ID: 1013261317

View in Genome Browser
Species Human (GRCh38)
Location 6:108446217-108446239
Sequence TTGTGTGCACATATGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013261317 Original CRISPR TTGTGTGCACATATGCACCC TGG Intronic
901170285 1:7252117-7252139 TTTTGGGCACATAGGCAACCTGG + Intronic
901979199 1:13020862-13020884 TTGTGTGCTCAGAGGAACCCAGG - Intronic
902002883 1:13208076-13208098 TTGTGTGCTCAGAGGAACCCAGG + Intergenic
902022108 1:13353840-13353862 TTGTGTGCTCAGAGGAACCCAGG + Intergenic
902483097 1:16722473-16722495 TTGTGAAGACATGTGCACCCAGG + Intergenic
902531972 1:17096444-17096466 AGGTGTGCACATGTGCACCTGGG + Intronic
903191185 1:21657053-21657075 TTGTGTGCAGTTGTGCACACAGG - Intronic
903590936 1:24455466-24455488 ATGTTTGCACATATGCACAGGGG + Intronic
905547899 1:38814413-38814435 TGGTGTGTGCATATGCACACAGG + Intergenic
906751740 1:48268813-48268835 TTTTGTGCACAAATCCATCCAGG - Intergenic
910550500 1:88468476-88468498 TTGTGTACACGTAGGTACCCAGG - Intergenic
911839370 1:102660800-102660822 TTCTGAGCACATATAAACCCTGG + Intergenic
912546702 1:110456480-110456502 TAGTACGCACATATGCACACAGG + Exonic
913483212 1:119309526-119309548 TTGTAATCACATAGGCACCCAGG - Intergenic
917977576 1:180250372-180250394 TTATGTTCACATTTGCACCCGGG - Intronic
918301729 1:183210255-183210277 TTGTGTCCAGATTTGCACCCTGG - Intronic
918937182 1:190936522-190936544 TTGTGTGCACAAATGCCCTGAGG + Intergenic
919919060 1:202157546-202157568 ATGTTTGCAGATATGTACCCTGG - Intronic
924659646 1:246004685-246004707 TTGTGTGCACATACATTCCCTGG - Intronic
1066495364 10:35937211-35937233 TTATGTGGACAAATCCACCCTGG + Intergenic
1067311028 10:45113785-45113807 TGGTGTGCACCTATGATCCCAGG - Intergenic
1068486709 10:57667826-57667848 GTGTCTGCACATGTGCACACAGG - Intergenic
1068760737 10:60706109-60706131 TGGTGTGCACCACTGCACCCAGG + Intronic
1069769742 10:70890586-70890608 TTGTGTGCCCACATGCTCACGGG - Intergenic
1071229286 10:83565839-83565861 TTTTGTGAACATATACACCAAGG + Intergenic
1071351834 10:84754366-84754388 GTGTGTGTGCATATGCACACAGG + Intergenic
1071497342 10:86178325-86178347 TTGTGTGCAAATAGGCAGGCAGG - Intronic
1074696660 10:116055861-116055883 TTGTGTGAACATTTGGACCTTGG - Intergenic
1078725636 11:13928335-13928357 TTGTGTATACATATGCACCTAGG + Intergenic
1079247229 11:18761568-18761590 ATGTGTGCACATGTGCACAGGGG + Intronic
1082934354 11:58640862-58640884 ATGTGTGCACACATGGACCCAGG + Intronic
1083987891 11:66228811-66228833 TTTTATGCAAATATGCCCCCAGG - Intronic
1084079161 11:66808092-66808114 GTGTGTGTGCATATGCACCATGG - Intronic
1088881472 11:113976477-113976499 TTGTGTGCAAATAGCCACTCTGG + Intronic
1089508370 11:118979813-118979835 ATGTGGGCACAAATGCACCTGGG - Intronic
1089557752 11:119324120-119324142 TTATGTGCATATTTGCACCCTGG - Intergenic
1090242410 11:125193475-125193497 TTGTATGCACACATGCACACTGG - Intronic
1091987136 12:4919885-4919907 TTTTGTGCAGATGTGAACCCTGG + Intronic
1092308524 12:7326346-7326368 AGGTGTGCACAACTGCACCCTGG + Intronic
1092664904 12:10785158-10785180 ATGTGGGCACATATACACCATGG - Intergenic
1093953905 12:25195125-25195147 TTGTGTGGACAAACGCTCCCGGG + Exonic
1095229825 12:39726356-39726378 TTGTGAGAACACATGCACACAGG - Intronic
1096018360 12:48299464-48299486 TCGTGTGCACAAATGCTGCCAGG + Intergenic
1097706808 12:62877255-62877277 TTGTGTCCGCAGATGCACCAGGG + Intronic
1097802439 12:63929079-63929101 TTGTGTACACACATGTAACCAGG - Intronic
1099955495 12:89349551-89349573 TTGTGTTCACAGATGAAGCCCGG - Exonic
1101328418 12:103737266-103737288 TGGTGTGGGCATTTGCACCCAGG - Intronic
1102300726 12:111769079-111769101 CTGGGTCCAGATATGCACCCAGG + Intronic
1103155090 12:118677815-118677837 TTGTTGGCACATATACACCATGG - Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105799774 13:23893104-23893126 TTCTGTCCCCATATGCACACAGG + Intronic
1105849271 13:24319928-24319950 TTCTGTCCCCATATGCACACAGG - Intronic
1106666911 13:31860860-31860882 TTGTGGGCATATATGCCCACTGG - Intergenic
1107887344 13:44884774-44884796 TTGTGTTCACATGCCCACCCAGG + Intergenic
1108625836 13:52228221-52228243 CTGTGTGGACACAAGCACCCCGG + Intergenic
1108660228 13:52578259-52578281 CTGTGTGGACACAAGCACCCCGG - Intergenic
1109148336 13:58811480-58811502 TAATGTGCACATATACACCAAGG - Intergenic
1110820557 13:79910414-79910436 TTGTGTGTCCATATGCACCTTGG - Intergenic
1111866883 13:93779885-93779907 TTGTGTGCATATAAACCCCCTGG + Intronic
1113130083 13:107026772-107026794 TTTTGGGCACATATACACCATGG + Intergenic
1113526610 13:110983997-110984019 GTATGTGCACACATGCACACAGG - Intergenic
1119061662 14:71480991-71481013 TTAGGTGCAGAAATGCACCCAGG + Intronic
1122948976 14:105030292-105030314 AACTGTGCACAAATGCACCCAGG - Intergenic
1123897280 15:24841419-24841441 TTGTGTGCAGATAAGCATCACGG + Intronic
1124336228 15:28859137-28859159 TGGTGTGCACATATAGCCCCAGG - Intergenic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1126270146 15:46806532-46806554 TTGTGTGTCCATGTGTACCCAGG - Intergenic
1130569946 15:85033474-85033496 CTGTGTGTATATATGCACACAGG - Intronic
1130569947 15:85033475-85033497 CTGTGTGCATATATACACACAGG + Intronic
1132998668 16:2838071-2838093 TGGTGTGCACATGTACTCCCAGG + Intronic
1134835556 16:17357795-17357817 ATGGGTGCACATTCGCACCCAGG - Intronic
1135154440 16:20040359-20040381 TTGTGGGCATATAAGCATCCTGG - Intronic
1135929204 16:26722278-26722300 ATGTGTGCGCACATGCACCCCGG + Intergenic
1136399830 16:30011226-30011248 TCGTGTGCACACATCCAACCGGG + Intronic
1138851545 16:60635436-60635458 TAATGTGCACATGTGCACACAGG + Intergenic
1139929575 16:70515146-70515168 TTGTGTGCACATGTAATCCCAGG - Intronic
1140033917 16:71358905-71358927 TTCTGTGCCCATTGGCACCCAGG + Intronic
1143000792 17:3793889-3793911 TTTTGTACACATGTGCACTCAGG - Intronic
1143689990 17:8553437-8553459 GTGTATGCACATATATACCCAGG - Intronic
1144312694 17:14027467-14027489 CAGTGTGCACATATCCACCCAGG + Intergenic
1144332063 17:14233860-14233882 CAGTGTGCACATATCCACCCAGG - Intergenic
1144498764 17:15767723-15767745 CAGTGTGCACATATCCACACAGG + Intergenic
1145162147 17:20582757-20582779 CAGTGTGCACATATCCACACAGG + Intergenic
1149399791 17:56284117-56284139 GTGTGTGCACACATGCTCACAGG + Intronic
1150571213 17:66388730-66388752 TTGTCTGCACATCTGCACTGTGG + Intronic
1150583722 17:66498772-66498794 ATGTGTGCACACATGCATGCTGG + Intronic
1157439982 18:47703291-47703313 GTGTGTGCACAGGTGCACCAGGG + Intergenic
1158888574 18:61852060-61852082 TTGAGAGCACATGTGCCCCCTGG - Intronic
1160352587 18:78196806-78196828 TTGTGTGCACCTGGGCACGCCGG - Intergenic
1161380583 19:3963138-3963160 TTGTGTGCACATGTAGTCCCAGG + Intronic
1163290274 19:16374840-16374862 GTGTGTGCTCATACACACCCGGG - Intronic
1164906472 19:31972533-31972555 CTAGGTGCACATCTGCACCCAGG + Intergenic
1165718957 19:38065163-38065185 TTGTGTTCACATATTCCCCAGGG - Intronic
1165918397 19:39275944-39275966 GTGTGTGCACATGTGCATGCAGG + Intergenic
925053537 2:835965-835987 TGGTGTTCCCATTTGCACCCCGG - Intergenic
925543391 2:4990860-4990882 CTGGGTGCATATAAGCACCCAGG - Intergenic
925811262 2:7703049-7703071 TTATGTGCACATATGAACACTGG + Intergenic
927680902 2:25138382-25138404 TTGGGTGTACACACGCACCCAGG - Intronic
928179530 2:29058278-29058300 CTGTGTGCACAGATGCTCCCTGG + Exonic
928922805 2:36542761-36542783 TTTTCTGCCCATATTCACCCAGG + Intronic
930327263 2:49935613-49935635 TTGTTGGCACATATGCTCCAAGG - Intronic
933700978 2:85255400-85255422 TTGTGTGCAGGTGTGCACACAGG - Intronic
935754780 2:106268597-106268619 TCATGTGCACATCTGCACCATGG + Intergenic
939823648 2:146987505-146987527 TTGTGTGCACACATGTGCTCAGG + Intergenic
941322579 2:164073734-164073756 TTGTGTTCAAATATTCAGCCTGG + Intergenic
941895040 2:170620677-170620699 CTGTGTGCACAGATCTACCCGGG - Intronic
942033767 2:171990522-171990544 TAGTGTGCACCTATGGTCCCAGG - Intronic
945441889 2:209889425-209889447 TTGTATGCACATACACACCTTGG + Intronic
947042938 2:225944699-225944721 TTGGGTGGACATCTGCACCATGG + Intergenic
948936591 2:241169196-241169218 TTCTCTGCACTTATGCTCCCGGG + Intronic
1173147212 20:40535138-40535160 GTGGGTGCACATTCGCACCCTGG + Intergenic
1173503205 20:43568098-43568120 TTGTGACCACTTCTGCACCCAGG - Intronic
1175077119 20:56385146-56385168 TTGTGTGCACCTCTCCATCCTGG + Intronic
1175591400 20:60194828-60194850 TTGGATGCAGATATGCACACTGG - Intergenic
1178908304 21:36654081-36654103 CTGTGTGCCCACATGGACCCAGG - Intergenic
1181503091 22:23330900-23330922 TTGTATGTAGATATGCAACCTGG + Intergenic
1181653898 22:24279276-24279298 TTGTATGTAGATATGCAACCTGG + Intronic
950423078 3:12910039-12910061 ATGTGCACACATATGCACACAGG - Intronic
950782050 3:15400369-15400391 TTATGTGCACATATGCATGGAGG - Intronic
953909654 3:46885300-46885322 TTGTGAGCGCCTGTGCACCCGGG + Intronic
956822426 3:72965860-72965882 ATATGTGCACATATGTACACAGG - Intronic
961670164 3:128523206-128523228 ATGTGTGGACAAATGCCCCCCGG + Intergenic
962392152 3:134981660-134981682 GTGGGTGCACAGATGCACGCAGG - Intronic
964545600 3:157830181-157830203 GTTTGTGTACATATACACCCAGG + Intergenic
968518704 4:1025525-1025547 GTGTGTGCATACATGCATCCAGG - Exonic
969962913 4:10964315-10964337 ATGTGTGCACACATGAACACAGG + Intergenic
973016657 4:45148103-45148125 TTGTTAGCACATATTCAGCCTGG + Intergenic
974143049 4:57912464-57912486 GTGTGTGCACATATGCACACAGG + Intergenic
976107275 4:81632610-81632632 TTCAGTGCACATATGCACACAGG + Intronic
980940356 4:139268275-139268297 TTGTTTGCACAAAGGCACACAGG + Intronic
984811679 4:183800865-183800887 TTGTGTGAAATCATGCACCCAGG - Intergenic
985863543 5:2493731-2493753 ATGTGTGCACATACTCACGCAGG - Intergenic
986659544 5:10046648-10046670 TTTTGTTCACATTTGCATCCTGG - Intergenic
989177723 5:38544930-38544952 TAGTGTGCAGTTATGCACCATGG + Intronic
991475882 5:67018999-67019021 ATGTGTGCACACATGCAGACAGG - Intronic
991934000 5:71783935-71783957 TGGTGTGCAGAGAGGCACCCAGG + Intergenic
992557782 5:77920165-77920187 ATGTGTGCACACATGTGCCCAGG - Intergenic
997659837 5:135580809-135580831 TTGTGTGCACATGTACACATGGG + Intergenic
999150361 5:149422565-149422587 ATGTGTGCAAACGTGCACCCCGG + Intergenic
1000988172 5:167883473-167883495 TTGTGTGCTCATTTGCACCATGG - Intronic
1003570714 6:7254700-7254722 ATGTGTGCACATATCCACTGTGG - Intergenic
1006661039 6:35644847-35644869 TTGTGTGCATATATTTTCCCAGG - Intronic
1006911911 6:37568853-37568875 TACTGAGCACATATGCACACTGG + Intergenic
1007984229 6:46191259-46191281 TTGTGTGCACATGTGCCTTCAGG + Intergenic
1012500583 6:99883734-99883756 TTGTGTCCACATCTCTACCCAGG + Intergenic
1013261317 6:108446217-108446239 TTGTGTGCACATATGCACCCTGG + Intronic
1015141472 6:129938793-129938815 CTGTGTGTACATATGCATACAGG + Intergenic
1017559223 6:155608751-155608773 GTGTGTGCACACATGCACGTAGG - Intergenic
1018188694 6:161289755-161289777 TTGTGTACATATGTGCTCCCAGG - Intergenic
1018719348 6:166561141-166561163 GTGTGTGCACAAGTGCACCCAGG - Intronic
1019295736 7:273058-273080 TCGTGTGCACACACACACCCAGG + Intergenic
1019492092 7:1319052-1319074 GTGTGTTAACATGTGCACCCGGG + Intergenic
1024552739 7:50577110-50577132 TTGTGTTCCCATATGCACTTAGG - Intergenic
1024914603 7:54485101-54485123 TTCTTTGCACTTATGCAACCAGG + Intergenic
1026333748 7:69376122-69376144 TTTTGGGCACATATACACCATGG + Intergenic
1027144316 7:75683498-75683520 CTGTGTGTGCAGATGCACCCTGG + Intronic
1027636198 7:80678107-80678129 GTGTGTGCACATATGCACTGTGG + Intronic
1031983388 7:128145298-128145320 ATGTGTGGACATCTGCACTCAGG + Intergenic
1032001391 7:128267730-128267752 GTGTATGCACAAATGCACACTGG + Intergenic
1035175315 7:157045941-157045963 ACGTGTGCACACATGCACACAGG + Intergenic
1038002212 8:23402128-23402150 AGGTGTGCACACATGCACACAGG + Intronic
1042581196 8:70280986-70281008 TGGTGTACACATCTGCATCCTGG + Intronic
1043419853 8:80087314-80087336 TTGTTGGCACATATACACCATGG + Intronic
1043912910 8:85884569-85884591 TGGTTTGTACATATGCATCCTGG + Intergenic
1043923921 8:86015455-86015477 ATGTGTGCACATATCCACTAGGG + Intronic
1044352134 8:91178873-91178895 TTGTGTACACATAAACATCCAGG - Intronic
1048914298 8:139166808-139166830 ATGTGTGAATATATGCACACAGG - Intergenic
1050115606 9:2260316-2260338 TTGTGTGCATGTATGTACACAGG + Intergenic
1050850763 9:10283111-10283133 GTGTGTGTACATATGCAGGCAGG - Intronic
1051321482 9:15910157-15910179 GTGTGTGCACATATATACCATGG - Intronic
1054777178 9:69133457-69133479 TTGTGTGCACCCATGAGCCCAGG - Intronic
1055124469 9:72703257-72703279 TAGTGTGCACATATAGTCCCAGG - Intronic
1055358688 9:75465450-75465472 TTTTGTGGTCATATGGACCCCGG + Intergenic
1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG + Intronic
1062262737 9:135670993-135671015 CTGTGTGCACACGTGCACCGGGG + Intergenic
1062536663 9:137024058-137024080 GTGTGTGCACATCTGCACACGGG - Intronic
1187477422 X:19624432-19624454 TTGTGTAGGCATATGCACCTGGG + Intronic
1188554141 X:31392615-31392637 GTGTATGCACACATGCACACTGG + Intronic
1196009548 X:110872332-110872354 CTCTGGGCACATATGCACCATGG - Intergenic
1197695599 X:129546823-129546845 ATGTGTGCACATATTTTCCCAGG - Intronic
1199593546 X:149489382-149489404 AGTTGTGCACATATGCACACAGG - Intronic
1200041714 X:153375675-153375697 TTGTGTGCACAGAAGCCACCAGG - Intergenic