ID: 1013264103

View in Genome Browser
Species Human (GRCh38)
Location 6:108477716-108477738
Sequence CCCTAGTAGGTCCAATGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013264103_1013264110 12 Left 1013264103 6:108477716-108477738 CCATAACATTGGACCTACTAGGG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1013264110 6:108477751-108477773 AAGGTGAATTTCTATAACTGTGG No data
1013264103_1013264108 -7 Left 1013264103 6:108477716-108477738 CCATAACATTGGACCTACTAGGG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1013264108 6:108477732-108477754 ACTAGGGCCAGGGTCAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013264103 Original CRISPR CCCTAGTAGGTCCAATGTTA TGG (reversed) Intronic
907230176 1:52990359-52990381 GTCTAGTAAGTCCAATGTTTTGG - Intronic
921858058 1:220010206-220010228 CAGTAGTAGGTCTAATGTTTTGG + Intronic
1067928068 10:50531009-50531031 TCCTAGAAGGTCCTGTGTTAGGG - Intronic
1074048541 10:109861496-109861518 CTCTTTTAAGTCCAATGTTATGG + Intergenic
1079105730 11:17571212-17571234 GCCTAGTAGGGCAGATGTTAGGG + Intronic
1079685965 11:23360370-23360392 CCCTATAAGGTCTAATGTTAAGG + Intergenic
1103022731 12:117549166-117549188 CACTAATATGTCCATTGTTATGG - Intronic
1118029981 14:61810104-61810126 CCCTATTAGACCCATTGTTAGGG - Intergenic
1140724746 16:77801884-77801906 CCCCAGTAGGAACAATTTTAGGG - Intronic
1148542025 17:48488490-48488512 CCCTAGTAGGTCCCAAGGAATGG - Intergenic
1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG + Intronic
1155624167 18:27815271-27815293 CTCTGGTAGGTCCAGTCTTAGGG + Intergenic
1167526220 19:49985535-49985557 CACTTGTAGGTCTAATGTCAGGG - Intronic
1168620707 19:57877268-57877290 CCCTAGTATGGCCAAGGTCATGG + Intronic
926388642 2:12364085-12364107 TCCTAGTGGGTGCAATTTTAAGG - Intergenic
932156081 2:69418768-69418790 CCCCAGTATGTCCACTTTTAAGG + Intronic
939074067 2:137579350-137579372 CCCAAGAAGGACCAATGTTTTGG - Intronic
939720955 2:145650524-145650546 CCCTAATAGTTCTAATGTTCAGG - Intergenic
950344659 3:12281956-12281978 CCAAAGTAGGTCCATTTTTAGGG + Intergenic
953663563 3:44908781-44908803 GTCTAGTAGGTTCAATGTCAGGG + Intronic
957464876 3:80574927-80574949 CAATAGTAGGTCCAATATTATGG - Intergenic
970429689 4:15977315-15977337 TCCTAGAAGATCCGATGTTAGGG + Intronic
974430097 4:61785509-61785531 CCTGAGTAAATCCAATGTTAAGG + Intronic
974880827 4:67755361-67755383 CCAAAGCAGGTACAATGTTAAGG + Intergenic
979159439 4:117440844-117440866 AACTAGTTGGTCCAATGATACGG - Intergenic
984472450 4:180193736-180193758 ACCTGGAAGGTCTAATGTTAAGG - Intergenic
988664173 5:33307116-33307138 CCCCAGTATATCCAATGTTTGGG - Intergenic
994114379 5:96045754-96045776 GCCTAGTAGGTCTAACTTTAGGG + Intergenic
995609281 5:113891724-113891746 ACCTAGGAAGTCCCATGTTAGGG - Intergenic
999442774 5:151615340-151615362 ACCTAGTAGCTCCAATGTGAGGG + Intergenic
1005427318 6:25716402-25716424 CCCTACTAGGGCTAATTTTATGG - Intergenic
1007022918 6:38540342-38540364 CCATAGGGGGTCCAATTTTATGG + Intronic
1013264103 6:108477716-108477738 CCCTAGTAGGTCCAATGTTATGG - Intronic
1015507711 6:134006755-134006777 TCCTCGTAGGACAAATGTTAGGG - Intronic
1036937135 8:13014147-13014169 CCTTACTAGTTCCAAGGTTATGG - Intronic
1037365793 8:18121207-18121229 GCCCAGTAGGTAGAATGTTATGG - Intergenic
1040772495 8:50994424-50994446 GTCTAGTAAGTCCAATGTTTGGG + Intergenic
1045918333 8:107500359-107500381 CACTAGTACTTCCAGTGTTATGG - Intergenic
1046161051 8:110365428-110365450 CCCAAGTATTTCCAATGTTCTGG - Intergenic
1046482085 8:114835456-114835478 CCCTTGTAATTCCAATGTTTTGG + Intergenic
1048827491 8:138443072-138443094 CCCCAGTAGGTCCTATCTCAAGG + Intronic
1049770294 8:144377051-144377073 CCTTACTAGGTCCAGTGTTGAGG + Intronic
1189368387 X:40407781-40407803 CCTTACTAGGTGAAATGTTAAGG - Intergenic
1190082391 X:47366553-47366575 CCCTAGAAGGTGCAGTGTCAGGG + Intergenic
1197089704 X:122522008-122522030 GCATAGTAAGTCCAATGTTTGGG - Intergenic
1199585399 X:149411083-149411105 GCCTAGTAAGTCCAATTTTAGGG + Intergenic