ID: 1013273532 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:108562119-108562141 |
| Sequence | GGATTCTCCGGACAGCACCG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 50 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 46} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1013273528_1013273532 | 16 | Left | 1013273528 | 6:108562080-108562102 | CCGGCGAGGGAAGGGCGAACGGA | 0: 1 1: 0 2: 0 3: 6 4: 77 |
||
| Right | 1013273532 | 6:108562119-108562141 | GGATTCTCCGGACAGCACCGAGG | 0: 1 1: 0 2: 0 3: 3 4: 46 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1013273532 | Original CRISPR | GGATTCTCCGGACAGCACCG AGG | Intronic | ||