ID: 1013251852

View in Genome Browser
Species Human (GRCh38)
Location 6:108342217-108342239
Sequence TCCCACAGGCTGAACCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013251848_1013251852 -1 Left 1013251848 6:108342195-108342217 CCTGTTTCCTGCAAGGAATGCCT 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251846_1013251852 6 Left 1013251846 6:108342188-108342210 CCTCTGTCCTGTTTCCTGCAAGG 0: 1
1: 0
2: 2
3: 33
4: 330
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251842_1013251852 22 Left 1013251842 6:108342172-108342194 CCATCCCTTTCTATGCCCTCTGT 0: 1
1: 0
2: 4
3: 46
4: 627
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251845_1013251852 7 Left 1013251845 6:108342187-108342209 CCCTCTGTCCTGTTTCCTGCAAG 0: 1
1: 0
2: 6
3: 36
4: 334
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251843_1013251852 18 Left 1013251843 6:108342176-108342198 CCCTTTCTATGCCCTCTGTCCTG 0: 1
1: 0
2: 2
3: 40
4: 410
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251844_1013251852 17 Left 1013251844 6:108342177-108342199 CCTTTCTATGCCCTCTGTCCTGT 0: 1
1: 0
2: 0
3: 42
4: 391
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251849_1013251852 -8 Left 1013251849 6:108342202-108342224 CCTGCAAGGAATGCCTCCCACAG 0: 1
1: 0
2: 2
3: 13
4: 189
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data
1013251841_1013251852 23 Left 1013251841 6:108342171-108342193 CCCATCCCTTTCTATGCCCTCTG 0: 1
1: 0
2: 2
3: 46
4: 375
Right 1013251852 6:108342217-108342239 TCCCACAGGCTGAACCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013251852 Original CRISPR TCCCACAGGCTGAACCAGCC AGG Intronic
No off target data available for this crispr