ID: 1013273532

View in Genome Browser
Species Human (GRCh38)
Location 6:108562119-108562141
Sequence GGATTCTCCGGACAGCACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013273528_1013273532 16 Left 1013273528 6:108562080-108562102 CCGGCGAGGGAAGGGCGAACGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1013273532 6:108562119-108562141 GGATTCTCCGGACAGCACCGAGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013273532 Original CRISPR GGATTCTCCGGACAGCACCG AGG Intronic
906263090 1:44407675-44407697 GGGTTCTGCGGCCCGCACCGCGG - Intronic
907291137 1:53413719-53413741 GGATTCTCCAGACTGCACTGTGG + Intergenic
915305380 1:154974259-154974281 GGAGTCTCCGCACCGCACCGCGG + Intronic
923816204 1:237381700-237381722 GGATACTGTGGACAGCACCTGGG + Intronic
1063127278 10:3146580-3146602 GGATTCTCAGGACATGACTGGGG + Intronic
1072743766 10:97926047-97926069 GGCTTCTCCGGACAGCAGGCAGG - Intronic
1076485797 10:130816242-130816264 GGATCCTCAGAACAGCATCGTGG + Intergenic
1082005380 11:47416115-47416137 GGATGCTCCTGCCAGCACAGGGG + Exonic
1085010921 11:73141536-73141558 GCATTCTCGGGGCTGCACCGAGG - Intronic
1085442639 11:76578231-76578253 GGAGTTTCAGGACAGCCCCGTGG - Intergenic
1087078358 11:94146578-94146600 GGGTCCTCAGGACAGCACCCTGG - Intronic
1097872046 12:64610281-64610303 GGTTTCTCCCGACAGCGTCGCGG - Intergenic
1103474565 12:121209384-121209406 GGCTACTCCGCACAGCCCCGGGG + Intergenic
1104535471 12:129614126-129614148 GGGTTCTCCAGACAGTACCCTGG - Intronic
1132950299 16:2558024-2558046 GGAGTCTCCGGCAAGCCCCGAGG - Intronic
1133391413 16:5413278-5413300 GCATTCTCCAGAGAGCACCATGG + Intergenic
1139938955 16:70591027-70591049 GGGGTCTCAGGACAGCACTGTGG + Intronic
1143141314 17:4743401-4743423 GGCTTCTCCAGACACCCCCGAGG + Exonic
1151356034 17:73559121-73559143 GGACTCTCCTGCCTGCACCGGGG + Intronic
1152925914 17:83087675-83087697 GCACTCTCCGGCCAGCGCCGCGG + Intronic
1155877401 18:31103251-31103273 GGATTCTCAGGACATCCCTGAGG - Intergenic
1160678108 19:401120-401142 GGCTTCCCCGGACAGGACCACGG - Intergenic
1163739823 19:19004501-19004523 GGGTTCTCAGGAGAGCCCCGTGG - Exonic
934655449 2:96114829-96114851 GGATCCTCCGGAAGGCACGGCGG + Exonic
942045878 2:172099203-172099225 GGATTCTCCGGCCGGCGGCGGGG - Intergenic
1172853049 20:37980555-37980577 GGCCTCTCAGGACAGCATCGCGG + Intergenic
1184358321 22:43997204-43997226 GGATTCCCCGGGCAGATCCGAGG - Intronic
1184688279 22:46106156-46106178 GGATTCTCCCCACAGCCCTGGGG + Intronic
1185039927 22:48498617-48498639 GGTTTCTCAGGGCAGCACTGGGG + Intronic
961737928 3:129013976-129013998 GGCTTTTCCGGAGAGGACCGAGG + Intronic
973602340 4:52554375-52554397 TGATTCTCTGGACACCAGCGGGG - Intergenic
985619420 5:946206-946228 GGATGCGCCGGACAGCTCCAGGG - Intergenic
991706091 5:69360251-69360273 GGATTCTAGGCACAGCACCAGGG + Intronic
992627646 5:78649107-78649129 GGTTCCTCCGGGCCGCACCGGGG + Intronic
992813050 5:80408311-80408333 GGGTTCCCCGGCCAGCTCCGGGG - Intronic
1003081713 6:3026592-3026614 GGTTTCTCCTGACAGGACTGAGG - Intergenic
1003645871 6:7912322-7912344 GGAATTTCCCAACAGCACCGTGG - Intronic
1003704649 6:8511403-8511425 GGATTCTCCAGAAAGCAACATGG - Intergenic
1007125420 6:39422227-39422249 GGATTCTCTGGGCAGCACTGCGG - Intronic
1013273532 6:108562119-108562141 GGATTCTCCGGACAGCACCGAGG + Intronic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1018498588 6:164377916-164377938 GTCTTCTCCAGACATCACCGTGG - Intergenic
1018641939 6:165911850-165911872 GCTTCCTCCGGACAGCACCTTGG - Intronic
1021632935 7:22664743-22664765 GGATGCTCCGAACTACACCGGGG - Intergenic
1022473933 7:30698314-30698336 GGATTCTCAGGGCAACACTGTGG - Intronic
1034101106 7:148451294-148451316 GGAATCTCAAGACAGCACCAAGG - Intergenic
1034150834 7:148914340-148914362 AGCTTCCCTGGACAGCACCGAGG - Intergenic
1038425179 8:27460150-27460172 GGGTTCTCGGGACAGCATGGAGG - Exonic
1062275337 9:135727738-135727760 GGATTCTCCGGACAGAGGTGGGG + Intronic
1185850971 X:3486217-3486239 GGATTTTACAGACAGCACTGAGG + Intergenic