ID: 1013270118

View in Genome Browser
Species Human (GRCh38)
Location 6:108537498-108537520
Sequence CATTCTAGTCAGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013270114_1013270118 -9 Left 1013270114 6:108537484-108537506 CCCTCGGGGCAGAGCATTCTAGT No data
Right 1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG No data
1013270105_1013270118 21 Left 1013270105 6:108537454-108537476 CCCTGCAGGGCATGGGGCCCAGC No data
Right 1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG No data
1013270106_1013270118 20 Left 1013270106 6:108537455-108537477 CCTGCAGGGCATGGGGCCCAGCT No data
Right 1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG No data
1013270113_1013270118 3 Left 1013270113 6:108537472-108537494 CCAGCTGGGTGACCCTCGGGGCA No data
Right 1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG No data
1013270112_1013270118 4 Left 1013270112 6:108537471-108537493 CCCAGCTGGGTGACCCTCGGGGC No data
Right 1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG No data
1013270115_1013270118 -10 Left 1013270115 6:108537485-108537507 CCTCGGGGCAGAGCATTCTAGTC No data
Right 1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013270118 Original CRISPR CATTCTAGTCAGAGGGAAGC TGG Intergenic
No off target data available for this crispr