ID: 1013251849

View in Genome Browser
Species Human (GRCh38)
Location 6:108342202-108342224
Sequence CTGTGGGAGGCATTCCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013251849_1013251852 -8 Left 1013251849 6:108342202-108342224 CCTGCAAGGAATGCCTCCCACAG 0: 1
1: 0
2: 2
3: 13
4: 189
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251849_1013251857 8 Left 1013251849 6:108342202-108342224 CCTGCAAGGAATGCCTCCCACAG 0: 1
1: 0
2: 2
3: 13
4: 189
Right 1013251857 6:108342233-108342255 AGCCAGGAGCCAGCCAGAAAGGG No data
1013251849_1013251861 20 Left 1013251849 6:108342202-108342224 CCTGCAAGGAATGCCTCCCACAG 0: 1
1: 0
2: 2
3: 13
4: 189
Right 1013251861 6:108342245-108342267 GCCAGAAAGGGCAGTCGCTTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1013251849_1013251860 19 Left 1013251849 6:108342202-108342224 CCTGCAAGGAATGCCTCCCACAG 0: 1
1: 0
2: 2
3: 13
4: 189
Right 1013251860 6:108342244-108342266 AGCCAGAAAGGGCAGTCGCTTGG No data
1013251849_1013251856 7 Left 1013251849 6:108342202-108342224 CCTGCAAGGAATGCCTCCCACAG 0: 1
1: 0
2: 2
3: 13
4: 189
Right 1013251856 6:108342232-108342254 CAGCCAGGAGCCAGCCAGAAAGG 0: 1
1: 0
2: 3
3: 36
4: 366
1013251849_1013251863 21 Left 1013251849 6:108342202-108342224 CCTGCAAGGAATGCCTCCCACAG 0: 1
1: 0
2: 2
3: 13
4: 189
Right 1013251863 6:108342246-108342268 CCAGAAAGGGCAGTCGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013251849 Original CRISPR CTGTGGGAGGCATTCCTTGC AGG (reversed) Intronic
900420750 1:2555004-2555026 ATGTGGGGGACATTCCTGGCAGG + Intergenic
900806069 1:4769187-4769209 CTGTGGGAAGCATCCGCTGCTGG + Intronic
900922206 1:5680207-5680229 CTGTGGGAGCCATTTCCTCCAGG - Intergenic
901391578 1:8949513-8949535 CTGTGCAAGCCATTCCTGGCAGG - Intronic
901844477 1:11973135-11973157 CTGTGGGAGGGCTTCCTGGAAGG + Intronic
902602915 1:17552148-17552170 GTGAGGGAGGCAGTCCCTGCTGG + Intronic
902952756 1:19899608-19899630 CTGTGGGACACATTCCTAGAAGG + Intronic
906662223 1:47590972-47590994 CTCTGGGTGGGATTCCTTACAGG - Intergenic
907266820 1:53266919-53266941 CTGTGGAAGGCTTTCAGTGCAGG - Intronic
907360989 1:53914781-53914803 CTGGGGGAGGCATCCTTTGTGGG - Intergenic
908354283 1:63316502-63316524 CTGTGGGAAGGATTCTCTGCGGG - Intergenic
911717960 1:101156665-101156687 TTGTGGGAGAAATTCTTTGCAGG + Intergenic
912722226 1:112029911-112029933 CTGTGGTAGGCATTCCTTTCTGG + Intergenic
913045215 1:115068327-115068349 CTGGGGGAAGCTTTCCTTTCTGG - Intronic
917599657 1:176561371-176561393 CAGTGGGAGGCAATCATTACTGG + Intronic
921177894 1:212609351-212609373 CTGTGGGAGCCGATCCTTCCCGG + Intronic
922589411 1:226763172-226763194 CTGAGGGGGGCAGTCCTTTCTGG + Intergenic
923859830 1:237882504-237882526 CTGTGGGTGGCAGGCCTTTCTGG - Exonic
924811820 1:247409656-247409678 CACTGGGAGGCATTCCTTAAAGG + Intergenic
1066059715 10:31711812-31711834 CTGTGGAAGGCATTACTGGAGGG - Intergenic
1066273143 10:33843327-33843349 CTCTGGTACACATTCCTTGCTGG + Intergenic
1067685671 10:48464981-48465003 CTGTGGGAGGCACCCTGTGCTGG + Intronic
1072239813 10:93485266-93485288 CTATGGGTGGAATTGCTTGCTGG + Intergenic
1072772081 10:98150623-98150645 CTGTGGGATGCCTCCCATGCAGG - Intronic
1074353858 10:112764044-112764066 ATGTGGGAGACAGTCATTGCAGG - Intronic
1075688717 10:124381034-124381056 GTGTGGGAGGCCTTCCCAGCAGG - Intergenic
1076134519 10:128036268-128036290 GTGGGGGAGGCACTCCTTGTGGG - Intronic
1076174820 10:128360357-128360379 CTGAGTGAGGCAGTCATTGCAGG - Intergenic
1076385131 10:130050135-130050157 CTGGGCGAGACATTCCTGGCAGG + Intergenic
1076571797 10:131438108-131438130 CTTTGAGAGGCAGCCCTTGCTGG - Intergenic
1078264026 11:9739710-9739732 GTGTGGGAGGAATCCCATGCTGG + Intronic
1078918105 11:15799897-15799919 AGGTGGGAGGCATACCTTCCTGG - Intergenic
1079355413 11:19726460-19726482 CTGGGGAAGACATTCCATGCAGG - Intronic
1082212770 11:49525673-49525695 CTCTGTGAGGCATACCTAGCAGG - Intergenic
1084268142 11:68015328-68015350 CTGCGGGAGGCCTTCCACGCGGG + Exonic
1084748327 11:71187674-71187696 CAGTGGGAGGCAGTACTTGGTGG + Intronic
1086636825 11:89098837-89098859 CTCTGTGAGGCATACCTAGCAGG + Intergenic
1089283873 11:117393290-117393312 TTGTGGGAGGTTTTCCTTCCTGG + Intronic
1090250111 11:125245099-125245121 CTGGGGGAGACCTTCCATGCTGG + Intronic
1091622552 12:2100345-2100367 CTGAGGAAGGAATTCCTTGAAGG + Intronic
1094682644 12:32679579-32679601 CTGTGGGAGGAGGGCCTTGCTGG + Intronic
1098995081 12:77110039-77110061 ATGTGGGAGGCATTAGTGGCTGG - Intergenic
1100712479 12:97273270-97273292 CTATGGGAAGCATTCCTTTTTGG - Intergenic
1102629419 12:114264802-114264824 GTGGGGGAAACATTCCTTGCTGG - Intergenic
1107313042 13:39100396-39100418 CTGTGGAAGGCATTCATTTTGGG - Intergenic
1108342637 13:49513208-49513230 CTTTGGAATGCATTCCTTGAGGG - Intronic
1114634103 14:24177806-24177828 CTTGGGGAGGCAGTCCTTGTGGG - Intronic
1118835580 14:69475663-69475685 CTGTGGGAAGCCTCACTTGCGGG - Intergenic
1122597072 14:102901164-102901186 CTGTGTGGGGGAGTCCTTGCTGG + Intronic
1128367398 15:67014009-67014031 CTGAGGGAGGGCTGCCTTGCAGG + Intergenic
1128669075 15:69560810-69560832 CTGAGGGATGCAGTCCCTGCTGG - Intergenic
1129062054 15:72868024-72868046 CTGCAGGCTGCATTCCTTGCTGG + Intergenic
1129660937 15:77552592-77552614 TTGGGGGAGGCAGTCCTTCCAGG - Intergenic
1129791145 15:78341314-78341336 CTGTGGCGCGCCTTCCTTGCAGG + Intronic
1131469008 15:92679644-92679666 CCATGGGAGTCATTCATTGCAGG - Intronic
1132501209 16:285483-285505 CTGTGGCAGGGAGTCCATGCTGG - Intronic
1132725450 16:1336410-1336432 CTGTGAGAGGCAATGCTTGCGGG - Intronic
1132734334 16:1378140-1378162 TAGTGGGGGGCATTCCATGCAGG - Intronic
1135155609 16:20050375-20050397 TTGTGGGGTGCATTCTTTGCAGG + Intronic
1135328636 16:21543563-21543585 CCGTGGCAGGCATTCCTGGAGGG + Intergenic
1136338986 16:29629536-29629558 CCGTGGCAGGCATTCCTGGAGGG + Intergenic
1137806936 16:51315871-51315893 ATGAAGGAGGCATTCCTTCCTGG - Intergenic
1139930589 16:70523278-70523300 CTGTGGGAAACTCTCCTTGCTGG - Intronic
1140863703 16:79041345-79041367 CTCTAGGAAGCCTTCCTTGCTGG + Intronic
1142041658 16:87898102-87898124 CCGTGGCAGGCATTCCTGGAGGG + Intronic
1144639074 17:16927678-16927700 CGGTGAGAGGCACTCCCTGCAGG - Intergenic
1144876165 17:18398597-18398619 CAGTGAGAGGCACTCCCTGCCGG + Intergenic
1145156063 17:20545823-20545845 CAGTGAGAGGCACTCCCTGCCGG - Intergenic
1145207861 17:20994319-20994341 CGGTGAGAGGCACTCCCTGCAGG + Intergenic
1145793399 17:27642193-27642215 CTGGGGGAGGCATCCCAGGCTGG - Intronic
1146843532 17:36169891-36169913 CAGTGAGAGGCACTCCCTGCAGG - Exonic
1146855839 17:36257829-36257851 CAGTGAGAGGCACTCCCTGCAGG - Exonic
1146864781 17:36330546-36330568 CAGTGAGAGGCACTCCCTGCAGG + Exonic
1146871745 17:36381740-36381762 CAGTGAGAGGCACTCCCTGCAGG - Exonic
1146879106 17:36432822-36432844 CAGTGAGAGGCACTCCCTGCAGG - Exonic
1146883044 17:36453968-36453990 CAGTGAGAGGCACTCCCTGCAGG - Intergenic
1147067641 17:37931140-37931162 CAGTGAGAGGCACTCCCTGCAGG + Exonic
1147074632 17:37982364-37982386 CAGTGAGAGGCACTCCCTGCAGG - Intronic
1147079171 17:38010695-38010717 CAGTGAGAGGCACTCCCTGCAGG + Intronic
1147086155 17:38061903-38061925 CAGTGAGAGGCACTCCCTGCAGG - Exonic
1147095110 17:38134637-38134659 CAGTGAGAGGCACTCCCTGCAGG + Intergenic
1147102100 17:38185868-38185890 CAGTGAGAGGCACTCCCTGCAGG - Intergenic
1149846692 17:60012379-60012401 CAGTGAGAGGCACTCCCTGCAGG - Intergenic
1150085038 17:62268953-62268975 CAGTGAGAGGCACTCCCTGCAGG - Intergenic
1151993921 17:77596730-77596752 CAGTGAGACGCATTCCCTGCAGG + Intergenic
1153228081 18:2912814-2912836 CTCTTGGAGGCATTCCTTATTGG - Intronic
1153687208 18:7558111-7558133 CTTTGGGAGGCCTTCCCTTCTGG + Intergenic
1153747259 18:8192481-8192503 CTGTGGGAGCCCTTTCATGCAGG - Intronic
1154326479 18:13395035-13395057 CTGGGGAAGGCATTGCTTCCAGG + Intronic
1160340555 18:78085463-78085485 CTGGGCGAGGAAGTCCTTGCGGG - Intergenic
1161044818 19:2129190-2129212 CTGCGTGGGGCATTCCCTGCGGG - Intronic
1161044837 19:2129240-2129262 CTGTGTGGGGCATTCCCTGCGGG - Intronic
1162222052 19:9186059-9186081 CTGTGTGAGGCAGTCCATGTAGG - Exonic
1162474398 19:10891382-10891404 GTTTGGGAGGCCTCCCTTGCTGG + Intronic
1163570862 19:18081497-18081519 CTGTGTGGTGCAGTCCTTGCTGG - Intronic
1163783864 19:19264471-19264493 CTGTGGGAGGCTCTCCTTGCAGG + Exonic
1163861702 19:19746407-19746429 TGGTGAGAGGCACTCCTTGCAGG + Intergenic
1163862297 19:19748681-19748703 CTGTGGGAGGGAGTTCTTTCAGG + Intergenic
1164522995 19:28992896-28992918 AAGTGGGAGGCATGCCATGCAGG - Intergenic
1164622501 19:29705183-29705205 CTTTGGGAGGCATGCCTGGGAGG - Intronic
1165015783 19:32879105-32879127 CTGTGTGAGGCAGACCTTTCAGG + Exonic
925870207 2:8263819-8263841 CTGTGGGAGTATTCCCTTGCAGG - Intergenic
926542519 2:14199167-14199189 CTGTGGGCTGCATTCCTTTCTGG + Intergenic
926559329 2:14398729-14398751 TTGTAAGAGGCATTTCTTGCTGG - Intergenic
926733057 2:16051571-16051593 CTGTGGTGGGCATTCCAGGCAGG + Intergenic
928071191 2:28219131-28219153 CAGTGGGCCGCATTCCTTTCTGG + Intronic
930543464 2:52736817-52736839 CTGTGTGTTCCATTCCTTGCAGG - Intergenic
932785086 2:74593779-74593801 CTGGGGAACTCATTCCTTGCTGG - Intronic
933897815 2:86826725-86826747 CTGTGGGAGGCTTCCTTAGCAGG + Intronic
934512379 2:94955766-94955788 CTGTGGGAGGCTTTGCTTTCCGG - Intergenic
937369356 2:121286726-121286748 CAGTGGGGGGCAGTCCTTGAGGG - Intergenic
938694327 2:133821938-133821960 CTGTGAGAAGCATTCCTTGAAGG + Intergenic
939558065 2:143701095-143701117 CTGTGGGAGGCATTATTTATAGG + Intronic
939670231 2:145001992-145002014 CTGTGGAAGATATTCCTGGCAGG + Intergenic
940449001 2:153814654-153814676 CTGTGTGATGCATTACTTTCTGG - Intergenic
944636692 2:201681857-201681879 CTGTGTGAGGAAGACCTTGCTGG - Intronic
946698232 2:222383636-222383658 ATGTGTGAAGCATTCTTTGCTGG - Intergenic
947463652 2:230323532-230323554 CTGTGGCAGGCCTTGCTGGCTGG + Intergenic
1168736386 20:142419-142441 CTGTGCTAGGCATGCCTTGGGGG - Exonic
1170623304 20:18011698-18011720 ATGTGGGAAGCATTCCAGGCAGG - Intronic
1171948041 20:31396020-31396042 GTGTGGGGGGCATTCATAGCTGG - Intergenic
1174384142 20:50176701-50176723 CTGTGGGAGGCATCAGGTGCGGG - Intergenic
1174684638 20:52442060-52442082 CTGTGTGAGGCATTCATGCCTGG - Intergenic
1175284522 20:57829066-57829088 CCGGAGGAGGCAGTCCTTGCAGG + Intergenic
1176940346 21:14916303-14916325 ATTTGGGAGGCATTCCTTCCAGG + Intergenic
1179426573 21:41284260-41284282 CTGAGAGAGGCAGTCCTTTCAGG - Intergenic
1179555833 21:42175320-42175342 CTGCAGGAGGCATTCCTGGCAGG - Intergenic
1179707906 21:43192981-43193003 CTGTGGGTGGCATTCGTTCCAGG + Intergenic
1180119056 21:45734404-45734426 CTGTGCAGGGCATTCCTTTCTGG + Intronic
1180245175 21:46542561-46542583 ATGTTGGAGGTTTTCCTTGCTGG + Intronic
1181437435 22:22918832-22918854 CTGAGGGAGGCACTCCTGGTGGG + Intergenic
1183276401 22:36900846-36900868 CTGTGGGAGGCATCCCGGGAGGG - Intergenic
1183503971 22:38198708-38198730 CTATGGGAAGCAGTCCCTGCAGG + Intronic
1184536901 22:45093778-45093800 CTCTGGGAGGCCTCCCTTGCTGG - Intergenic
951322265 3:21259683-21259705 CAGTGGGAGTTATTCCCTGCAGG - Intergenic
951577139 3:24125632-24125654 CTGTGGGCCCCATTTCTTGCTGG + Intronic
956137860 3:66116746-66116768 TTATGGGAGGCAATCTTTGCAGG + Intergenic
958022168 3:88011126-88011148 CTGTGGGAGGCAGGCCATGTAGG + Intergenic
962027289 3:131561501-131561523 CTGTGGGAAGCTTTCCTTCAAGG + Intronic
967475061 3:189906990-189907012 ATGTGGGTGGCATCCCTTGAGGG - Intergenic
970861450 4:20707849-20707871 CTAAAGGAGGTATTCCTTGCAGG + Exonic
971231933 4:24807088-24807110 CTTTGAGAGGCGCTCCTTGCAGG - Exonic
972335970 4:38107254-38107276 CTGTGGGAGGCCTCCCTGGGCGG - Intronic
973375424 4:49283002-49283024 GTGTGGGAGGCCTGCCTGGCGGG + Intergenic
973377245 4:49295170-49295192 GTGTGGGAGGCCTGCCTGGCGGG + Intergenic
973378165 4:49301306-49301328 GTGTGGGAGGCCTGCCTGGCGGG + Intergenic
973379112 4:49307604-49307626 GTGTGGGAGGCCTGCCTGGCGGG + Intergenic
973380899 4:49320201-49320223 GTGTGGGAGGCCTGCCTGGCAGG - Intergenic
973381987 4:49327239-49327261 GTGTGGGAGGCCTGCCTGGCGGG - Intergenic
975823347 4:78293919-78293941 CTGTGGCAGGCTTTCTCTGCTGG - Intronic
977137026 4:93317768-93317790 CTCTGGGTGGCATTTATTGCTGG + Intronic
979853892 4:125608414-125608436 CTTTGGGAGCCATTCATTCCTGG - Intergenic
980785132 4:137543329-137543351 CTGTGGGAGGAATTTGTTGGTGG + Intergenic
983605243 4:169575524-169575546 CTGTGGGAAGCTCTTCTTGCAGG - Intronic
984922809 4:184780519-184780541 CTGTGTGCAGCATTGCTTGCTGG - Intronic
986747665 5:10758867-10758889 CCCTGGGAGAAATTCCTTGCTGG - Intronic
988708142 5:33745479-33745501 CTGTGGGAGGCATTCTAAGGTGG - Intronic
993810341 5:92468290-92468312 TTGTGGGAGGCATTGCTTCACGG + Intergenic
995225314 5:109693775-109693797 TTCTGGGAGGAATTCCTTGGAGG + Intronic
997354191 5:133251865-133251887 CTGTGGGAGGCCTTGCTTGGGGG + Intronic
997819771 5:137054612-137054634 CTCTGGGTGGCTTTCCTTGTTGG - Intronic
999419477 5:151428373-151428395 CTGAGGGAGGCAATCCTGGGAGG + Intergenic
1001555003 5:172631172-172631194 CTGTGATGGGCAGTCCTTGCTGG + Intergenic
1003207528 6:4026927-4026949 CTGGGGAAAGCATTCCTGGCAGG + Intronic
1003638225 6:7854253-7854275 TTGTGGGAGGCAGGCCATGCCGG + Intronic
1003788929 6:9520640-9520662 ATGTTGGAGGCAGTCCTTGTGGG - Intergenic
1007404210 6:41624297-41624319 CTGAGGGAGGAAGCCCTTGCAGG - Intergenic
1008561615 6:52730088-52730110 CTGGGGGATGCAGTCCTTGGTGG - Intergenic
1011028437 6:82894786-82894808 CTGTGGGCAGCATCCCTGGCAGG + Intronic
1011388895 6:86829131-86829153 ATGTTGGAAGCATTCATTGCTGG + Intergenic
1013067098 6:106694520-106694542 CTGTGGCGGGCACGCCTTGCTGG + Intergenic
1013251849 6:108342202-108342224 CTGTGGGAGGCATTCCTTGCAGG - Intronic
1016989559 6:149919922-149919944 CTGGAGGAGGCACTCCTTGCTGG - Intronic
1017249173 6:152261288-152261310 CTGTGGTAGGCATCCCAGGCTGG + Intronic
1018051745 6:160015409-160015431 CTCTGGGGGGGATTCCTTTCTGG + Intronic
1018177979 6:161195405-161195427 ATGATGGAAGCATTCCTTGCAGG - Intronic
1020100416 7:5391207-5391229 TGGTGGGAGGAATTCCTTCCTGG - Intronic
1022499666 7:30874512-30874534 ATGTGGGAGGCATGGGTTGCAGG + Intronic
1024179217 7:46872779-46872801 CTGTGGGAGGAATTAGTGGCTGG - Intergenic
1024258453 7:47556970-47556992 CTGTGGGGGGCATGGCTTGGTGG - Intronic
1029170641 7:98627240-98627262 ATGTGGGAGGCATTCCAGGACGG + Exonic
1032151996 7:129436686-129436708 CTGTGGAAGGCAGTCCTTAGAGG + Intronic
1032695236 7:134330271-134330293 CTTTGGGAGACATTCTTTCCAGG - Intergenic
1032857281 7:135845938-135845960 CTGTTGTAGGAATTCCATGCAGG - Intergenic
1035549989 8:514841-514863 CTGTTGGTGCCATTCCTTGGAGG - Intronic
1035649490 8:1254196-1254218 CTGTGGGAGGCACTGATTTCAGG - Intergenic
1036813547 8:11884801-11884823 CTGTGGCCGCCATTCCTTCCTGG - Intergenic
1037776979 8:21841900-21841922 TTCTGGGAGGCCTTCCTTGAGGG + Intergenic
1038098653 8:24346018-24346040 CTGTCTGAGGCTTTCCTTGATGG - Intronic
1038334801 8:26637351-26637373 CTTTGGGAGGCAGCCCTGGCAGG + Intronic
1041068489 8:54104198-54104220 CTGTGGGAGCCACTCTGTGCTGG + Intergenic
1041209838 8:55538112-55538134 CTATGGGATGGATTCCTTTCTGG + Exonic
1041480846 8:58318381-58318403 CAGCGGTAGGGATTCCTTGCTGG - Intergenic
1047285966 8:123487388-123487410 CTGGGGCAGGCATTCCAAGCTGG + Intergenic
1049456578 8:142694714-142694736 CTGTAGGAGTTAGTCCTTGCAGG + Intergenic
1057904494 9:98973763-98973785 CTGTTGGAGTCATTCCTTCCAGG + Intronic
1060709384 9:125842708-125842730 CTGTTTGAAGGATTCCTTGCTGG + Intronic
1060812789 9:126619371-126619393 CTATGGGAGGCCTTCCAGGCTGG - Intronic
1203549132 Un_KI270743v1:153618-153640 GTGTGGGAGGCCTTTCTGGCGGG - Intergenic
1203550087 Un_KI270743v1:159932-159954 GTGTGGGAGGCCTGCCTGGCGGG - Intergenic
1187157350 X:16733387-16733409 CTGTGGGTGGTATTACTTCCAGG - Intronic
1190428235 X:50352616-50352638 CTGTGGTAGACATTACTTGCTGG - Intergenic
1195557687 X:106245867-106245889 CTGTGGGATACATCCCTGGCTGG + Intergenic
1197753845 X:129981963-129981985 CTGAGGGAGGCTCCCCTTGCAGG - Intronic
1199704119 X:150409340-150409362 CTGTGGCAGGCAGGCCTGGCAGG + Intronic