ID: 1013273530

View in Genome Browser
Species Human (GRCh38)
Location 6:108562098-108562120
Sequence ACGGACAGGAGTACATTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013273519_1013273530 22 Left 1013273519 6:108562053-108562075 CCAGGTGAGGAGAGGGGGCAGGG 0: 1
1: 0
2: 11
3: 109
4: 969
Right 1013273530 6:108562098-108562120 ACGGACAGGAGTACATTTGCTGG No data
1013273528_1013273530 -5 Left 1013273528 6:108562080-108562102 CCGGCGAGGGAAGGGCGAACGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1013273530 6:108562098-108562120 ACGGACAGGAGTACATTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013273530 Original CRISPR ACGGACAGGAGTACATTTGC TGG Intronic