ID: 1013251848

View in Genome Browser
Species Human (GRCh38)
Location 6:108342195-108342217
Sequence AGGCATTCCTTGCAGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013251848_1013251852 -1 Left 1013251848 6:108342195-108342217 CCTGTTTCCTGCAAGGAATGCCT 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251848_1013251857 15 Left 1013251848 6:108342195-108342217 CCTGTTTCCTGCAAGGAATGCCT 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1013251857 6:108342233-108342255 AGCCAGGAGCCAGCCAGAAAGGG No data
1013251848_1013251861 27 Left 1013251848 6:108342195-108342217 CCTGTTTCCTGCAAGGAATGCCT 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1013251861 6:108342245-108342267 GCCAGAAAGGGCAGTCGCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1013251848_1013251856 14 Left 1013251848 6:108342195-108342217 CCTGTTTCCTGCAAGGAATGCCT 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1013251856 6:108342232-108342254 CAGCCAGGAGCCAGCCAGAAAGG 0: 1
1: 0
2: 3
3: 36
4: 366
1013251848_1013251860 26 Left 1013251848 6:108342195-108342217 CCTGTTTCCTGCAAGGAATGCCT 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1013251860 6:108342244-108342266 AGCCAGAAAGGGCAGTCGCTTGG No data
1013251848_1013251863 28 Left 1013251848 6:108342195-108342217 CCTGTTTCCTGCAAGGAATGCCT 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1013251863 6:108342246-108342268 CCAGAAAGGGCAGTCGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013251848 Original CRISPR AGGCATTCCTTGCAGGAAAC AGG (reversed) Intronic
904007905 1:27373462-27373484 AGGCAGCCCTTGCAGGAGCCAGG - Intronic
906517639 1:46448852-46448874 CGGCCGTCCTGGCAGGAAACTGG + Intergenic
907343144 1:53751801-53751823 ATGCCTTCCTTCCAGGCAACAGG - Intergenic
909658918 1:78061128-78061150 AGGAAACCCTTTCAGGAAACAGG - Intronic
911726084 1:101242482-101242504 TGGCATTTCCTTCAGGAAACTGG - Intergenic
915056276 1:153134009-153134031 AAGCATGCCTTCCAGGAACCTGG + Intergenic
920679120 1:208059330-208059352 ACTCATTCCTTGCAGGAATAAGG + Intronic
923030593 1:230246450-230246472 AAGCCCTCCTTGCAGGAATCTGG + Intronic
924531986 1:244901149-244901171 AGGCCTTGCTTGAAGGAAAGTGG - Intergenic
1066604559 10:37148495-37148517 AGGCATTCTAGGCAGGTAACGGG + Intronic
1067825349 10:49568167-49568189 AGACTCTCCTGGCAGGAAACAGG - Intergenic
1067898677 10:50214905-50214927 TGGCATTCATTACAGGAAATAGG - Intronic
1070416932 10:76199372-76199394 AGCCAGTCCATGGAGGAAACGGG - Intronic
1071337837 10:84615990-84616012 AGGAATGCCTTGCTGAAAACTGG + Intergenic
1072318741 10:94228341-94228363 AGGTATTCCTTGGGGGAATCAGG - Intronic
1072553304 10:96495209-96495231 TGGAATTCCTCTCAGGAAACAGG + Intronic
1075721628 10:124590908-124590930 AGGCCTCCTTTCCAGGAAACAGG + Intronic
1078852326 11:15176060-15176082 AGGAACTCCTTGAAGGAAATGGG + Exonic
1079470165 11:20770461-20770483 AGGCTTTCCGGACAGGAAACAGG - Intronic
1080587301 11:33693661-33693683 ACGCATTTCCTGCAGGAACCTGG + Intergenic
1080790627 11:35519612-35519634 AGCCATTCCCTAGAGGAAACAGG - Intronic
1082172707 11:49025449-49025471 ATCCATTCCATACAGGAAACAGG + Intergenic
1085420572 11:76354882-76354904 AGGTATTCTGTGCACGAAACAGG - Intronic
1086385374 11:86302112-86302134 AGGCTTACCTTCCCGGAAACTGG + Intergenic
1092883947 12:12909576-12909598 AGGCATTCCTTCCAGAAATGTGG + Intronic
1094056495 12:26274119-26274141 AGGCCTTCTCTGCATGAAACAGG + Intronic
1098084218 12:66824385-66824407 AGTCATTCCTTGCATGGCACTGG + Intergenic
1101416957 12:104516752-104516774 AGGCATGCCTTGCTGTAAAGAGG + Intronic
1104727988 12:131089327-131089349 AGGCATTGCCTTCAGGGAACGGG + Intronic
1108189569 13:47923796-47923818 AGGCCTTTCTTGCAGGAGTCAGG - Intergenic
1108714988 13:53070060-53070082 CGGCATTACATCCAGGAAACAGG - Intergenic
1109699568 13:66008407-66008429 AAGCATTCTTTGGAGAAAACAGG - Intergenic
1109919749 13:69040705-69040727 ATACATTTCTTGAAGGAAACAGG + Intergenic
1111806614 13:93046013-93046035 AGGGATTCTGTGCAGGAAGCAGG + Intergenic
1113817407 13:113183063-113183085 AGGAATTCCTAGCAGTAAAATGG + Intronic
1115074730 14:29374329-29374351 AGTCATTTCATACAGGAAACAGG + Intergenic
1115773487 14:36689956-36689978 AAGCTTTCCTTGGTGGAAACAGG + Intronic
1119875213 14:78053703-78053725 AGGCTTTCCTTGCACAGAACTGG - Intergenic
1121098894 14:91236214-91236236 AGGCTGTGCTTGCGGGAAACTGG - Intronic
1123018918 14:105388515-105388537 GAGAATCCCTTGCAGGAAACAGG - Intronic
1123120002 14:105912060-105912082 TGGCCTTCCTTGCAGGAATGAGG + Intergenic
1124241513 15:28032065-28032087 AGGAATTCCTTACAGGAGAAAGG - Exonic
1124892908 15:33749283-33749305 AGGCAATCATTGCAGGATATAGG + Intronic
1125060644 15:35418452-35418474 AGACATTCCTTGATGGAAGCTGG + Intronic
1125163781 15:36678790-36678812 AGGCATTCTTTGCAGTAGGCAGG + Intronic
1125306477 15:38321941-38321963 AGGAATTACTTCCAGGAAACAGG - Intronic
1126361263 15:47848386-47848408 AGCCATTCCTAGCAACAAACAGG + Intergenic
1126791984 15:52229956-52229978 AGGTATTCGCTGAAGGAAACTGG - Intronic
1130963309 15:88679406-88679428 AGGCCCTCCTTGCAGGGAGCAGG + Intergenic
1131275729 15:90978929-90978951 AGGCATTTCTTGCATGAATGAGG - Intronic
1132174837 15:99703874-99703896 AGACATTCCTTTTAGTAAACAGG - Intronic
1132175489 15:99710954-99710976 AGGCATTCCTTGAAGGGATTTGG + Intronic
1133674895 16:8061760-8061782 AACAATTCCTTGCATGAAACTGG - Intergenic
1134747748 16:16601091-16601113 AGGCATTCCTGGGAGGAGATGGG - Intergenic
1138618982 16:58197403-58197425 AAGCATTCCTTGGGGGAAAGGGG + Intronic
1140640896 16:76971379-76971401 AGGCATGGCATTCAGGAAACAGG + Intergenic
1140943021 16:79740146-79740168 AGACATTCCTTGAAGAAATCAGG - Intergenic
1143265722 17:5635670-5635692 AGGCATTCCTTCCAGGAAGGAGG - Intergenic
1147523357 17:41196149-41196171 AGGCATCCTTTGGAGGAAACAGG + Intronic
1152236151 17:79139950-79139972 AGGCTTTCCCTGCAGGTAAAAGG + Intronic
1152494908 17:80664165-80664187 AGGCAGACCTTCCAGGCAACAGG - Intronic
1155093711 18:22535863-22535885 AGGCTTCCCTTCCAGGAAAATGG + Intergenic
1159428431 18:68320010-68320032 AGCTATTCCTTGCAGAAAGCTGG - Intergenic
1159661809 18:71106369-71106391 AGGCATTGCTTGCTGGAATTTGG - Intergenic
1161007161 19:1942395-1942417 TGGCATTGTTTGCAGGAAGCGGG + Intronic
1161937258 19:7379669-7379691 AGGGGTTCCTTGGAGCAAACAGG + Intronic
1164942997 19:32266145-32266167 AGGAATTCACTGCAGGGAACTGG - Intergenic
1165896506 19:39144677-39144699 TTGTCTTCCTTGCAGGAAACAGG + Intronic
925230901 2:2233074-2233096 AGGCATTCCCTGAAGGTAGCAGG + Intronic
926736296 2:16075772-16075794 CGGCATTCCTTGTGGGACACAGG + Intergenic
928063590 2:28139697-28139719 AGTCAATCCTTGTAGAAAACTGG - Intronic
930788191 2:55293668-55293690 AGGCATTCCTTCCAGGTGCCAGG + Intronic
932423944 2:71617461-71617483 AGGCTTTCCTGGCAGGCAAAAGG + Intronic
933661024 2:84926994-84927016 AGGCGTCCCTTGTAGGAACCAGG - Intergenic
937284423 2:120741249-120741271 AGCCATTCCCTCTAGGAAACAGG + Intronic
937477124 2:122225706-122225728 AAGCATCCCATGCAGGAACCAGG - Intergenic
940909979 2:159202013-159202035 AGGCTCTCCTAGCAGAAAACTGG - Intronic
942325327 2:174771707-174771729 AGGCACTCCATGCTGGAAACAGG - Intergenic
943219470 2:185086738-185086760 AGGCATTTCTTGTGGGAAAGAGG + Intergenic
943316414 2:186394647-186394669 AGTCATTCTTTGAAGAAAACTGG + Intergenic
946781515 2:223196523-223196545 AGGCATTCCTTCAAGAAAGCAGG - Intronic
1168785998 20:540917-540939 TTGCATTCCTTGGTGGAAACTGG + Intronic
1171095134 20:22325661-22325683 AAGCATTCCATCCAAGAAACTGG + Intergenic
1171465032 20:25321395-25321417 AGGCCCTCCTTTCAGGAAGCTGG + Intronic
1172564399 20:35917665-35917687 AGGCAGAGCTTCCAGGAAACAGG + Intronic
1173820424 20:46016236-46016258 AGGCTTTCTCTGCAGGAGACAGG - Exonic
1175284523 20:57829073-57829095 AGGCAGTCCTTGCAGGTTCCTGG + Intergenic
1178148136 21:29763386-29763408 AGGCATTCTTTACATGAAAATGG + Intronic
1179084513 21:38205716-38205738 AGGTCTTCCCTGCAGGACACAGG - Intronic
1180102964 21:45598449-45598471 AGGCAAGCCTAGCAGGAGACAGG - Intergenic
1180597795 22:16990229-16990251 AGGAATTACTGGCAAGAAACTGG - Intronic
1183017062 22:34997476-34997498 AGGAAGTCCTTGCATGAACCAGG - Intergenic
1184795154 22:46727916-46727938 AATCATTCCTCTCAGGAAACAGG + Intronic
951067366 3:18282647-18282669 GGGAGTTCCTGGCAGGAAACTGG - Intronic
951322263 3:21259676-21259698 AGTTATTCCCTGCAGGAGACGGG - Intergenic
954577885 3:51686761-51686783 AGGCCTTCCTTGAATGAAATGGG - Intronic
955201283 3:56854413-56854435 AGGCTTTCTCTGAAGGAAACAGG + Intronic
959385015 3:105693227-105693249 ACGCATTCCTTGCATCAAAGAGG - Intronic
961155919 3:124679538-124679560 AGGCAATCATTGTAGGAAATAGG - Intronic
963263575 3:143216842-143216864 TGGGATTCCTGGCAGGAAAATGG - Intergenic
966435542 3:179879800-179879822 AGGCATTCCATGGTGGAAACTGG - Intronic
966548260 3:181175670-181175692 ATGCATGCCTTGAAGGAAAATGG + Intergenic
967784305 3:193473366-193473388 AGGTTTTCCTTGCAGCAAAATGG + Intronic
967838735 3:193986362-193986384 AGGCAGGCCCTGCAGGGAACAGG - Intergenic
968149693 3:196327412-196327434 AGGCATGCCATGCTGGGAACTGG - Exonic
968277823 3:197454393-197454415 AGGCATTTTTTGCAGGTAAGAGG + Intergenic
971254635 4:25002936-25002958 GGGCATTACTTTCAGGAAACTGG + Exonic
974022557 4:56704865-56704887 AGGGCTTCCTTGGGGGAAACTGG + Intergenic
974476630 4:62389733-62389755 AAGAATTCCTTGGGGGAAACTGG + Intergenic
979307618 4:119165593-119165615 ATGCATCCCTTGCATGAAAGAGG + Intronic
979767833 4:124483306-124483328 CGGCATGCTTTCCAGGAAACAGG - Intergenic
983961546 4:173760821-173760843 AGTCATGCCTTGCAGAAAAAAGG + Intergenic
984901586 4:184591163-184591185 AGGCCTTCCTGGAAGGAAGCAGG + Intergenic
985850497 5:2385112-2385134 AGACATTCCTTTCAGGACTCAGG + Intergenic
987550314 5:19371121-19371143 AGGCATGGATTCCAGGAAACAGG - Intergenic
991147074 5:63319297-63319319 AGGCAATGGTTGCAGGAAGCTGG + Intergenic
993600907 5:89923715-89923737 AGGAATTCATTTCAGAAAACTGG - Intergenic
997523984 5:134540877-134540899 AGGCCTGCCTGGGAGGAAACAGG + Intronic
998444086 5:142185379-142185401 AGGCAGTCCCTTCAGGAACCAGG - Intergenic
998901714 5:146862561-146862583 AGGCAGGCCTTGCAGGTACCAGG + Intronic
1004407703 6:15349775-15349797 AGGCATTGCTTGCGGGAAGGAGG - Intronic
1007250758 6:40493273-40493295 AGCAATGCCTGGCAGGAAACTGG - Intronic
1010118445 6:72343116-72343138 AGGCCTCCCTTGCAGGTATCTGG + Intronic
1013251848 6:108342195-108342217 AGGCATTCCTTGCAGGAAACAGG - Intronic
1013470668 6:110461018-110461040 AGGCTTTCCCTGCTGGAAGCTGG + Intronic
1014181359 6:118387924-118387946 AGCCATATCTTGCAGAAAACAGG + Intergenic
1014652308 6:124054745-124054767 AGGCATTCCTTTCAGGTTGCCGG + Intronic
1014854184 6:126379354-126379376 AGGCATTCCTTCATGGAAAATGG + Intergenic
1015511298 6:134040547-134040569 AGACAATCCTTTGAGGAAACGGG - Intronic
1018905842 6:168075441-168075463 AGGCATCCCCTGCAGGTAACAGG + Intronic
1019331283 7:462039-462061 AGGCATTCCCTGCGGGGAGCTGG + Intergenic
1020816231 7:12909255-12909277 AGGCATACCTAGTAGGAAAAGGG + Intergenic
1023621049 7:42073299-42073321 AGGCATTCCGTTTAGCAAACTGG + Intronic
1024093548 7:45967142-45967164 AGGCTCTCCTTGCAGGACAGAGG - Intergenic
1028580657 7:92406463-92406485 AGGTACTCATTGGAGGAAACTGG + Intergenic
1028871340 7:95773664-95773686 AGGCATTCCAAGCAAGAAAATGG - Intronic
1029154276 7:98503934-98503956 CGGCAATCCTTGCAGGACAGTGG - Intergenic
1032389836 7:131548783-131548805 AGGGATTCCTGGTAGGAAGCAGG - Intronic
1032494874 7:132353841-132353863 GGACCTTCCTTGCAGAAAACAGG - Intronic
1035291748 7:157843870-157843892 TGGCATTCCTTCCAGACAACTGG + Intronic
1040722123 8:50337472-50337494 CTCCTTTCCTTGCAGGAAACGGG - Intronic
1042438125 8:68791811-68791833 AGTCAGTCCTTGCAGGTGACAGG - Intronic
1044841782 8:96343263-96343285 AGGCATTCCAGGCAGGAGCCTGG - Intergenic
1045683678 8:104689450-104689472 AGGAATTTCATGAAGGAAACTGG - Intronic
1047970865 8:130083299-130083321 AGGCCTTCCTTGCAGGGAAAAGG - Intronic
1048162456 8:132033650-132033672 AGGCAATCCTTGCAGACCACAGG - Intronic
1049197541 8:141323975-141323997 TGGCATTCCTTGCAGAAAGGAGG - Intergenic
1050141782 9:2523640-2523662 TGTCATTACTTGCAGGACACAGG + Intergenic
1054747749 9:68872047-68872069 AGGCTTTCCTTGCTTGAGACTGG - Intronic
1055550840 9:77431093-77431115 AGGGTTTCCTTACTGGAAACTGG - Intronic
1055709709 9:79047149-79047171 AAGCATTTCTTCCAGGAGACAGG - Intergenic
1056515190 9:87343320-87343342 AGGCATTCCGGGCAGGAGCCTGG - Intergenic
1056546151 9:87615657-87615679 TGGCTTTCCTTGGAGGAAAAGGG + Intronic
1057616881 9:96599682-96599704 ATGCTTTCATTTCAGGAAACCGG + Intronic
1060578895 9:124725565-124725587 AGGCTTTCCTATCAGGAATCTGG + Intronic
1060906719 9:127313638-127313660 AGGCATGCCCTGGAAGAAACTGG - Intronic
1062422049 9:136487370-136487392 AGGAAGTCCTTGCAGGAGGCCGG - Intergenic
1188746701 X:33853645-33853667 AGGCATTGCATGCAGGTATCCGG + Intergenic
1190309047 X:49103448-49103470 AGGCATTCCCTGCAAGATCCTGG - Intergenic
1192858435 X:75039526-75039548 AGAAATTCCTTCCAGGAACCAGG + Intergenic
1197716940 X:129716211-129716233 AGGAATTCCTTGCAGGGAGAAGG - Intergenic
1199573050 X:149287485-149287507 AGGCATTACTTACAGGAAACTGG + Intergenic