ID: 1013251846

View in Genome Browser
Species Human (GRCh38)
Location 6:108342188-108342210
Sequence CCTTGCAGGAAACAGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013251846_1013251852 6 Left 1013251846 6:108342188-108342210 CCTCTGTCCTGTTTCCTGCAAGG 0: 1
1: 0
2: 2
3: 33
4: 330
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251846_1013251856 21 Left 1013251846 6:108342188-108342210 CCTCTGTCCTGTTTCCTGCAAGG 0: 1
1: 0
2: 2
3: 33
4: 330
Right 1013251856 6:108342232-108342254 CAGCCAGGAGCCAGCCAGAAAGG 0: 1
1: 0
2: 3
3: 36
4: 366
1013251846_1013251857 22 Left 1013251846 6:108342188-108342210 CCTCTGTCCTGTTTCCTGCAAGG 0: 1
1: 0
2: 2
3: 33
4: 330
Right 1013251857 6:108342233-108342255 AGCCAGGAGCCAGCCAGAAAGGG No data
1013251846_1013251850 -8 Left 1013251846 6:108342188-108342210 CCTCTGTCCTGTTTCCTGCAAGG 0: 1
1: 0
2: 2
3: 33
4: 330
Right 1013251850 6:108342203-108342225 CTGCAAGGAATGCCTCCCACAGG 0: 1
1: 0
2: 0
3: 31
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013251846 Original CRISPR CCTTGCAGGAAACAGGACAG AGG (reversed) Intronic
900029850 1:363496-363518 CCTGGCAGTAAACAGGTCACAGG + Intergenic
900050501 1:592560-592582 CCTGGCAGTAAACAGGTCACAGG + Intergenic
900393823 1:2445000-2445022 CCAAGCAGGAGATAGGACAGTGG - Intronic
900751422 1:4400335-4400357 CCTTGCAGGACATCCGACAGGGG + Intergenic
901655276 1:10765789-10765811 CCCTGCCGGCAGCAGGACAGTGG - Intronic
902122850 1:14182554-14182576 ACTAGCAGGATACAGGACTGGGG - Intergenic
903132281 1:21288147-21288169 CCTTGCAGGAAAAGGCAAAGAGG - Intronic
903299682 1:22369870-22369892 CCATGCAGGAGGCAGGGCAGGGG + Intergenic
903326820 1:22573617-22573639 GCGTGGAGGAACCAGGACAGGGG + Intronic
904284516 1:29445310-29445332 CCAGGCAGGAAACAGGACCCAGG - Intergenic
904453750 1:30633997-30634019 GCTTGGAGGACACAGCACAGAGG - Intergenic
905547603 1:38811936-38811958 CCTTGCAGGACATGCGACAGGGG - Intergenic
906702108 1:47867024-47867046 CCTTGCAGGAGACAGGCGGGTGG - Intronic
907727876 1:57036917-57036939 TCTTACAGGAAAAATGACAGTGG + Intronic
908351443 1:63289252-63289274 CCTTGCAGGCCAGAAGACAGTGG + Intergenic
910874902 1:91869253-91869275 CCTTGCTGGAATTAAGACAGTGG - Intronic
911785808 1:101945463-101945485 AGTTGCAGGAAGCAGGTCAGTGG + Intronic
911811461 1:102287287-102287309 TCTTGCAGGAAACAGTTCAATGG - Intergenic
912438681 1:109681117-109681139 GCTGGCAGGAAGCAGGCCAGAGG - Intronic
912441202 1:109699562-109699584 GCTGGCAGGAAGCAGGCCAGAGG - Intronic
912700166 1:111872185-111872207 CTTTACAGGTAAGAGGACAGAGG + Intronic
912965032 1:114229905-114229927 CCTTGGAGGAAACAGTGGAGTGG - Intergenic
913162025 1:116153117-116153139 CCTCGCAGGAACCAAGAGAGAGG + Intergenic
914224261 1:145707467-145707489 GCTGGCAGGAAGCAGGACAGAGG - Intronic
915056451 1:153135609-153135631 CCTTACAGGCAAGAAGACAGAGG + Intergenic
915727165 1:158025992-158026014 GCCTGCAGGAACCAGGGCAGGGG - Intronic
917630466 1:176886722-176886744 ACCTGCATGAAACAGGCCAGAGG + Intronic
918096694 1:181341985-181342007 CCTGGAAGGAAACAGGACAAGGG + Intergenic
920403666 1:205693344-205693366 CCCTGCAGGGAGCAGGGCAGTGG + Intergenic
920946073 1:210529679-210529701 CCTTGCTGGAAACAGTTCTGTGG - Intronic
921456982 1:215382967-215382989 TCTTGTAGGCAACAGGTCAGTGG - Intergenic
921786923 1:219242385-219242407 CCTAGCAGAGAACAGGCCAGGGG + Intergenic
921805446 1:219449003-219449025 CATTGCAGGAATCAGGGAAGAGG - Intergenic
921841698 1:219835430-219835452 TCTTGAAGGACACAGGACACAGG + Intronic
923660760 1:235955081-235955103 CCTTGCAGGAATGAGAGCAGAGG - Intergenic
924273441 1:242359213-242359235 CCTCACAGGAAACAGGAAACAGG - Intronic
1063463588 10:6229459-6229481 CCTTGCGGGTCACAGGGCAGGGG - Intronic
1064553742 10:16527730-16527752 CTTTGCAGGGACAAGGACAGAGG + Intergenic
1064573478 10:16720163-16720185 CCTTTAAAGAAACATGACAGTGG + Intronic
1064591101 10:16891510-16891532 CCTTGCTGTATTCAGGACAGTGG - Intronic
1065363730 10:24914681-24914703 CCTTGGAAGAAACAGAGCAGAGG - Intronic
1066579317 10:36862662-36862684 CCTCACAGGAAACATGGCAGTGG + Intergenic
1067128230 10:43538650-43538672 CTTTTGAGGAAACAGGACAAGGG - Intergenic
1067171771 10:43912637-43912659 GCTTGCAGGAACCAGTACTGGGG - Intergenic
1067270390 10:44786615-44786637 CCTGGAAGGAACCAGGACTGCGG + Intergenic
1067275930 10:44834140-44834162 CCTTGCAGGAAACCTCCCAGAGG - Intergenic
1069625888 10:69867451-69867473 CTTTGCAGAACACGGGACAGTGG - Intronic
1069807648 10:71136086-71136108 CCTGGCAGGAACCAGGACAGGGG + Intergenic
1069860602 10:71468806-71468828 CCCGGCAGGAGACAGGGCAGGGG + Intronic
1071292387 10:84197089-84197111 ACTTGCAGGCAACAGGGCATGGG + Intronic
1073970529 10:109042204-109042226 CCTTGGAGGAGAAAGGAAAGAGG - Intergenic
1075173176 10:120134689-120134711 GCTGGCAGAAAACAGGAGAGTGG - Intergenic
1075935119 10:126333662-126333684 CCTTGGAAGAAACAGTCCAGAGG - Intronic
1077453954 11:2666900-2666922 CTTTGCAGAAGACAGGACACTGG - Intronic
1077471076 11:2760783-2760805 CCTTGCAGGACATGTGACAGGGG + Intronic
1077487815 11:2847113-2847135 CCTTGCAGAAAGCATCACAGAGG + Intronic
1080651159 11:34223628-34223650 CCTTGCAGGCAGCAGGCCTGGGG + Intronic
1080885452 11:36363584-36363606 CCTTGCAGGAAACCTGCCCGGGG - Intronic
1081580632 11:44349228-44349250 GCTGGCAGAAAACAGGAAAGAGG - Intergenic
1083229861 11:61309901-61309923 GCTTGCAGGAAACCAGACTGAGG + Exonic
1083547563 11:63560303-63560325 ACCTGCAGGAAACAGGAAGGAGG + Intronic
1085070379 11:73538634-73538656 CCTTGCTGGTAACAGGAAATTGG + Intronic
1085393090 11:76192505-76192527 CCTTGCACGAAAGAAGACAGAGG - Intronic
1085823977 11:79823398-79823420 CCTGGAAGGAAATAGGCCAGAGG - Intergenic
1088906069 11:114156329-114156351 CCTTACAGGAAGCTGCACAGTGG + Exonic
1089021654 11:115221842-115221864 CCTGGCAGGAGACATGCCAGCGG + Intronic
1090313329 11:125763045-125763067 CTTTGCAGGCAAGAAGACAGTGG - Intergenic
1091295556 11:134471886-134471908 CATTGCAGGAGAGAGGACAGGGG - Intergenic
1091752577 12:3032091-3032113 CCTTCCAGAAAATAGGGCAGTGG + Intronic
1092081342 12:5718870-5718892 CCATGCAGGAAACTGCACGGTGG - Intronic
1092426877 12:8382006-8382028 CCTTGCAGGCAACTGCACTGAGG - Intergenic
1095261703 12:40105796-40105818 CCTTGCGGGACATAGGGCAGGGG + Exonic
1096445982 12:51692187-51692209 CCTTGCAGGCTCCAGGTCAGTGG - Intronic
1096828333 12:54295966-54295988 CCTGTGAGGACACAGGACAGAGG - Intronic
1096871181 12:54593276-54593298 CCTAGCAGGAGCCAGGGCAGTGG + Intergenic
1097290895 12:57914033-57914055 CCTTGCAGGACATGTGACAGGGG - Intergenic
1100049606 12:90431503-90431525 CCTTGTATGAAACAAGATAGTGG - Intergenic
1102018459 12:109664232-109664254 CCTTCAAGGAGACAGAACAGAGG + Intergenic
1102057622 12:109908402-109908424 CCTTGCAGGAAATGGCTCAGAGG + Intronic
1102298302 12:111753900-111753922 CCTGGCAGGAAACAAGGTAGGGG + Exonic
1102523915 12:113497479-113497501 CCTTGTAGGCAAGAGGGCAGAGG - Intergenic
1103979053 12:124724208-124724230 AGTTGCAGGAACCAGGGCAGGGG + Intergenic
1108090049 13:46839986-46840008 TCTTGTAGGGAACAGGACAGTGG + Intronic
1109589819 13:64463255-64463277 CCTTGCAGGATATGTGACAGGGG - Intergenic
1111239012 13:85450693-85450715 CTTTGCAGCAATCATGACAGTGG + Intergenic
1113383095 13:109821360-109821382 CCTTGAAGGAGACAGGAGGGAGG - Intergenic
1113459132 13:110469533-110469555 TCTTGCAGGAAAAAGGAGACAGG + Intronic
1115224424 14:31088195-31088217 CCTGAAAGGAAACAGGAAAGTGG - Intronic
1115595024 14:34901113-34901135 ACTTGTAGGAAACAAGACATGGG + Intergenic
1116962219 14:50978141-50978163 CCTTGCAGGGAGAAGGGCAGGGG + Intronic
1117251154 14:53940060-53940082 CCATGAAGAAAACAGTACAGAGG + Intergenic
1117496786 14:56313421-56313443 CATTGCAGCAGACAGGAGAGCGG + Intergenic
1117517022 14:56512028-56512050 CCTTGAAGGGAAAAGGACAGTGG - Intronic
1118045209 14:61962338-61962360 CCTTGCAGGACAGAAGACAATGG - Intergenic
1119545672 14:75469737-75469759 ACTTGAAGGAGGCAGGACAGAGG + Exonic
1119909266 14:78334962-78334984 CCATGAAGGAAACAGGAATGGGG + Intronic
1120713383 14:87815915-87815937 CCTTGCAGGACATGAGACAGGGG - Intergenic
1120968954 14:90191637-90191659 CCTTGCAGGAGCAAGGAGAGGGG + Intergenic
1121064932 14:90953919-90953941 CTTTTGAGGAAACAGGACAAGGG - Intronic
1121081809 14:91114546-91114568 CCTTGCAGGAGAGAGAACAGAGG - Intronic
1121187406 14:91987323-91987345 TCCAGCAGGAGACAGGACAGGGG - Intronic
1121662198 14:95643629-95643651 GCTTGCAGAAAACAGGTCATGGG + Intergenic
1122757510 14:103993911-103993933 GCTTTCAGCAAACAGGACGGAGG + Intronic
1122960466 14:105091711-105091733 CCTTGCAGGGACCAGGGCACCGG + Intergenic
1122999197 14:105283215-105283237 GTCAGCAGGAAACAGGACAGGGG + Intronic
1123608945 15:22068896-22068918 CCTTGCAGAGAAAAGGAGAGTGG - Intergenic
1123932859 15:25180243-25180265 CCATGCAGGAAAGTGGGCAGGGG - Intergenic
1123935294 15:25191174-25191196 CCATGCAGGAAAGTGGGCAGGGG - Intergenic
1124223575 15:27870274-27870296 CATGGCAGGACACAGGACAGGGG - Intronic
1124587518 15:31023382-31023404 CCTTGCAGGCCTGAGGACAGTGG + Intronic
1125169997 15:36756010-36756032 CCTTGCTGGACTCAGCACAGAGG - Intronic
1125182049 15:36888592-36888614 CCTAGGAGGAGGCAGGACAGAGG - Intergenic
1125405674 15:39350806-39350828 CATTTCAGGCAATAGGACAGTGG - Intergenic
1125767595 15:42145765-42145787 CCTTGCAGGTAACAGATCCGGGG + Exonic
1126294806 15:47128080-47128102 CCTTACAGGCCACAGGAGAGTGG - Intergenic
1128976889 15:72160866-72160888 CAGTGCAGGAACCAGGCCAGGGG - Exonic
1129118797 15:73382377-73382399 CCCTGCAGGAAATAGGAGCGAGG - Intergenic
1130089310 15:80806490-80806512 TCTTCCAGGAACCAGGAAAGAGG + Intronic
1132142179 15:99405272-99405294 TCTTGCAGAAGACAGGCCAGAGG + Intergenic
1202981186 15_KI270727v1_random:360696-360718 CCTTGCAGAGAAAAGGAGAGTGG - Intergenic
1133371382 16:5248358-5248380 CCTTGCAGGCAACTGCACTGAGG + Intergenic
1133715701 16:8445972-8445994 CCTTTCAGGAAAAAGGAAACTGG + Intergenic
1135540999 16:23330418-23330440 CCTTGGAAGGAACAGGAAAGAGG + Intronic
1135917043 16:26614556-26614578 GCTGGCAGGAAACAGGAAAGAGG + Intergenic
1135952262 16:26925994-26926016 CCTTGCAGGCTAGAGGGCAGTGG + Intergenic
1136459075 16:30398687-30398709 CCTTGCCGCATTCAGGACAGAGG - Exonic
1136471501 16:30483812-30483834 CTTTCCTGGACACAGGACAGAGG + Exonic
1136614727 16:31391185-31391207 CCTTGCAGGAAACCGAGCCGAGG - Intergenic
1138013519 16:53407612-53407634 ATTTGAAGGAAAGAGGACAGGGG - Intergenic
1139953150 16:70681529-70681551 GCTTCCAGGACACAGGGCAGGGG - Intronic
1142340249 16:89517306-89517328 CCTTCCAGGAACCATGACAACGG - Intronic
1142340257 16:89517345-89517367 CCTTCCAGGAACCATGACAACGG - Intronic
1142790201 17:2258191-2258213 CCTTACAGAAAACAGCAAAGAGG + Intronic
1143102769 17:4513405-4513427 CTTTCCAGGAGTCAGGACAGGGG - Intronic
1144497869 17:15760555-15760577 ACTTGGAGGAAACAGGAAACAGG - Intergenic
1144605424 17:16661102-16661124 ACTTGGAGGAAACAGGAAACAGG + Intergenic
1145161243 17:20575605-20575627 ACTTGGAGGAAACAGGAAACAGG - Intergenic
1145221995 17:21097071-21097093 CCTTGCAGGAAAGAGGATGTGGG + Intergenic
1145938303 17:28727492-28727514 CCTTGCGAGAGCCAGGACAGGGG + Intronic
1147761493 17:42800305-42800327 CCTTGAAGGAAGGAGGACATTGG + Intronic
1148017161 17:44530030-44530052 ACCAGCAGGGAACAGGACAGGGG + Intergenic
1149309367 17:55379046-55379068 CCTTGAAGGAAGGAGGAAAGGGG + Intergenic
1150931464 17:69589904-69589926 CCTTGCAGGACATGTGACAGGGG + Intergenic
1151113974 17:71712490-71712512 CCTTGCACAATACAGGACATTGG - Intergenic
1151885719 17:76922313-76922335 CCTTGCAGAAACCAGGAAGGGGG - Intronic
1152082606 17:78197703-78197725 CCTTCCAGGGAACAGGTCAAAGG + Intronic
1152853765 17:82652032-82652054 CCTTACAGGAAAGAGGGAAGGGG + Intergenic
1152904366 17:82962200-82962222 CCTGGGAGCAAACAGGCCAGCGG - Intronic
1152949907 17:83223064-83223086 CCTGGCAGTAAACAGGTCACAGG - Intergenic
1155314470 18:24557979-24558001 CCTCGCAGGACATACGACAGGGG + Intergenic
1155890118 18:31257429-31257451 CCTTGAATGAAGGAGGACAGTGG + Intergenic
1156197672 18:34793946-34793968 CCTAGAAAAAAACAGGACAGAGG + Intronic
1157848749 18:51028533-51028555 CCTTGCAGGCTACAGGACTGAGG - Intronic
1158395799 18:57077586-57077608 CCTTTCAGGAAAGAAGAAAGGGG - Intergenic
1158540659 18:58350879-58350901 CCTAGCAGAAAAGAGTACAGAGG + Intronic
1158950374 18:62488784-62488806 CTTAGCATGAATCAGGACAGTGG + Intergenic
1158958600 18:62567511-62567533 CCTGGCAGGAGCCAGCACAGAGG - Intronic
1162178108 19:8846887-8846909 CCTTGCAGGACATGTGACAGGGG + Intergenic
1162574893 19:11493550-11493572 CCCTGCAGAATACAGGACAAGGG - Intronic
1163744266 19:19035556-19035578 CCTTGGAGGACTCAGGTCAGGGG + Intronic
1163745511 19:19044128-19044150 CCATCCAGGAAACAGGGAAGAGG - Intronic
1163761030 19:19136979-19137001 CCTGGCAGGTCACAGGAGAGAGG - Intronic
1164903113 19:31945055-31945077 CCTTGGGAGAAACAGGAAAGTGG + Intergenic
1165173897 19:33913320-33913342 GACTGCAAGAAACAGGACAGAGG + Intergenic
1165225439 19:34351506-34351528 TCTTGCAGGAAACACAGCAGTGG + Exonic
1165952659 19:39482877-39482899 CCTTGCAGGAAACAACCCGGTGG + Exonic
1166403524 19:42502261-42502283 CCTGGCCGACAACAGGACAGTGG + Intergenic
1166570208 19:43790936-43790958 CCATGCAGGAGACAGGCCCGAGG - Intergenic
1166732530 19:45067239-45067261 CCTTGCAGGAAGGAGGACTGTGG + Intronic
1168184705 19:54692158-54692180 CATTACAGGAAACAGTACATAGG + Intronic
926235602 2:11041124-11041146 TCTTGCAGGAAACATGAAAAAGG + Intergenic
926745975 2:16158740-16158762 CCTTGCTTGAAACCTGACAGAGG + Intergenic
928441513 2:31295939-31295961 CCTTGCAGGATATGTGACAGGGG - Intergenic
928753450 2:34496498-34496520 CCTTACAAGAAAAAGAACAGAGG + Intergenic
928792993 2:34981115-34981137 CCTGCCAGGAAACTGGCCAGAGG + Intergenic
929282056 2:40091171-40091193 CCATGCAGGTATCAGGACACAGG - Intergenic
929330137 2:40672995-40673017 CCTTGGAGGAAAGAGGCGAGAGG - Intergenic
929565980 2:42985175-42985197 CCTTCCAGCCATCAGGACAGGGG - Intergenic
930436830 2:51355060-51355082 CCTTGCAGATAACTGGAAAGAGG - Intergenic
930903541 2:56537383-56537405 ATTTACAGAAAACAGGACAGAGG + Intergenic
932224928 2:70032035-70032057 CCTTGGAGGACACATGACTGTGG - Intergenic
932478825 2:72025960-72025982 GCTTTCAGGAAACAGGGCAGAGG - Intergenic
933901639 2:86854527-86854549 CCATCCAGGAGTCAGGACAGGGG - Intronic
935214345 2:100964339-100964361 ACTTGCAGGAAACGGGGCAGGGG - Intronic
935778910 2:106494741-106494763 CCATCCAGGAGTCAGGACAGGGG + Intergenic
935955214 2:108369503-108369525 CTTTCTAGGGAACAGGACAGGGG + Intergenic
937085409 2:119168730-119168752 GCTTGCAGGAGGGAGGACAGTGG - Intergenic
937684767 2:124683304-124683326 CATTACAGGAAACAAGCCAGTGG + Intronic
937914626 2:127092808-127092830 CCATGAAGGAGAGAGGACAGAGG + Intronic
938590972 2:132735828-132735850 AGTTGCAGGAAATAGGCCAGAGG + Intronic
940071906 2:149698166-149698188 CCTTGAAGGAAGCAGTGCAGTGG + Intergenic
941115850 2:161471612-161471634 CCTCGCAGGAAACATAACTGGGG - Intronic
941707639 2:168676936-168676958 CTTAGCAGGAAACAAGACAGTGG - Intronic
945377629 2:209097417-209097439 CCTTGCAGGACATGTGACAGGGG - Intergenic
945468472 2:210199526-210199548 CCATGAAGGAAATAGGAAAGTGG - Intronic
945714641 2:213343124-213343146 CCTGGCAGGAAACAGCACCTGGG + Intronic
946623183 2:221580913-221580935 GGTTGCAGGAAAATGGACAGTGG - Intergenic
947091089 2:226512237-226512259 CTTGGCAGGGAAAAGGACAGAGG - Intergenic
948207868 2:236172416-236172438 CCATGCAGAAAGCAGGACAGGGG + Intergenic
948378319 2:237536795-237536817 CCGGGCAGGCTACAGGACAGCGG - Intronic
948389218 2:237600069-237600091 CGTTGAAGGACACTGGACAGTGG - Intronic
948779038 2:240305788-240305810 CTCAGCAGGAATCAGGACAGCGG + Intergenic
1169522591 20:6389558-6389580 ACTGGCAGGAAACAGGAGTGAGG - Intergenic
1170403973 20:16017118-16017140 ACTTGGAGGAAAGAGGGCAGTGG - Intronic
1170507945 20:17047888-17047910 CCCTGCAGGAAACACAAAAGAGG + Intergenic
1170596691 20:17811051-17811073 CCTTGCTTGACACAGGGCAGAGG - Intergenic
1171233874 20:23509036-23509058 CCATGCGGAAAAGAGGACAGAGG + Intergenic
1171369174 20:24649716-24649738 ACTTTCAGGAAACAGGACTGGGG - Intronic
1172416531 20:34773409-34773431 CCTTGCAGCAGACACGATAGTGG + Intronic
1173369993 20:42426779-42426801 CCTTGCAGGACACACAACAGGGG - Intronic
1173443536 20:43097815-43097837 CCTTAGAGGAAACAGCACAGGGG + Intronic
1173595197 20:44254486-44254508 CCTTGCAGGAGGCAGGAGACAGG - Intronic
1174672224 20:52318881-52318903 GCTGGCAGGATAAAGGACAGAGG + Intergenic
1174799977 20:53555329-53555351 CCCTGCAAGTAACAGGAAAGTGG + Intergenic
1174875432 20:54222435-54222457 GTTTGCAGGAAGCAGGGCAGAGG + Intronic
1175329878 20:58156225-58156247 CCATGGAGGAAACAGGCCGGTGG + Intronic
1175333293 20:58179141-58179163 CATTGCCACAAACAGGACAGGGG + Intergenic
1175733033 20:61366996-61367018 CATTGCAGGCAACGAGACAGCGG + Intronic
1175738365 20:61403097-61403119 CCATGCAGGAAAAAGGAGAAAGG - Intronic
1175943266 20:62547533-62547555 CCTTGCAGGTCAGAGGTCAGAGG - Intergenic
1178422299 21:32452341-32452363 CCTTGCAGGGCACGTGACAGGGG + Intronic
1178725935 21:35051722-35051744 ACTTGCAGGAACTAGGACAGAGG - Intronic
1180128737 21:45810708-45810730 CCTTTCAGAAAACAGGGAAGAGG - Intronic
1180945207 22:19688812-19688834 CCTTCAAGGAAACAGGCCCGGGG - Intergenic
1181053437 22:20248375-20248397 GCTGGCTGGAAACAGGACTGTGG - Intronic
1182659853 22:31917482-31917504 TCCTGCAGGAACCAGGAGAGTGG + Intergenic
1183439676 22:37816121-37816143 CCTTGCAGGGACCAGGCCCGAGG - Intronic
1183455666 22:37921950-37921972 CCTGGCAGGGGACAGGACAGGGG - Exonic
1183490619 22:38113653-38113675 CCCTGTTGGGAACAGGACAGGGG + Exonic
1184199796 22:42960386-42960408 TCATGCAGGAGACAGGACTGGGG + Intronic
1184795157 22:46727923-46727945 CCTCTCAGGAAACAGGGCTGTGG + Intronic
1185370520 22:50458885-50458907 ACTGGGAGGGAACAGGACAGAGG + Intronic
949399570 3:3651874-3651896 CCTGGCAGGAATCCAGACAGGGG - Intergenic
951706278 3:25547141-25547163 GCCTGCAGGAAACAGAACATGGG - Intronic
951850367 3:27133093-27133115 CCTTGCAGTAGGGAGGACAGTGG - Intronic
952776154 3:37048492-37048514 GCTTGCAGGAAAAAGGACAAGGG - Intronic
954134312 3:48575125-48575147 CCCTGCAGGAAACAAGAAAATGG + Exonic
954904027 3:54044380-54044402 CCTTCCAGGAAACAGAAGAGAGG - Intergenic
955169609 3:56550464-56550486 CCTTGCAGCAAACAGAATAATGG - Intergenic
955631462 3:60979778-60979800 GCTTGCAGGAGAGAGAACAGCGG - Intronic
955789152 3:62570539-62570561 CCTGGCAGGAGACTGGGCAGGGG + Intronic
957485693 3:80859208-80859230 CCTTACAGGCAAGAAGACAGTGG + Intergenic
958524641 3:95240448-95240470 CCTTGCAGGATTTATGACAGGGG + Intergenic
960231233 3:115230000-115230022 CCTGGGAGGAAGAAGGACAGAGG - Intergenic
961282558 3:125775388-125775410 CCTTGCAGGCAACTGCACTGAGG + Intergenic
961524125 3:127485839-127485861 CCTTGCAGGGAAATGGACAAGGG - Intergenic
963732882 3:148989836-148989858 CGTTGTAGGAAACAGAAAAGTGG - Intergenic
965065113 3:163838861-163838883 CCTTGCAGGATATGCGACAGGGG + Intergenic
965862599 3:173165083-173165105 CAGTGAAGGAAACATGACAGGGG - Intergenic
966531597 3:180987894-180987916 CCTTGCAGGAAGCAGGAGAATGG + Intronic
966809991 3:183835102-183835124 AGTTGCAGGAAATAGTACAGAGG - Intronic
967610414 3:191499426-191499448 CATTGCAGAAAACAGCAAAGTGG + Intergenic
969015168 4:4099012-4099034 CCTTGCAGGCAACTGCACTGAGG - Intergenic
972320654 4:37970702-37970724 CCTTGCAGGAAATAGCAAAATGG - Intronic
973099612 4:46249331-46249353 ATTTGCAGTAAACAGGAAAGAGG + Exonic
973815431 4:54614774-54614796 CCTGGCAGGTGACAGAACAGGGG + Intergenic
974021801 4:56698209-56698231 CCTTGCAGCAAAGAAGAAAGAGG + Intergenic
975190255 4:71452221-71452243 CCTTTCAGAATAAAGGACAGAGG - Intronic
975580975 4:75906703-75906725 CCTTGCAGGACACTCAACAGGGG - Intergenic
976407556 4:84677395-84677417 CCCTGCAGGAGACACGACAGAGG + Exonic
979529239 4:121751251-121751273 CCATGCAGGCAGCAGGAAAGAGG + Intergenic
979733867 4:124057389-124057411 TATTGCAGGAAGCAGGACAAAGG - Intergenic
982089683 4:151869501-151869523 CCTGGCAGGAGACAGGAAACAGG + Intergenic
983471886 4:168167159-168167181 CCAAGCAGGATAAAGGACAGGGG - Intronic
983661089 4:170131403-170131425 CCTTGCCGGGAAATGGACAGAGG - Intergenic
984389587 4:179111641-179111663 TCTTAAATGAAACAGGACAGTGG + Intergenic
986159891 5:5218327-5218349 CCTTGCAGGACATGAGACAGGGG + Intronic
986432148 5:7691828-7691850 CCTTACAGGAAGCATGACTGGGG + Intronic
986805448 5:11304628-11304650 CCTTGCAAGAAAGGGGCCAGGGG + Intronic
989217739 5:38922631-38922653 CTTTGCTGGAGACAAGACAGTGG + Intronic
990250858 5:53913446-53913468 ACTCACAAGAAACAGGACAGAGG - Intronic
992637185 5:78736113-78736135 CCTTGCAGGAAGTGTGACAGGGG - Intronic
993011747 5:82491092-82491114 CCTTGGAGGAAAGAGGAGAATGG - Intergenic
993533356 5:89050463-89050485 CTTTTGAGGAAACAGGACAAGGG - Intergenic
994425338 5:99577560-99577582 CCTAACAGGAAACATGACTGGGG - Intergenic
995278962 5:110310579-110310601 GGTTGCAGGACACAGGAGAGGGG - Intronic
995419955 5:111953293-111953315 CATTGCAGCAAACATGGCAGTGG + Intronic
996648589 5:125845887-125845909 CCTTGCAGGACATGTGACAGGGG - Intergenic
997106428 5:131024351-131024373 CATTTCAGGCAGCAGGACAGAGG + Intergenic
997741552 5:136259284-136259306 CATGGCAGGAGACAGCACAGTGG - Intronic
998901719 5:146862568-146862590 CCTTGCAGGTACCAGGGAAGGGG + Intronic
999986190 5:157007637-157007659 CCATGCTGGAATCTGGACAGTGG + Intergenic
1000203447 5:159034558-159034580 CCTCGCTGGAAGCAGGTCAGGGG - Intronic
1001768371 5:174272989-174273011 CCTAGAAGGATACAGGTCAGAGG + Intergenic
1002459912 5:179368199-179368221 GCTGGCAGGAAGCAGGGCAGGGG - Intergenic
1002666451 5:180829200-180829222 CCTCTGAGGAAACAGGACAAAGG - Intergenic
1002666457 5:180829249-180829271 CCTCTGAGGAAACAGGACAAAGG - Intergenic
1002744139 5:181456876-181456898 CCTGGCAGTAAACAGGTCACAGG - Intergenic
1004758254 6:18637371-18637393 CCTTGCAGGAAAGAGGAACCAGG - Intergenic
1004759224 6:18647812-18647834 TCTTGCAGGAGACAGGGGAGGGG - Intergenic
1005425748 6:25701089-25701111 CCTTGAAGGAGACAGGCCACAGG - Intronic
1005754006 6:28909436-28909458 CCTTCCAGGAACTAGGACAGGGG + Intronic
1006286075 6:33095473-33095495 ACTTCCAGGAAAGAGGAGAGGGG + Intergenic
1006817747 6:36864383-36864405 CCTGGCAGGAAACAGCACAGGGG - Intronic
1011149075 6:84248983-84249005 CCTTGCAGGAAGAAGAAGAGAGG - Intergenic
1012795047 6:103748982-103749004 CCTTGCAGGACATGTGACAGGGG - Intergenic
1013251846 6:108342188-108342210 CCTTGCAGGAAACAGGACAGAGG - Intronic
1013285450 6:108677414-108677436 CACAGCAGGAAAGAGGACAGAGG - Intronic
1013606714 6:111756969-111756991 ACCTGCAGGAAATAGCACAGGGG - Intronic
1014533244 6:122585733-122585755 GCTTGGAGGAAGCAGGATAGTGG - Intronic
1015635624 6:135271247-135271269 CCTGGCAGCAAAGAGGAAAGGGG + Intergenic
1017682400 6:156877422-156877444 ACCTGAAGGAAACAGGAGAGGGG - Intronic
1017697918 6:157037395-157037417 CCATGCAAGAAACATGCCAGAGG + Intronic
1018078659 6:160239619-160239641 CATGGCAGGAAGGAGGACAGAGG + Intronic
1018526302 6:164713589-164713611 CTGTGCAGGAAACATGACTGGGG - Intergenic
1019248998 6:170730105-170730127 CCTGGCAGTAAACAGGTCACAGG - Intergenic
1020231398 7:6321837-6321859 CCTTGCAGGATGGAGGGCAGTGG + Intergenic
1022823077 7:33980490-33980512 CTTTTCAGGAAACAGGATGGTGG + Intronic
1022825208 7:34003997-34004019 CCTGGAAGGAAACAGGAAAAAGG - Intronic
1024227844 7:47341277-47341299 CCTTCCAGAAAACAGAAGAGGGG - Intronic
1026005572 7:66597754-66597776 TCCTGCAGGTAACTGGACAGGGG + Intergenic
1026012529 7:66647934-66647956 TCCTGCAGGCAACTGGACAGGGG - Intronic
1026225246 7:68434634-68434656 CCTGGCAGGAAACAAGGCACTGG - Intergenic
1026457665 7:70586879-70586901 ACTTGCAGGAAACAGGAAGGAGG + Intronic
1026631823 7:72044362-72044384 CCATGCAGAAAAGAAGACAGGGG - Intronic
1026967247 7:74448052-74448074 CCTTGAAGGAAACATGCCAAGGG - Intergenic
1029073846 7:97920672-97920694 CCTTGCAGGCAACTGCACTGAGG - Intergenic
1031362414 7:120862503-120862525 CCTAGCAGTGAACAGGAGAGAGG - Intergenic
1031957429 7:127956599-127956621 CAGTGCAGGAAACAGGACTTAGG - Intronic
1032126860 7:129201612-129201634 ACTTGCAGAAAACAGAGCAGTGG - Intronic
1032609285 7:133393692-133393714 CCATCTATGAAACAGGACAGGGG + Intronic
1034732906 7:153403402-153403424 CCTGGCATGAAACAGAGCAGGGG + Intergenic
1035499046 8:77230-77252 CCTGGCAGTAAACAGGTCACAGG + Intronic
1036256931 8:7213427-7213449 CCTTGCAGGCAACTGCACTGAGG - Intergenic
1036308981 8:7672026-7672048 CCTTGCAGGCAACTGCACTGAGG - Intergenic
1036360553 8:8074086-8074108 CCTTGCAGGCAACTGCACTGAGG + Intergenic
1036890417 8:12592881-12592903 CCTTGCAGGCAACTGCACTGAGG - Intergenic
1036897988 8:12650799-12650821 CCTTGCAGGCAACTGCACTGAGG - Intergenic
1037363506 8:18098144-18098166 CTTTGCAGGACTCACGACAGGGG - Intergenic
1039306278 8:36266971-36266993 CCTTGCAGGACAAGTGACAGAGG + Intergenic
1039724477 8:40201026-40201048 CCATTAAGGAAACAGGACTGTGG + Intergenic
1041550642 8:59096966-59096988 CATTGCTGGAAACAGGATAGAGG + Intronic
1042441927 8:68838837-68838859 CCTTGCAGGAACTAGGACACAGG + Intergenic
1043253145 8:78101265-78101287 TCCTGTAGGATACAGGACAGTGG + Intergenic
1045321996 8:101089211-101089233 CCATGCAGGAAACAGGGGAGAGG + Intergenic
1045481346 8:102594476-102594498 CCTTGCAGGACGTTGGACAGGGG - Intergenic
1047079160 8:121441144-121441166 CCTTTAAGAAAACAGGACAATGG + Intergenic
1049503727 8:142983427-142983449 CCTTGCAGGAAGCAGGACTTTGG - Intergenic
1051575627 9:18612106-18612128 CCTAGCAGGAAAGAAGTCAGAGG + Intronic
1051603338 9:18896381-18896403 CCTTGCAGGACAGAAGGCAGTGG + Intronic
1054748524 9:68880749-68880771 GCTTGCAAGAAACAGAACAAAGG + Intronic
1054928176 9:70609258-70609280 CCTTGCAGAAAACAGCTTAGTGG - Intronic
1057579642 9:96275045-96275067 CCTTGCAGGCAAAAAGAGAGTGG + Intronic
1058136821 9:101316667-101316689 CTTGGCAGGAAACAGAAAAGTGG + Intronic
1058473712 9:105307884-105307906 CCTTGGAGGAGTCAGGAGAGGGG + Intronic
1059628137 9:116090213-116090235 CTTTGCAAGAAATAGGACAGGGG + Intergenic
1060050934 9:120377669-120377691 CCTTGTAAGAAACGGGAGAGAGG - Intergenic
1061908751 9:133711945-133711967 TCTTGCAGAGCACAGGACAGTGG - Intronic
1062184519 9:135210856-135210878 CCTTGCAGGAGACTGGGGAGAGG - Intergenic
1062454531 9:136629383-136629405 CCCAGCTGGACACAGGACAGAGG - Intergenic
1203609953 Un_KI270748v1:87369-87391 CCTGGCAGTAAACAGGTCACAGG - Intergenic
1187471090 X:19570330-19570352 CCTTGGAGGAAAAGGGAGAGAGG + Intronic
1187845170 X:23527697-23527719 TCTTGTAGGAAACAGATCAGTGG - Intergenic
1188733808 X:33686453-33686475 CCTTGAAGGAAACAGATCAATGG + Intergenic
1188807167 X:34605465-34605487 CCTTGCAGGACATGCGACAGGGG - Intergenic
1189520234 X:41759407-41759429 CTTAGAAGGATACAGGACAGGGG - Intronic
1190060492 X:47208462-47208484 CTTGGCAGAAAACAAGACAGAGG - Intronic
1191943725 X:66506318-66506340 CCTTGCAGGCCAGAAGACAGTGG + Intergenic
1193385211 X:80862236-80862258 TCTTGCAGGAAACAGGTAAGTGG + Intergenic
1193815531 X:86101191-86101213 CACTGCAGGAAATTGGACAGAGG + Intergenic
1196242808 X:113363480-113363502 CCTTGCGGGCAACAGGTCATTGG + Intergenic
1198139112 X:133785004-133785026 CCCTGCAGGAAACAGATCAGTGG + Intronic
1199411426 X:147528376-147528398 CCTTTCAAGAAAGAGGACAATGG + Intergenic
1199852650 X:151736626-151736648 GCTTGCTGGAAACAAGGCAGTGG - Intergenic
1201850086 Y:18470785-18470807 CCTTGCAGTGAAATGGACAGAGG + Intergenic
1201883232 Y:18849592-18849614 CCTTGCAGTGAAATGGACAGAGG - Intergenic