ID: 1013251845

View in Genome Browser
Species Human (GRCh38)
Location 6:108342187-108342209
Sequence CTTGCAGGAAACAGGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 334}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013251845_1013251852 7 Left 1013251845 6:108342187-108342209 CCCTCTGTCCTGTTTCCTGCAAG 0: 1
1: 0
2: 6
3: 36
4: 334
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251845_1013251856 22 Left 1013251845 6:108342187-108342209 CCCTCTGTCCTGTTTCCTGCAAG 0: 1
1: 0
2: 6
3: 36
4: 334
Right 1013251856 6:108342232-108342254 CAGCCAGGAGCCAGCCAGAAAGG 0: 1
1: 0
2: 3
3: 36
4: 366
1013251845_1013251850 -7 Left 1013251845 6:108342187-108342209 CCCTCTGTCCTGTTTCCTGCAAG 0: 1
1: 0
2: 6
3: 36
4: 334
Right 1013251850 6:108342203-108342225 CTGCAAGGAATGCCTCCCACAGG 0: 1
1: 0
2: 0
3: 31
4: 178
1013251845_1013251857 23 Left 1013251845 6:108342187-108342209 CCCTCTGTCCTGTTTCCTGCAAG 0: 1
1: 0
2: 6
3: 36
4: 334
Right 1013251857 6:108342233-108342255 AGCCAGGAGCCAGCCAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013251845 Original CRISPR CTTGCAGGAAACAGGACAGA GGG (reversed) Intronic
900850104 1:5136079-5136101 CTTCTAGGAAAGAGGACAGCAGG - Intergenic
901455664 1:9361512-9361534 CATGCAGGAAAGAGGCCACAGGG - Intronic
902580177 1:17403055-17403077 CTGGGAGGTAACAGGAGAGAAGG - Intergenic
902616348 1:17625554-17625576 GATGCAAGAGACAGGACAGAAGG + Intronic
903441907 1:23394642-23394664 CTTGTAGGGGAAAGGACAGAGGG - Intronic
904452892 1:30627770-30627792 CTTCAAGGAAGCAGGTCAGAGGG + Intergenic
904598828 1:31662757-31662779 ACTGCTGGAAACAGGACAGCTGG + Intronic
905003214 1:34689682-34689704 ATTGTAGGGAACAGGACAGCAGG - Intergenic
906280474 1:44549937-44549959 CTTTTTGGAGACAGGACAGATGG - Intronic
907487503 1:54787866-54787888 CTGGCAGCACACAGGACAGCCGG - Intronic
908116818 1:60948975-60948997 GTTGCAGGAAGGAGGAGAGAGGG - Intronic
908423337 1:63980908-63980930 TTTTCAGGAGACAGCACAGACGG + Intronic
908685511 1:66714465-66714487 CTTTCAGGAAAAAAGACATATGG - Intronic
910204594 1:84735614-84735636 AATGCAGGAAAGAAGACAGAAGG - Intergenic
910806090 1:91191083-91191105 CCTGCAGTCAACAGGTCAGAAGG + Intergenic
910902510 1:92136611-92136633 CTTGCAGAACACAGTTCAGAAGG + Intronic
911191925 1:94956955-94956977 TGTGCAGAGAACAGGACAGATGG - Intergenic
911811460 1:102287286-102287308 CTTGCAGGAAACAGTTCAATGGG - Intergenic
913162026 1:116153118-116153140 CTCGCAGGAACCAAGAGAGAGGG + Intergenic
913995872 1:143651719-143651741 CTAGCAGGAAAAGGGACATAAGG - Intergenic
914376947 1:147080224-147080246 CTAGCAGGAGAAAGGACACAAGG + Intergenic
914492420 1:148160657-148160679 CTAGCAGGAAAAGGGACACAAGG - Intergenic
915900748 1:159845048-159845070 CTGGGAGGTAACAGGAAAGAAGG + Intronic
916582187 1:166118929-166118951 TTTGCAGACACCAGGACAGAGGG + Intronic
916736479 1:167611838-167611860 TTTACAGGAAACATGGCAGATGG - Intergenic
917630468 1:176886723-176886745 CCTGCATGAAACAGGCCAGAGGG + Intronic
918429191 1:184440700-184440722 CTTACAGGACAGAGGAGAGAGGG + Intronic
919138736 1:193543438-193543460 CTTCCAGGCAAGTGGACAGAGGG - Intergenic
920952337 1:210584333-210584355 CTTTAAGGAAACTGTACAGATGG - Intronic
921266217 1:213422952-213422974 CTTGCAGGGAACAGCCCTGAAGG + Intergenic
921699165 1:218247694-218247716 CATTCAGGAAACAGCAAAGATGG - Intergenic
921805445 1:219449002-219449024 ATTGCAGGAATCAGGGAAGAGGG - Intergenic
922396202 1:225203219-225203241 CTTGCAGAGAACATGGCAGATGG - Intronic
1063449683 10:6143124-6143146 ATGGCAGGGAAAAGGACAGAGGG + Intergenic
1064134181 10:12736262-12736284 GTGGCAGGAGACAGGACACATGG - Intronic
1064264122 10:13811112-13811134 CTTCTAGGAAACAAAACAGAAGG - Intronic
1065580626 10:27167654-27167676 CTGACAGGAAACAGTATAGAAGG - Intronic
1067913823 10:50375014-50375036 TTTGCAGAACTCAGGACAGAGGG + Intronic
1068960508 10:62862379-62862401 CTTGCAGCAAACCAAACAGACGG - Intronic
1072213833 10:93271589-93271611 CTTCCAGGAAACAGACCAAATGG + Intergenic
1072440504 10:95449885-95449907 CTTGCAGCAAACAAGATAGACGG + Intronic
1072546655 10:96445266-96445288 CCTGCAGGATGCAGGCCAGACGG + Intronic
1073071417 10:100796081-100796103 TATGCAGGATACATGACAGATGG - Intronic
1073877946 10:107947475-107947497 CTTGCATGAAAGAAGGCAGAAGG + Intergenic
1074500231 10:114017170-114017192 CTTGCAGGAAAGAGGTGAAATGG - Intergenic
1074827259 10:117223545-117223567 CTTCCAGGAGACTGGACAGCTGG + Intergenic
1075392664 10:122103787-122103809 CTTGCAGGAGAGAGGAAGGATGG + Intronic
1075585111 10:123651801-123651823 CTTGCAAGAAGCAGGAGATAAGG + Intergenic
1075634707 10:124022683-124022705 CTTGCTGGAGACAGGCCAGGTGG - Intronic
1077241953 11:1515254-1515276 GTTAAAGTAAACAGGACAGAGGG + Intergenic
1077292768 11:1806384-1806406 CTTCCAGGAAACAGAAGAGGAGG + Intergenic
1077755753 11:5025703-5025725 CTCGCAAGAAACAGGGAAGAAGG - Intergenic
1078403831 11:11050703-11050725 CTTCCAGGAAACAGAAGAGGAGG - Intergenic
1078983478 11:16565395-16565417 CTTCCAGAAAACAGAAGAGAAGG + Intronic
1079084132 11:17433235-17433257 CTTGAATGAAAGAGGATAGATGG - Intronic
1079120846 11:17683881-17683903 CTTGCAGGACACGGGGCAGGAGG - Intergenic
1080042472 11:27773372-27773394 ATTGCATGAAAGAGCACAGAAGG + Intergenic
1081580631 11:44349227-44349249 CTGGCAGAAAACAGGAAAGAGGG - Intergenic
1082212267 11:49519677-49519699 CTTGTATGAAAAGGGACAGAAGG + Intergenic
1083229862 11:61309902-61309924 CTTGCAGGAAACCAGACTGAGGG + Exonic
1083547565 11:63560304-63560326 CCTGCAGGAAACAGGAAGGAGGG + Intronic
1083969651 11:66066956-66066978 TTTGCAGGCCACAGAACAGAGGG - Intronic
1084674548 11:70626519-70626541 ACTGCAGGAAACAGGAAAGATGG + Intronic
1084675871 11:70634026-70634048 CTGGCAGGAAACACGGGAGATGG + Intronic
1086637321 11:89104837-89104859 CTTGGATGAAAAGGGACAGAAGG - Intergenic
1087232036 11:95676690-95676712 CATGAAGGAAACAGAACAGGTGG + Intergenic
1088557138 11:111073251-111073273 CTTGCAAGAAAAAGAACTGAGGG + Intergenic
1088963963 11:114699321-114699343 ATTGGAAGAAACAGGACTGAGGG - Intronic
1089802362 11:121044225-121044247 TATGCAGGAAACAAGACTGAAGG - Intronic
1090517651 11:127446139-127446161 CTTGCTGGAGATAGGTCAGAGGG + Intergenic
1091588802 12:1830977-1830999 CTTGCAGGAGAAAGGGCAGGTGG - Exonic
1093078658 12:14784161-14784183 TATGAAGGAAAGAGGACAGAAGG - Intergenic
1097381035 12:58895788-58895810 CATGCAGGACAGACGACAGAAGG + Intronic
1098107045 12:67079496-67079518 CTAACAGGAAACAGGCCAAATGG + Intergenic
1098368660 12:69734506-69734528 CTTGCTGGAAAAAGGATATAAGG + Intergenic
1099115015 12:78613075-78613097 CTTGCACCAAACAGGACACATGG + Intergenic
1102057623 12:109908403-109908425 CTTGCAGGAAATGGCTCAGAGGG + Intronic
1103062852 12:117872976-117872998 GTGGCAGGAACCAGAACAGAAGG + Intronic
1104303756 12:127590635-127590657 CTTACAGAAACCAGGAGAGAAGG + Intergenic
1105880795 13:24605147-24605169 CTTGAAGGAAAAAGAAGAGAAGG - Intergenic
1107265766 13:38552211-38552233 CTTGTAGGCAACAGGTCAGTTGG + Intergenic
1108953900 13:56126084-56126106 AATGCAGGAAACAGGAAAGAAGG - Intergenic
1113088814 13:106595902-106595924 GAGGCAGGAAACAGGAAAGATGG + Intergenic
1113417797 13:110143621-110143643 CTTCCAGAAAACAGAAGAGATGG + Intergenic
1113663521 13:112124369-112124391 CTTCCAGAAAACAGGAGAGGAGG - Intergenic
1116772326 14:49141844-49141866 TTTGCATTGAACAGGACAGAGGG - Intergenic
1117681819 14:58211295-58211317 CTTGGAGCAAGCAAGACAGATGG - Exonic
1117882063 14:60321789-60321811 CTTGGAGGCAACCAGACAGAAGG - Intergenic
1120195798 14:81480794-81480816 CTTTCAGGAAAAAGCACATATGG - Intronic
1121298414 14:92849403-92849425 CTGGAAGGAAACAGGCCAAATGG - Intergenic
1121662199 14:95643630-95643652 CTTGCAGAAAACAGGTCATGGGG + Intergenic
1123018915 14:105388507-105388529 CTTGCAGGAAACAGGCCCAGCGG - Intronic
1123781735 15:23634932-23634954 CTTTCAGAAAACAGAAAAGAAGG + Intergenic
1125181664 15:36886303-36886325 CTTTCAGGAGGCAGGACACAGGG + Intergenic
1125964908 15:43866239-43866261 CTTCCATGAGACAGGAAAGAGGG + Exonic
1126346238 15:47697202-47697224 CTTGCAGGAAACAAGGGAGCAGG + Intronic
1126739102 15:51759965-51759987 CTAGCAGGAAACTGGAGAGCAGG - Intronic
1128638508 15:69318414-69318436 CGAGCAGGTAACAGGAGAGAGGG - Intronic
1129112593 15:73346438-73346460 TTTGCAGGAAAGAGGTAAGAGGG + Intronic
1129708040 15:77805823-77805845 CTTGAAGGAGACAGGACAAGAGG + Intronic
1129808463 15:78484899-78484921 CCTGCAGCAAGCATGACAGATGG - Exonic
1130425173 15:83790190-83790212 CTTCCAGAAAACAGAAGAGAAGG + Intronic
1130877961 15:88030558-88030580 CTTCCACTAAAGAGGACAGAGGG + Intronic
1131293938 15:91130811-91130833 CTTGTAGGAAAGAGGATTGAAGG + Intronic
1131418679 15:92284489-92284511 CTTACTGGAAACAGGAATGAAGG + Intergenic
1131469347 15:92682996-92683018 CTGGCAGGAAGTAGGACAAAAGG + Intronic
1131535303 15:93232443-93232465 CCTGTTGGAAACAGGAAAGAGGG + Intergenic
1131712660 15:95073054-95073076 TGTGCAGGAGACAGGACATATGG + Intergenic
1131847503 15:96503443-96503465 CTTCACGGAAGCAGGACAGAGGG + Intergenic
1132142180 15:99405273-99405295 CTTGCAGAAGACAGGCCAGAGGG + Intergenic
1132421405 15:101672992-101673014 CTTGGAGGACACAGGACAGGAGG + Intronic
1133753257 16:8741370-8741392 CTTCTAGGAAACAGGTCAGATGG + Intronic
1135785045 16:25341045-25341067 CTTCCAGGAAACACCCCAGAGGG - Intergenic
1136006957 16:27337324-27337346 CTTGCAGCAAACAGGAACGGAGG - Intronic
1136413378 16:30090008-30090030 ATTTGGGGAAACAGGACAGACGG + Intronic
1136614726 16:31391184-31391206 CTTGCAGGAAACCGAGCCGAGGG - Intergenic
1137390685 16:48079003-48079025 CATGAAGGAAGCAAGACAGAAGG - Intergenic
1138527885 16:57619548-57619570 CCTGCAGGACACCTGACAGAGGG - Intronic
1141286635 16:82678924-82678946 GTTCCAGGAGATAGGACAGAAGG + Intronic
1141576709 16:84968611-84968633 CTTGGAGAAACGAGGACAGACGG + Intergenic
1141678668 16:85531260-85531282 CTCACAGGACACAGGACAGATGG - Intergenic
1142055148 16:87989565-87989587 CATCCAGGACACAGGACACAGGG + Intronic
1142055163 16:87989624-87989646 CATCCAGGACACAGGACACAGGG + Intronic
1142055193 16:87989742-87989764 CATCCAGGACACAGGACACAGGG + Intronic
1142055208 16:87989801-87989823 CATCCAGGACACAGGACACAGGG + Intronic
1142055223 16:87989860-87989882 CATCCAGGACACAGGACACAGGG + Intronic
1142055238 16:87989919-87989941 CATCCAGGACACAGGACACAGGG + Intronic
1142738252 17:1915302-1915324 CTGCCAGGCAACAGGATAGATGG - Intergenic
1143088950 17:4437144-4437166 CTTGCAGGAAACAGCTCTTATGG + Intronic
1143159358 17:4859011-4859033 CTGACAGGAAACAGGGCAGGAGG - Intronic
1143392765 17:6569799-6569821 TCTGCAGGAAACTGCACAGAAGG + Intergenic
1146586819 17:34089935-34089957 CCTGCAGGAACCAAGACAGCTGG - Intronic
1147186786 17:38717410-38717432 CCTGCAGGCACAAGGACAGAGGG - Exonic
1148086463 17:44996544-44996566 CCTGCAGGAAACAGCAGAGCAGG - Intergenic
1148324364 17:46774499-46774521 CTTCTAGGAAACTGGAAAGATGG - Intronic
1151334447 17:73431783-73431805 CTGGAAGGAATGAGGACAGATGG + Intronic
1151768284 17:76143372-76143394 CCTGCAGGGGACAGGACAGGAGG + Exonic
1151955133 17:77376376-77376398 CTTGCAGGAACCAAGACACCAGG - Intronic
1152082607 17:78197704-78197726 CTTCCAGGGAACAGGTCAAAGGG + Intronic
1152216340 17:79034797-79034819 CTTTTTGGAAACAGGAGAGAGGG + Intronic
1152409592 17:80116820-80116842 CTTGGAGGACTCAGGTCAGACGG - Intergenic
1152594546 17:81232021-81232043 GCTGGAGGAAACAGGACAGCCGG + Exonic
1153140844 18:1970952-1970974 CTTTCAGACAACAGGTCAGATGG + Intergenic
1153168079 18:2284941-2284963 CTTGCAGGAAAGAAGACGAATGG - Intergenic
1154233747 18:12583103-12583125 ATTGGATGAAACATGACAGATGG + Intronic
1154498397 18:14979297-14979319 AGAGCAGGAAGCAGGACAGAAGG + Intergenic
1155397570 18:25402933-25402955 CTGGGAAGAAACAGGAAAGAAGG - Intergenic
1156197673 18:34793947-34793969 CTAGAAAAAAACAGGACAGAGGG + Intronic
1156381640 18:36567159-36567181 TTTGCTGGAAGCAGGACTGAAGG - Intronic
1156869181 18:41925523-41925545 CTTGAAGCAAATAGGACAAACGG + Intergenic
1157848748 18:51028532-51028554 CTTGCAGGCTACAGGACTGAGGG - Intronic
1157854087 18:51088142-51088164 CTTCCAGGAAACAGAAGAGAAGG + Intergenic
1158630775 18:59112176-59112198 CATGGAGGAAACATGACAGCAGG + Intergenic
1158721376 18:59928210-59928232 TTAGCAGGAAAAAAGACAGAAGG + Intergenic
1159219887 18:65447021-65447043 TTTGCTAGAAACAGGACACAAGG - Intergenic
1160244396 18:77145497-77145519 CTCTGAGGAAGCAGGACAGATGG - Intergenic
1160508607 18:79441044-79441066 TTTGCTGGGAACAGCACAGATGG + Intronic
1160964487 19:1740526-1740548 CTTCCAGGGACCAGGAGAGAAGG + Intergenic
1164420070 19:28082379-28082401 CTTTCAGAAAACAGAAGAGAAGG + Intergenic
1164620586 19:29693630-29693652 CTTGGAGGAAATAAGAAAGAGGG - Intergenic
1164679865 19:30126946-30126968 CATGCAGGCACCAGGGCAGATGG - Intergenic
1166404781 19:42512313-42512335 CTTGGAGGAAACAGAACAAGAGG + Intronic
1166414409 19:42583169-42583191 CCTGCAGGAAACAGGACAAGAGG + Intronic
1166419019 19:42620135-42620157 CTTGGAGTAAACAGGACAAGAGG + Intronic
1166424913 19:42669131-42669153 CCTGCAGGAAACAGGACAAGAGG - Intronic
1166437529 19:42781133-42781155 CCTGCAGGAAACAGGACAAAAGG + Intronic
1166466431 19:43035796-43035818 CCTGCAGGAAACAGGACAAAAGG + Intronic
1166472573 19:43091870-43091892 CCTGCAGGAAACAGAACAAAAGG + Intronic
1166486224 19:43215216-43215238 CCTGCAGGAAACAGGACAAAAGG + Intronic
1166493339 19:43278856-43278878 CCTGCAGGAAACAGGACAAAAGG + Intergenic
1166538300 19:43589901-43589923 CTTGAAGGAAAGAGAACAGCAGG + Exonic
1166570207 19:43790935-43790957 CATGCAGGAGACAGGCCCGAGGG - Intergenic
1167528941 19:50002809-50002831 CTTGCCGGAAACCTGACAAATGG + Intronic
1168430302 19:56273745-56273767 GAGGCAGGAAACAGAACAGACGG + Intronic
1168697514 19:58412683-58412705 CTTCCAGAAAACAGAAGAGAAGG - Intronic
925152218 2:1622797-1622819 CCAGCAGGAGACAGGAGAGAAGG - Intergenic
925904272 2:8529940-8529962 CTGGCAGCAGACAGGCCAGAGGG - Intergenic
926235603 2:11041125-11041147 CTTGCAGGAAACATGAAAAAGGG + Intergenic
927293877 2:21431136-21431158 CTGGAAGGAAACAGAAGAGATGG + Intergenic
927774850 2:25894680-25894702 ACTGCAGGAAACAGGAGGGAAGG + Intergenic
928120118 2:28577975-28577997 CCTGCAGGAAAATGGACTGAAGG - Intronic
929437310 2:41938613-41938635 CCTGCAAGAAAGAGGACAAAAGG + Exonic
931752452 2:65341964-65341986 CTTGCAGCAAATATGACAGATGG + Intronic
932477493 2:72015501-72015523 CTTGCAGAAACCAGGTCAGTTGG - Intergenic
932478824 2:72025959-72025981 CTTTCAGGAAACAGGGCAGAGGG - Intergenic
932796552 2:74700795-74700817 CATGCAGAACAAAGGACAGAAGG + Intergenic
932877383 2:75467370-75467392 CTGACAGGAAACAGGAGTGAAGG - Intergenic
933139528 2:78776969-78776991 GCTGCAGGTAAAAGGACAGAAGG + Intergenic
934955866 2:98617976-98617998 CAAGGAGGAAACAGCACAGAGGG + Intronic
935448579 2:103183923-103183945 CTTTCAGGAAATAGGAAAGAAGG + Intergenic
935870587 2:107444237-107444259 CTTGCAGTAAGCAACACAGAGGG - Intergenic
936273923 2:111075124-111075146 CTTCCAGGAAACAGAAGAGGAGG - Intronic
936761154 2:115785141-115785163 CTTGTAGGCAACTGGAAAGAGGG + Intronic
936953377 2:118000721-118000743 CATTCAGGATCCAGGACAGACGG + Intronic
937042407 2:118832867-118832889 CCGGCAGGAAACACAACAGAGGG - Intergenic
937155520 2:119716029-119716051 ACAGCAGGAAACAGAACAGATGG + Intergenic
938181682 2:129190271-129190293 CATTCAGGAAGCAGCACAGAGGG - Intergenic
938606976 2:132904441-132904463 CTTGCAGCAAACATGAGAAATGG - Intronic
938735813 2:134185804-134185826 CTTGTAGGGAAGAGGAGAGATGG + Intronic
939618272 2:144385893-144385915 CTTGGAGGAAAGGGGAAAGAAGG - Intergenic
943302421 2:186220663-186220685 ATTGAAGGAAAGAGGAAAGAAGG + Intergenic
946074062 2:217059268-217059290 CTTCCAGGAAATAAGTCAGATGG + Intergenic
948006555 2:234614000-234614022 CTTACAGGATACAGGCCAGCTGG + Intergenic
948041096 2:234902172-234902194 CTTGCAGGAAGGAGAAGAGAAGG - Intergenic
948207869 2:236172417-236172439 CATGCAGAAAGCAGGACAGGGGG + Intergenic
948216030 2:236232882-236232904 CTTCCAGGAAATAGAAGAGAAGG + Intronic
948713059 2:239837178-239837200 CTTCCTGGAAGCAGGACAGGAGG + Intergenic
948724558 2:239925572-239925594 CTTGCAGAAAACAACAGAGAAGG + Intronic
1169132329 20:3172791-3172813 TTTCCAGGAAGCAGGACTGAGGG + Intronic
1170344107 20:15364312-15364334 TTTGTAGTAAACTGGACAGATGG - Intronic
1170382548 20:15777395-15777417 CATGCAGAAAATAGGACAGTTGG - Intronic
1170989217 20:21286857-21286879 CATGGAGGAAGCAGGAGAGAGGG - Intergenic
1171233875 20:23509037-23509059 CATGCGGAAAAGAGGACAGAGGG + Intergenic
1171369173 20:24649715-24649737 CTTTCAGGAAACAGGACTGGGGG - Intronic
1172216256 20:33237850-33237872 CTTGCAGGAAGCTTGACAAATGG + Exonic
1172309692 20:33908162-33908184 CCTGCAGGAAACAGGAGATCAGG - Intergenic
1172795389 20:37533474-37533496 CTTGGAGGATACATGACAAAGGG - Intergenic
1173595196 20:44254485-44254507 CTTGCAGGAGGCAGGAGACAGGG - Intronic
1174749143 20:53094777-53094799 CTTCCAGAAATCAGGACTGATGG + Intronic
1174868526 20:54161851-54161873 CAGGCAAGAAACAGCACAGAAGG + Intronic
1175060614 20:56238813-56238835 ATTGCATGTAACAGGACAGATGG + Intergenic
1175738364 20:61403096-61403118 CATGCAGGAAAAAGGAGAAAGGG - Intronic
1175800693 20:61799702-61799724 CTTGAAGGACCCAGGAGAGATGG - Intronic
1178725934 21:35051721-35051743 CTTGCAGGAACTAGGACAGAGGG - Intronic
1179054364 21:37917035-37917057 GTTGCAGTGGACAGGACAGAAGG - Intergenic
1179402141 21:41094166-41094188 CTTCCTGGATACAGGAGAGACGG + Intergenic
1180128736 21:45810707-45810729 CTTTCAGAAAACAGGGAAGAGGG - Intronic
1180756486 22:18165514-18165536 CTAACAGGAAACAGGAAACACGG - Intronic
1181075283 22:20371920-20371942 CTAACAGGAAACAGGAAACACGG + Intronic
1181315376 22:21967716-21967738 CCTGCAGGAAAAAGGATAAAGGG + Exonic
1183113685 22:35672983-35673005 CTTAAAAGAAACAAGACAGATGG + Intergenic
1185217416 22:49609398-49609420 CTTGCTGGAAACTGGGAAGATGG + Intronic
949861939 3:8513439-8513461 CTTACAAGAAACAGGATAGCTGG - Intronic
950569671 3:13792233-13792255 CTGGCAGGAAACAGCACAAATGG - Intergenic
951368100 3:21809996-21810018 CTTCCAGAAAATAGGAGAGAAGG + Intronic
951966131 3:28387285-28387307 CTTCCATGAAAGAAGACAGATGG - Intronic
953417462 3:42731120-42731142 CTGGCTGGAGCCAGGACAGAAGG + Intronic
953475471 3:43202279-43202301 CTTGCAGGCTCCAAGACAGATGG + Intergenic
954316896 3:49806258-49806280 CTAGCAGGAAACAGGAGCCAGGG + Intronic
954429191 3:50460345-50460367 CTTAAAGGAAACTGGACAAAGGG + Intronic
956500918 3:69884212-69884234 CTTCCAGGGAACATGACGGAAGG - Intronic
956767610 3:72497099-72497121 CAAGAAGGAAAAAGGACAGATGG - Intergenic
960591283 3:119368354-119368376 CTTGCCTGAAACAACACAGACGG - Exonic
961573247 3:127815660-127815682 CATCCAGGACACAGGACAGAAGG + Intronic
962048872 3:131791632-131791654 ATTTTAGGAAACAGTACAGATGG + Intronic
962052982 3:131837831-131837853 CTTGGGGGAAACAGGATAAAGGG + Intronic
962398016 3:135034555-135034577 CATGCAGGAAACTGGACAGGTGG + Intronic
963232263 3:142920118-142920140 CTTTCAGGAGACAGAGCAGAGGG - Intergenic
963851868 3:150217408-150217430 GTTCCAGGAAAGAGGGCAGAAGG + Intergenic
963855740 3:150251421-150251443 CCTGCAGGAACCAGCAGAGAAGG + Intergenic
964914804 3:161827837-161827859 ATTGCAGAAAACATGAGAGATGG + Intergenic
965699189 3:171442196-171442218 CACGGAGGAAACAGGAAAGAAGG + Intronic
966531598 3:180987895-180987917 CTTGCAGGAAGCAGGAGAATGGG + Intronic
968093439 3:195911658-195911680 CTTGAGGGAAACTGGAGAGATGG - Intronic
968485192 4:857353-857375 CTCACAGGAAGCAGGAGAGACGG - Intronic
969402259 4:6963240-6963262 CTCACAGGAGACAGAACAGAGGG - Intronic
970752061 4:19375897-19375919 CTGGCACCAAAAAGGACAGAAGG - Intergenic
971264366 4:25085016-25085038 CTTGATGGGAACAGCACAGACGG + Intergenic
973594861 4:52477813-52477835 CTTGCAGGTCACATTACAGATGG - Intergenic
974144168 4:57925560-57925582 TTTGCAGGTAACAGCACAAAGGG + Intergenic
977294277 4:95193731-95193753 CTGGCAGAGAACAGGAGAGAAGG - Intronic
979657347 4:123210758-123210780 ATTACAGAAAACAGCACAGAGGG - Intronic
979733866 4:124057388-124057410 ATTGCAGGAAGCAGGACAAAGGG - Intergenic
980188540 4:129494089-129494111 CCTGCAGAAAACAGGAGGGAAGG + Intergenic
980895865 4:138859526-138859548 CTCTGAGGAAACAGGACTGAAGG - Intergenic
983661088 4:170131402-170131424 CTTGCCGGGAAATGGACAGAGGG - Intergenic
983927585 4:173418367-173418389 CTTCCAGGAGCCAGGACTGAAGG - Intergenic
984140033 4:175993575-175993597 ATTGCAGGAGACAGGAAAGAAGG - Intronic
985522415 5:382202-382224 CTTCCAGAAAACAGAAGAGAAGG - Intronic
986449928 5:7853541-7853563 ATTCCAGGGAACAGGAGAGAGGG + Intronic
988371416 5:30373084-30373106 CTTCTAGGAAACAGGACAAAAGG + Intergenic
988659657 5:33251500-33251522 CCTTTAGAAAACAGGACAGACGG - Intergenic
990250857 5:53913445-53913467 CTCACAAGAAACAGGACAGAGGG - Intronic
990639834 5:57770273-57770295 CCTGCAGGAAGCAGTGCAGAAGG - Intergenic
990731081 5:58810151-58810173 CTGGCAGGAGACTGGACTGAAGG - Intronic
990971783 5:61515441-61515463 ATTCCATGACACAGGACAGAAGG + Intronic
991345808 5:65666945-65666967 CTTCCAGGAAACAGAAGAGGAGG - Exonic
992291210 5:75281992-75282014 ATTCCAGGAAACAGGAGTGAAGG + Intergenic
992376120 5:76189222-76189244 CTTTGAGGAAATAGGAGAGACGG + Intronic
992998668 5:82357740-82357762 CATACAGCAAACAGTACAGAAGG - Intronic
993128986 5:83872305-83872327 GTTCCAGGAAACACAACAGAGGG - Intergenic
994103184 5:95916332-95916354 CTTGAAGGAATGAGGAGAGAAGG + Intronic
994157047 5:96515338-96515360 CAAGCAGGAAACAGGCTAGATGG - Intergenic
995449667 5:112286704-112286726 GATGCAGGAAAGAGAACAGAAGG - Intronic
996591114 5:125148818-125148840 CTTCTAGGAAATAGGAGAGATGG - Intergenic
998212303 5:140209167-140209189 TATGCAGGAGAGAGGACAGAAGG + Intronic
1001039643 5:168325022-168325044 TTTGCAGGGGAGAGGACAGATGG + Intronic
1001671891 5:173480623-173480645 CTTGGAGTAGTCAGGACAGATGG + Intergenic
1002666450 5:180829199-180829221 CTCTGAGGAAACAGGACAAAGGG - Intergenic
1002666456 5:180829248-180829270 CTCTGAGGAAACAGGACAAAGGG - Intergenic
1003484028 6:6559943-6559965 CTTCCAGAAAACAGAAGAGAAGG - Intergenic
1004390431 6:15205072-15205094 CTTGCAGTAAAAAGAACACAAGG + Intergenic
1004758253 6:18637370-18637392 CTTGCAGGAAAGAGGAACCAGGG - Intergenic
1005179155 6:23083919-23083941 CTTATAGGAAAAAGGACACATGG + Intergenic
1005425747 6:25701088-25701110 CTTGAAGGAGACAGGCCACAGGG - Intronic
1006286076 6:33095474-33095496 CTTCCAGGAAAGAGGAGAGGGGG + Intergenic
1007379388 6:41477811-41477833 CTGGCAGGAGACTGGAGAGAGGG + Intergenic
1010902882 6:81449592-81449614 CTTGCAGGAGCCAGTTCAGAAGG - Intergenic
1011538547 6:88404930-88404952 CTTGCAGCCAACAGGTAAGATGG + Intergenic
1012822038 6:104097391-104097413 TTGGTAGGAAACAGAACAGATGG - Intergenic
1012929145 6:105298604-105298626 CTTTCATGATACAGGGCAGATGG - Intronic
1013251845 6:108342187-108342209 CTTGCAGGAAACAGGACAGAGGG - Intronic
1015490642 6:133821566-133821588 GTTCCAGGAAACCAGACAGAGGG + Intergenic
1017213760 6:151885057-151885079 CTTGCATGAAACAAGTCACAAGG + Intronic
1018078660 6:160239620-160239642 ATGGCAGGAAGGAGGACAGAGGG + Intronic
1018287890 6:162260215-162260237 CTGGCAGGCCACAAGACAGAGGG + Intronic
1018298202 6:162372027-162372049 CTTCCAGGAGGCTGGACAGAGGG - Intronic
1019029939 6:169001205-169001227 CATTCAGCAAACAGGACACAGGG + Intergenic
1020076738 7:5263409-5263431 CTCCCAGGAACCAGGACAAATGG + Intergenic
1021571153 7:22066593-22066615 GTGTCAGGAAACAGGAGAGAAGG - Intergenic
1022646498 7:32234725-32234747 CTTCCAGGAAACAGAAGAGAAGG + Intronic
1022825207 7:34003996-34004018 CTGGAAGGAAACAGGAAAAAGGG - Intronic
1022979387 7:35589919-35589941 CTTGGAGGAGTCAAGACAGAGGG - Intergenic
1023197553 7:37657751-37657773 ATTGCAGGAAACAGGATATCAGG + Intergenic
1023722518 7:43111529-43111551 CTTGCAGAAAAGAGCACAGCTGG + Intergenic
1024123519 7:46268455-46268477 CATGCAGGAGACAGGTCAGCAGG - Intergenic
1024216970 7:47256109-47256131 ATAGCTGGAAACAGGTCAGATGG + Intergenic
1024400178 7:48915284-48915306 ACTGCAGGAAACAGGAAAGGAGG - Intergenic
1025202354 7:56970185-56970207 CTTCCGGGAACCAGGACAAATGG - Intergenic
1025669594 7:63606742-63606764 CTTCCGGGAACCAGGACAAATGG + Intergenic
1025770917 7:64505800-64505822 CTTCCAGTAGAGAGGACAGAAGG - Intergenic
1026385959 7:69848045-69848067 CTTACAGGACAAAGTACAGATGG - Intronic
1028487322 7:91374124-91374146 CTCACAGGAAACAGGAGAGAAGG - Intergenic
1029510276 7:100990146-100990168 CTGTCAGGAACCAGGACACACGG + Intronic
1031957428 7:127956598-127956620 AGTGCAGGAAACAGGACTTAGGG - Intronic
1032126859 7:129201611-129201633 CTTGCAGAAAACAGAGCAGTGGG - Intronic
1032327126 7:130939948-130939970 CTTGAATGAAAGAAGACAGATGG + Intergenic
1036619628 8:10415976-10415998 CTTGGAGGAGAGAGGACACACGG - Intronic
1036933054 8:12974733-12974755 CTTGCATGAAAAGGGACAGGAGG + Intronic
1037770592 8:21796903-21796925 CTTGCAGAAAAAAGCACCGAAGG - Intronic
1038021478 8:23554875-23554897 CATGCAGTAAGCAAGACAGATGG - Intronic
1040598755 8:48864230-48864252 CTTGCATGGAAGAGGAAAGAAGG - Intergenic
1041550643 8:59096967-59096989 ATTGCTGGAAACAGGATAGAGGG + Intronic
1042417957 8:68547486-68547508 CTTTCAGAAAATAGAACAGAGGG + Intronic
1042802995 8:72741298-72741320 TTAGCAGGTAACAGGGCAGAAGG - Intronic
1044895208 8:96884441-96884463 CTTATAAGAAACAGGAGAGAGGG - Intronic
1045321997 8:101089212-101089234 CATGCAGGAAACAGGGGAGAGGG + Intergenic
1045448912 8:102299548-102299570 CTTTCAGTAAACAGAACAGTAGG + Intronic
1047412755 8:124637549-124637571 CTTGCAGAAAGCAGGAGGGAGGG + Intronic
1047809223 8:128390208-128390230 CTGGGAGGACACAAGACAGAGGG + Intergenic
1047966872 8:130051429-130051451 CTTCCATGAAAGATGACAGAAGG + Intergenic
1048915130 8:139175332-139175354 CTTGGGTGAGACAGGACAGATGG - Intergenic
1049816249 8:144603870-144603892 CTTGCAGGAATGAGGACATCAGG + Intronic
1051575628 9:18612107-18612129 CTAGCAGGAAAGAAGTCAGAGGG + Intronic
1052458718 9:28734773-28734795 CTTACTGGGAAAAGGACAGAGGG - Intergenic
1052506949 9:29367486-29367508 CTTGAAAGTAACAGCACAGAAGG + Intergenic
1053013685 9:34649745-34649767 CCTGGAGGAAGCAGGAGAGAAGG - Intronic
1053459011 9:38254132-38254154 CTTGCTGTTAACAGGACAGTTGG - Intergenic
1056688383 9:88785173-88785195 GTTGCAGGACCAAGGACAGAGGG + Intergenic
1057319279 9:93997428-93997450 CTTGCAAGGAACAGGACTGGAGG - Intergenic
1057546793 9:96025012-96025034 CTGGTAGGAAACTGGAAAGAAGG - Intergenic
1058312405 9:103520138-103520160 CTTGCAGGCAATAGGACTGAAGG - Intergenic
1060050933 9:120377668-120377690 CTTGTAAGAAACGGGAGAGAGGG - Intergenic
1061416050 9:130447469-130447491 TTTGCTGGAAGCTGGACAGATGG + Intronic
1186155135 X:6717481-6717503 AGTGCAGGAAGGAGGACAGAAGG - Intergenic
1186335661 X:8584135-8584157 CCTGCAGGCAACTGAACAGATGG + Intronic
1186376655 X:9010654-9010676 ACCGCAGGAAACAGGACACATGG + Intergenic
1187266113 X:17736053-17736075 TTTACAGGCAACAGGACATAAGG + Intergenic
1187438328 X:19293250-19293272 ATCACAGTAAACAGGACAGAAGG + Intergenic
1187556300 X:20355471-20355493 TTTTCAGGAAACAGAACAGCAGG - Intergenic
1187794113 X:22982609-22982631 GTAGAAGGAAACAGGATAGAAGG - Intergenic
1188568570 X:31554623-31554645 CTTACAGGGAAAAGGCCAGAGGG - Intronic
1189206719 X:39246197-39246219 CTTACAGTCAACAGAACAGATGG - Intergenic
1191601680 X:63016151-63016173 CTTGCAGCAGACAGGCCTGATGG - Intergenic
1192631062 X:72778060-72778082 CTCAAAGGAAACAAGACAGATGG + Intronic
1192650647 X:72942741-72942763 CTCAAAGGAAACAAGACAGATGG - Intronic
1193385212 X:80862237-80862259 CTTGCAGGAAACAGGTAAGTGGG + Intergenic
1193684222 X:84557520-84557542 CTTGAAGGAAACAGTAAACATGG + Intergenic
1193836055 X:86345410-86345432 CTTGCAGGAAAAAAAATAGAAGG + Intronic
1195615576 X:106909513-106909535 CTTGCAAGACAGAGGCCAGAGGG - Intronic
1195719218 X:107849934-107849956 CTGGTAGGAAACAGGACAGGAGG - Intronic
1197159904 X:123311344-123311366 CTTGCATGAAAGAGGACTGCTGG + Intronic
1198573802 X:137987702-137987724 CTGGCAGGAAAGAGAACAAAGGG - Intergenic
1199852649 X:151736625-151736647 CTTGCTGGAAACAAGGCAGTGGG - Intergenic
1201427730 Y:13872852-13872874 CCTGCAGGCAACTGAACAGATGG - Intergenic
1201850087 Y:18470786-18470808 CTTGCAGTGAAATGGACAGAGGG + Intergenic
1201883231 Y:18849591-18849613 CTTGCAGTGAAATGGACAGAGGG - Intergenic