ID: 1013273531

View in Genome Browser
Species Human (GRCh38)
Location 6:108562107-108562129
Sequence AGTACATTTGCTGGATTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013273528_1013273531 4 Left 1013273528 6:108562080-108562102 CCGGCGAGGGAAGGGCGAACGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1013273531 6:108562107-108562129 AGTACATTTGCTGGATTCTCCGG 0: 1
1: 0
2: 0
3: 25
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013273531 Original CRISPR AGTACATTTGCTGGATTCTC CGG Intronic