ID: 1013273528

View in Genome Browser
Species Human (GRCh38)
Location 6:108562080-108562102
Sequence TCCGTTCGCCCTTCCCTCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013273528_1013273531 4 Left 1013273528 6:108562080-108562102 CCGGCGAGGGAAGGGCGAACGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1013273531 6:108562107-108562129 AGTACATTTGCTGGATTCTCCGG 0: 1
1: 0
2: 0
3: 25
4: 325
1013273528_1013273535 23 Left 1013273528 6:108562080-108562102 CCGGCGAGGGAAGGGCGAACGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1013273535 6:108562126-108562148 CCGGACAGCACCGAGGAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 133
1013273528_1013273530 -5 Left 1013273528 6:108562080-108562102 CCGGCGAGGGAAGGGCGAACGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1013273530 6:108562098-108562120 ACGGACAGGAGTACATTTGCTGG No data
1013273528_1013273533 19 Left 1013273528 6:108562080-108562102 CCGGCGAGGGAAGGGCGAACGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1013273533 6:108562122-108562144 TTCTCCGGACAGCACCGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1013273528_1013273532 16 Left 1013273528 6:108562080-108562102 CCGGCGAGGGAAGGGCGAACGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1013273532 6:108562119-108562141 GGATTCTCCGGACAGCACCGAGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013273528 Original CRISPR TCCGTTCGCCCTTCCCTCGC CGG (reversed) Intronic