ID: 1013267981

View in Genome Browser
Species Human (GRCh38)
Location 6:108518946-108518968
Sequence CAGACCAGCTCCAAACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013267979_1013267981 0 Left 1013267979 6:108518923-108518945 CCCTGGGGAGCGTCTTAGGTGCA 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1013267981 6:108518946-108518968 CAGACCAGCTCCAAACAGCCAGG No data
1013267977_1013267981 14 Left 1013267977 6:108518909-108518931 CCTCTTTACAGTGTCCCTGGGGA 0: 1
1: 0
2: 1
3: 9
4: 190
Right 1013267981 6:108518946-108518968 CAGACCAGCTCCAAACAGCCAGG No data
1013267980_1013267981 -1 Left 1013267980 6:108518924-108518946 CCTGGGGAGCGTCTTAGGTGCAC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1013267981 6:108518946-108518968 CAGACCAGCTCCAAACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013267981 Original CRISPR CAGACCAGCTCCAAACAGCC AGG Intronic
No off target data available for this crispr