43721309-43721331 GCAGGAGAGAGGACAGAGAAAGG - Intergenic
1173686349 20:44926192-44926214 ACAGGACAAACGGTATAAAATGG + Intronic
1174111950 20:48203222-48203244 AGAGGACAGAGGGGAAAGGAGGG - Intergenic
1174152719 20:48497275-48497297 ACAAGACAGAAGTTATAGAAAGG + Intergenic
1174546987 20:51333040-51333062 GAAGGACAGTGGGCACAGAAAGG - Intergenic
1174872303 20:54194414-54194436 AGAGAACAGAGGGCATAGCATGG + Intergenic
1174877957 20:54248097-54248119 CCAGGGCAGAGGGCACACAAGGG - Intergenic
1175487503 20:59356129-59356151 ACAGGACAGAGGGGAGAGAGAGG - Intergenic
1175917246 20:62432289-62432311 ACAGGACAGAGGCCGGAGACGGG - Intergenic
1176159304 20:63640480-63640502 CCAGGGCAGAGGGCACAGGAGGG + Exonic
1177622083 21:23609612-23609634 ACAGGACTGATGGCAAACAACGG + Intergenic
1178009769 21:28270915-28270937 AAAGGAAAGAGGGCTTAGATTGG - Intergenic
1178166366 21:29982791-29982813 ATATCACAGAGGGAATAGAAAGG + Intergenic
1178388832 21:32181733-32181755 ACAGGAATGAGGGCAGTGAAAGG + Intergenic
1179054362 21:37917025-37917047 ACAGGACAGAAGGGACTGAATGG - Intergenic
1179241485 21:39597060-39597082 AGAAGACAGAGGACATAGAGTGG - Intronic
1180012707 21:45061608-45061630 ACATGGCAGAGTACATAGAAGGG - Intergenic
1180319442 22:11307142-11307164 ACAGAACAGAGGCCCTAGATGGG - Intergenic
1181911438 22:26241411-26241433 ACTGGACAGAGGCAAAAGAAAGG + Intronic
1181979467 22:26755816-26755838 GCAGGACACAGAGCATACAAAGG + Intergenic
1182735222 22:32528562-32528584 CCAGCACCGAGGGCACAGAAGGG + Intronic
1183111170 22:35649660-35649682 GCAGGTCAGAGGGGATGGAATGG + Intronic
1183470184 22:38001129-38001151 AGAGGCCACAGGGCAAAGAAGGG - Intronic
1183655168 22:39180240-39180262 ACAGGAGAGAGGACATTAAAAGG + Intergenic
1183836465 22:40458139-40458161 ATAGGACAGATGGCAGAGATAGG - Intronic
1184469893 22:44690430-44690452 ACCTGACAGAGGGCATGGCAGGG + Intronic
949622462 3:5829600-5829622 ACAGAACAGAGGTCAAAAAAGGG - Intergenic
951753902 3:26068006-26068028 ACAGGGCACAGGGCATAGCAGGG + Intergenic
952537577 3:34328223-34328245 ACAGGAGAGAGGGCAAGGCACGG - Intergenic
952609756 3:35194045-35194067 ACAGTACTGAGAGAATAGAATGG - Intergenic
953036558 3:39216715-39216737 TCAGGAGAGAAGGCAGAGAATGG - Intergenic
954927798 3:54252643-54252665 ACAGAGCAGAGAGCACAGAAAGG - Intronic
955584580 3:60462670-60462692 TCAGGACAGAGAACATAGGAGGG + Intronic
955924975 3:63995778-63995800 AAAGGCCAGAGGGCGTGGAAGGG - Exonic
956572585 3:70712926-70712948 ACAGGCCTGGGGGCCTAGAAGGG - Intergenic
956911147 3:73818518-73818540 GCAGGGGAGAGGGCAGAGAAGGG + Intergenic
957654895 3:83061397-83061419 ACAAGCCAGAGGGCCTAGGAGGG - Intergenic
957946217 3:87066783-87066805 ACAGGTCTGTGGGCATAGTAAGG + Intergenic
958513173 3:95075589-95075611 ACATGACAAAGGGGATAGAAGGG + Intergenic
960014593 3:112872090-112872112 CCAGGACAAAGGGAATGGAAGGG - Intergenic
960473511 3:118095749-118095771 ACAGGAGACAGGGCACAGGAGGG + Intergenic
961083380 3:124045113-124045135 GCTGGACAGTGGGCCTAGAAGGG + Intergenic
961621918 3:128231068-128231090 ACAGGAGAGAGGGGATGGAGGGG - Intronic
962663210 3:137626461-137626483 ACATGACAGAGGGGGTAAAAGGG + Intergenic
963847375 3:150172849-150172871 ACAGGGCAGAAGGGATGGAAAGG - Intergenic
964205510 3:154170560-154170582 ACAGGACAAATGGTACAGAAGGG - Intronic
964924694 3:161941008-161941030 ACAGGACTAAGGAAATAGAAGGG + Intergenic
965770964 3:172180756-172180778 ATAGGAAAGAGCCCATAGAATGG + Intronic
967088634 3:186116131-186116153 ATAGGAGAGAAGGCAGAGAAGGG - Intronic
967246988 3:187497839-187497861 ACAAAACAGAGGGAACAGAAAGG - Intergenic
968084829 3:195869581-195869603 GCAGGACAGAGGACAAAGGAGGG + Intronic
968727896 4:2256718-2256740 AGAGGACAGAGGGCAAAGCCAGG + Intronic
969257441 4:6011792-6011814 ACAGGAAACAGGGCCTGGAAAGG + Intergenic
969609062 4:8216959-8216981 TCAGGACACAGGACAAAGAAGGG - Exonic
969839647 4:9871543-9871565 AGAGGACACAGGGAAGAGAAGGG - Intronic
970528513 4:16957639-16957661 ACAGGACAGAGGGTAAAGGATGG + Intergenic
970938917 4:21608140-21608162 AGAATACAGAGGGAATAGAAAGG - Intronic
972167030 4:36299613-36299635 GAAGGACAGAGTGCATACAATGG - Intronic
972427735 4:38950283-38950305 ACAGGACAGAGAGCAGGGAGGGG - Intergenic
972889043 4:43532134-43532156 ACAGGCCATGGGGAATAGAAAGG - Intergenic
975416420 4:74110304-74110326 AGAGGACAGAGGCTATAGTAAGG - Intergenic
975701570 4:77072325-77072347 ACAGGACAGAAGGCAGGGCATGG + Intronic
976409111 4:84692303-84692325 TGAGGACAAATGGCATAGAATGG + Intronic
977240552 4:94563682-94563704 ATAGGACAGGGTGCATATAAAGG + Intronic
978884881 4:113756756-113756778 ACAGAATTGAGAGCATAGAAGGG - Intronic
979748133 4:124242740-124242762 ACATGGCAGAAGGGATAGAAAGG - Intergenic
980168228 4:129253712-129253734 ATAGAAGAGAGAGCATAGAAAGG - Intergenic
980427599 4:132646638-132646660 GCATGACAGAGAGCATAGAAAGG + Intergenic
981064688 4:140470146-140470168 AGAGGACTGAGAGCACAGAAGGG - Intronic
981325482 4:143441796-143441818 GCAGAACTGAGGCCATAGAAGGG - Intronic
983331999 4:166341987-166342009 ACATGACAAAGAGAATAGAAAGG - Intergenic
983674799 4:170280100-170280122 ATAGGACCCAGGGCTTAGAAGGG - Intergenic
984731014 4:183068364-183068386 AGAGGACAAAGGGAAAAGAAAGG + Intergenic
984837056 4:184032061-184032083 GCAAGACAGAGGACATAGGATGG + Intergenic
985487106 5:158119-158141 CCAGGACAGAGGGCACAGACTGG - Intronic
985681685 5:1259049-1259071 ACAGGAGAGAGGGAATGGAGTGG + Intronic
986499150 5:8379992-8380014 ACAGGATACAGGGCACACAATGG + Intergenic
988393461 5:30666033-30666055 ACATGGGAGAGGGCATAGGAGGG + Intergenic
989169188 5:38458460-38458482 ACAGGACAGTGGGACTACAAGGG - Intronic
989823214 5:45820616-45820638 AGAGGACAGAGGGCTTTGGAAGG + Intergenic
990062922 5:51674166-51674188 ACAGAACAGAGGACTCAGAAAGG - Intergenic
992423369 5:76629153-76629175 ACAGGACAGAGTGAAAAGATAGG - Intronic
992596931 5:78356657-78356679 GCAGGAGAGAGGGCATAGACTGG + Intergenic
994228765 5:97287570-97287592 ACATGACAGAAGGAATAGTAGGG + Intergenic
994605899 5:101966229-101966251 ACAGAACAGAGTCCATAGTATGG - Intergenic
995102197 5:108325969-108325991 TCTAGACAGAGGACATAGAAAGG + Intronic
996046880 5:118883642-118883664 ACAGGAGAGAGAGCACACAAGGG + Intronic
996453744 5:123656489-123656511 ACAGGTCTGAAGGCCTAGAAAGG - Intergenic
997693743 5:135845376-135845398 TCAGGGCAGAGTGCAGAGAAGGG - Intronic
997820105 5:137057641-137057663 ACAGGGCAGAGAGCAAAGAAAGG - Intronic
998396811 5:141823975-141823997 AAAGGACAGGAGGGATAGAAAGG + Intergenic
998971299 5:147595395-147595417 ACAGGACAGAAGGAACAGAGGGG - Intronic
999330212 5:150668689-150668711 GCAGGACAGAGGGGACAGAATGG - Intronic
1000083322 5:157867733-157867755 GCAGGACAGAGGATAGAGAATGG - Intergenic
1000441612 5:161270606-161270628 ACAGGAGAGAGAGCACACAAAGG - Intergenic
1000794619 5:165649439-165649461 ACATGACAGAGGCCATGGAAGGG + Intergenic
1001153399 5:169252037-169252059 ATAGGAGAGATGGGATAGAATGG - Intronic
1002602453 5:180361796-180361818 GCAGGCCAGAGAGCCTAGAATGG + Intergenic
1003903170 6:10674130-10674152 ACATGGCAGAGGGCAGAGAGAGG + Intronic
1004681463 6:17899399-17899421 CCAGGGCAGAGGGCACGGAAAGG + Intronic
1004697195 6:18044484-18044506 ACAGCACAGAGAGCATGCAATGG - Intergenic
1007165845 6:39828508-39828530 ACATGACAGAAGGAATGGAAGGG + Intronic
1007237574 6:40401820-40401842 AGAGGACAGAGCACCTAGAAAGG - Intronic
1007270038 6:40629430-40629452 ACAAGACAGAGGGCCTAGAGAGG - Intergenic
1008126765 6:47677948-47677970 ACAGGACAGAAGGCTGAGAATGG - Intronic
1009708526 6:67287250-67287272 ACATGACAGTGGACAAAGAATGG - Intergenic
1010585808 6:77657779-77657801 ACAGAGCAGAGAGCATATAATGG - Intergenic
1012948106 6:105489253-105489275 ACAGGACAGAGAGAATAACAGGG - Intergenic
1013169565 6:107624353-107624375 GGAGGACAGACAGCATAGAAGGG + Intronic
1013251844 6:108342177-108342199 ACAGGACAGAGGGCATAGAAAGG - Intronic
1013685017 6:112570531-112570553 ACATGACGGAGGGCATCAAATGG - Intergenic
1014399583 6:120971163-120971185 CCCGGACAGAGGGGATAGCATGG - Intergenic
1015166673 6:130206921-130206943 AAATGTCAGAGGGCTTAGAAAGG + Intronic
1015285833 6:131485593-131485615 ACAAGAGAGAGGACATAGTATGG + Intergenic
1015341189 6:132102908-132102930 ACAAGTCAAATGGCATAGAAGGG - Intergenic
1015446438 6:133311244-133311266 ACAGGAAAGAGGGGAAGGAAGGG - Intronic
1015760341 6:136652877-136652899 ACATTACAGAGGTCACAGAAAGG + Intronic
1015772845 6:136786493-136786515 ACAATGCAGAGGGCAAAGAAGGG + Intronic
1015853025 6:137593850-137593872 ACAGGACTGGAGGCCTAGAAGGG - Intergenic
1016036285 6:139386850-139386872 ACAGGACAGAGGTAACAGGAAGG - Intergenic
1016060690 6:139626751-139626773 ACAGGTCACTGGTCATAGAAAGG - Intergenic
1017876441 6:158529000-158529022 ACAGGACAGGGAGCAGAGCAGGG - Intergenic
1019532225 7:1509490-1509512 ACAGGAAACAGCGCATGGAAAGG - Intergenic
1019654149 7:2179566-2179588 CCAGGACAGAGGGAACAGAATGG + Intronic
1020605689 7:10333885-10333907 ACATGAGAGAGGGCATTGTATGG + Intergenic
1021648172 7:22807272-22807294 ACAGGAGATAGGGCATACATGGG + Intergenic
1022101693 7:27173062-27173084 ACAGGAAAGAGCGCACAGGAGGG + Intronic
1022292433 7:29017148-29017170 ACAGGGCAGAGTGCATAGTCTGG - Intronic
1023625505 7:42111527-42111549 ACAGGACACCAGGAATAGAATGG + Intronic
1024114791 7:46182442-46182464 GCAGGACAGGGGGCAAACAAGGG - Intergenic
1026285963 7:68963022-68963044 ACAGGATCCAGGTCATAGAAGGG - Intergenic
1031076675 7:117220016-117220038 GCAGGAGAGAGGACAGAGAAGGG - Intronic
1031146125 7:117998990-117999012 ACATGGCAGAAGGCACAGAAGGG + Intergenic
1032506062 7:132435508-132435530 AGAGAACAGAGGGCAAAGGAGGG + Intronic
1032549849 7:132774460-132774482 TCAGGTCAGAGGGGAGAGAATGG - Intergenic
1032876862 7:136047114-136047136 ACAGGGCAGAAGGGATGGAAGGG + Intergenic
1032989189 7:137372538-137372560 ACAAGATAGAGGGGAAAGAAAGG + Intergenic
1032997623 7:137465474-137465496 ACAGGACAGAGCTCTTAAAAAGG + Intronic
1034072694 7:148202148-148202170 GCAGGAGAGAGGCCATTGAAGGG - Intronic
1034241833 7:149616867-149616889 ACAGGACTGAAGGCAGAGAAGGG + Intergenic
1034503728 7:151468707-151468729 ACAGGACAGAAGGCTGAGGATGG - Intronic
1036218845 8:6903641-6903663 AAAGGACAGGGGGAAGAGAAAGG + Intergenic
1036959117 8:13224718-13224740 ACAGGACAGTGTGCACAGGAAGG + Intronic
1036962570 8:13261334-13261356 AGAGGCCAGAGTGTATAGAATGG + Intronic
1037087849 8:14875226-14875248 ACATGACAGAAGACACAGAAAGG + Intronic
1037658869 8:20910248-20910270 ACAGCAGAGAAGGCATAGAGAGG - Intergenic
1039622549 8:39011888-39011910 ACAGGAAAGAAGGCAGAGACTGG + Intronic
1039734014 8:40310329-40310351 AGAGAACAGAGGGAATAGAGTGG - Intergenic
1040436183 8:47393868-47393890 ACAGGACAAAGGACAAAGGACGG - Intronic
1040633887 8:49249448-49249470 AGAGGACATTGGGGATAGAATGG - Intergenic
1041468662 8:58183965-58183987 ACAGGCCAGAGGGAAAAGCACGG + Intronic
1042180118 8:66079454-66079476 TCAGGAAAGATGTCATAGAAGGG + Intronic
1044320230 8:90792700-90792722 ACAGCACAGAAGGAAAAGAAAGG - Intronic
1044823171 8:96172157-96172179 ACAGAACAGAAAGAATAGAATGG + Intergenic
1045493842 8:102691464-102691486 ACAGGGCGGAGGCAATAGAATGG + Intergenic
1045517561 8:102873736-102873758 ACAGAACTCAGGGAATAGAAAGG - Intronic
1047805214 8:128352280-128352302 ACAGGATGGAGGGTTTAGAATGG - Intergenic
1048496815 8:134942390-134942412 GCAGGACAGAGGGTATTCAAGGG - Intergenic
1049472314 8:142781979-142782001 ACAGGGCAGAGGGCAGTGATGGG + Intergenic
1053495466 9:38545476-38545498 ACAGGACAAAGGGAAAGGAAGGG - Intronic
1054938616 9:70715730-70715752 ACAGGTCAGAGGGGTTAGGAAGG - Intronic
1054940307 9:70733723-70733745 ACAGGTCAGAGGGGTTAGGAAGG - Intronic
1055085000 9:72304953-72304975 AAAAGAGAGTGGGCATAGAAAGG - Intergenic
1055375692 9:75646855-75646877 ACTGGACAGGGAGTATAGAATGG + Intergenic
1055601660 9:77925279-77925301 ACAGGACAGAGGAGAAAGAGAGG - Intronic
1055744107 9:79423883-79423905 ACAGAACAGAGGACACAGGAAGG + Intergenic
1056237973 9:84614918-84614940 CCAAGAAAGAGGGCAAAGAATGG - Intergenic
1056623499 9:88234938-88234960 ACAGGAGAGAGGGCAGAGGCAGG + Intergenic
1057289768 9:93797545-93797567 TCAGTACAGTGGGGATAGAATGG - Intergenic
1061378564 9:130240610-130240632 TCAGGACAGTGGGCATGGAAAGG + Intergenic
1062723988 9:138060924-138060946 ACAGGACAGGGGCTCTAGAAAGG - Intronic
1188083860 X:25879756-25879778 ACATGACAGAAGAAATAGAAGGG - Intergenic
1188529912 X:31128276-31128298 ACAGGGCATTGGGCATAGAGAGG - Intronic
1189862633 X:45289362-45289384 ACAGGACAGAAGGGACAGAAGGG + Intergenic
1190276427 X:48902446-48902468 ACCGGGAAGAGGGCAAAGAACGG + Exonic
1190732181 X:53233570-53233592 ACTGGAGAAAGGGCATAGACTGG + Exonic
1192589622 X:72349157-72349179 ACAGTGCAAAGGGCATAGACAGG - Intronic
1192591394 X:72362954-72362976 ACAGGACAGAGGTGACAGAAAGG + Intronic
1192923225 X:75729589-75729611 ACAGGCCAAAAGGCATAGGAAGG - Intergenic
1193713227 X:84903685-84903707 ACAGGTCAGAGGCTATTGAAAGG - Intergenic
1195091387 X:101463018-101463040 TCAGGACAGAGGGCTTTGCAAGG - Intronic
1195454242 X:105050937-105050959 GCAGGGCAGAGGGCAGAGGAGGG - Intronic
1195574239 X:106431891-106431913 ATAGCATAGAGGGCAGAGAAAGG + Intergenic
1196285162 X:113871403-113871425 ACAGGCCAGGAGGCCTAGAAGGG + Intergenic
1197796578 X:130305104-130305126 ACAAGACAGAGGACATAGCCTGG - Intergenic
1197887188 X:131230920-131230942 ACAGCACAGAGCCCATGGAAAGG + Intergenic
1199015148 X:142806334-142806356 TCAGGAAAAAGGGCATACAAAGG - Intergenic
1199645712 X:149909081-149909103 CCAGGACCTAGGGCCTAGAAGGG - Intergenic
1202081572 Y:21089230-21089252 CCAGGAGACAGGGCAAAGAAAGG + Intergenic