ID: 1013273535

View in Genome Browser
Species Human (GRCh38)
Location 6:108562126-108562148
Sequence CCGGACAGCACCGAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013273528_1013273535 23 Left 1013273528 6:108562080-108562102 CCGGCGAGGGAAGGGCGAACGGA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1013273535 6:108562126-108562148 CCGGACAGCACCGAGGAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013273535 Original CRISPR CCGGACAGCACCGAGGAGGT AGG Intronic