ID: 1013273673

View in Genome Browser
Species Human (GRCh38)
Location 6:108562887-108562909
Sequence CTGTCTTGGGGGAAGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 1, 2: 4, 3: 54, 4: 638}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013273673_1013273683 16 Left 1013273673 6:108562887-108562909 CCTGGCCCCTTCCCCCAAGACAG 0: 1
1: 1
2: 4
3: 54
4: 638
Right 1013273683 6:108562926-108562948 GCCAAAGAGTCCTGTGCGATTGG 0: 1
1: 0
2: 0
3: 8
4: 60
1013273673_1013273681 -6 Left 1013273673 6:108562887-108562909 CCTGGCCCCTTCCCCCAAGACAG 0: 1
1: 1
2: 4
3: 54
4: 638
Right 1013273681 6:108562904-108562926 AGACAGTGTGTGTCAGTACCAGG 0: 1
1: 0
2: 2
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013273673 Original CRISPR CTGTCTTGGGGGAAGGGGCC AGG (reversed) Intronic
900095933 1:940115-940137 CTGCCCTGGGGGACGGTGCCTGG - Intronic
900415474 1:2532632-2532654 CTGGCTCAGGGGAAGGGACCAGG - Intergenic
900616166 1:3566625-3566647 GTGCGTTGGGGGAAGGGCCCCGG - Intronic
900692422 1:3988583-3988605 CTCTCCTGGGAGAAGGAGCCAGG + Intergenic
900947347 1:5838519-5838541 CTGTCCTGGGAGGAGGGGGCTGG + Intergenic
900958263 1:5901942-5901964 TTGTCTTTGGGGGAGGGGGCTGG - Intronic
901457786 1:9373279-9373301 GTGACTGGGGAGAAGGGGCCTGG + Intergenic
902778520 1:18689963-18689985 TTGTATTGGTGGAAGGGGTCAGG + Intronic
903007601 1:20308936-20308958 CTGTCTGCGGGGTAGGTGCCAGG - Intronic
903406586 1:23102396-23102418 CTGTGTTGGGAGAAGGGGCAGGG - Intronic
903601546 1:24545591-24545613 CTCCTTTGGGGGAAGGAGCCTGG - Intergenic
904821732 1:33249552-33249574 CTTTCTTGGGGGAGTGGGGCAGG - Intergenic
905337032 1:37251878-37251900 ATGTCTCAGGGGAAGGGGCCTGG + Intergenic
905775993 1:40667444-40667466 CTGTCTCTGTGAAAGGGGCCAGG - Intergenic
905793204 1:40801168-40801190 CTGGCTGGGGGGAAGGGGAATGG + Intronic
905893943 1:41533359-41533381 CTGTGGTGGTGGAAGGGGCTAGG - Intronic
906183237 1:43839562-43839584 CTGTCTCTGGGGAAGGAGTCTGG - Intronic
906459337 1:46025423-46025445 ATGTGTTGTGGGAAGGGACCTGG - Intronic
906898735 1:49809298-49809320 CTGTCGTGGGGGGAGGGGGGAGG - Intronic
907012768 1:50978376-50978398 CTGTCATGGGGGGAGGGGAAGGG - Intergenic
907253699 1:53161386-53161408 TTTCCTTGAGGGAAGGGGCCTGG + Intergenic
907408457 1:54268461-54268483 CTGTCGGGGGTGAAGGGGCAGGG - Intronic
908366992 1:63434725-63434747 CTGGTTTAGGGGAAAGGGCCAGG + Intronic
909707474 1:78604666-78604688 CTCACATGGTGGAAGGGGCCAGG - Intergenic
910130061 1:83893839-83893861 GTGTCCTAGGGGAAGGGGCAGGG + Intronic
910319387 1:85926661-85926683 CTGTCATGGGGTGAGGGGCAGGG + Intronic
910892057 1:92028836-92028858 CTGTCTTGGGGTGAGGGGGAGGG - Intergenic
911816594 1:102359943-102359965 CTGTCGGGGGGTAAGGGGCAAGG + Intergenic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
912796796 1:112698400-112698422 CCTTCTTGGAGGAGGGGGCCAGG - Exonic
913048927 1:115098472-115098494 TAGTCCTGGGGGAAGGTGCCTGG + Intergenic
913161266 1:116148075-116148097 CTGAGTTGGGGTGAGGGGCCTGG - Intergenic
913407493 1:118511932-118511954 CTGTCCTGGGGTAGGGGGCAGGG - Intergenic
915237178 1:154492498-154492520 CTGGCCTGGGGGTGGGGGCCAGG - Intronic
915448758 1:155990129-155990151 CTGACTTTGGGGAAGTGGTCAGG + Intronic
915611076 1:156993524-156993546 TTGTCTTTAGGGAAGGGCCCAGG - Intronic
915792682 1:158691503-158691525 CTGTCATGGGGTGAGGGGCAAGG + Intergenic
916252411 1:162751990-162752012 CTGTCGTGGGGTGAGGGGACGGG + Intronic
916602539 1:166306967-166306989 CTGTCTTTGGGGAAGGTTTCTGG + Intergenic
916961450 1:169893722-169893744 GCGCCGTGGGGGAAGGGGCCGGG - Intronic
917106209 1:171494774-171494796 CTTTCTTGAGGGAGGGGGGCAGG - Intronic
917288275 1:173444184-173444206 CTGTGTTGGAGAAAGGGGTCGGG - Intergenic
917483311 1:175432050-175432072 CTGCCTGTGGGGAGGGGGCCAGG + Intronic
918085611 1:181242566-181242588 CTGTCTTGGGGTGAGGGGACGGG - Intergenic
918088139 1:181262795-181262817 GAGTCCTAGGGGAAGGGGCCCGG + Intergenic
918099124 1:181358155-181358177 CTCTCTACGTGGAAGGGGCCAGG + Intergenic
918427917 1:184429005-184429027 CTGGGTTGGGGGATGGAGCCAGG - Intronic
919843987 1:201629423-201629445 CTGCCCTGGGAGAGGGGGCCAGG - Intronic
920687611 1:208121212-208121234 CTGCCTTAGGAGAGGGGGCCTGG + Intronic
920831735 1:209471738-209471760 CTTTCTTGTGGGCAGGGGCGGGG + Intergenic
921980892 1:221257600-221257622 CTGTCATGGGGTGAGGGGTCAGG - Intergenic
922062207 1:222103698-222103720 CTGTGCTGAGGGAGGGGGCCCGG + Intergenic
922643579 1:227261786-227261808 CTGACATGGGGAAAGGGTCCTGG - Intronic
922748064 1:228058366-228058388 CTTTCTTTGGGGAAGGGGTAGGG - Intronic
922866901 1:228868171-228868193 TTTCCTTGGGGGATGGGGCCAGG + Intergenic
924335373 1:242982205-242982227 CTGTCTTGAGGGAAAGGGAGGGG - Intergenic
1063935519 10:11073717-11073739 CTGACTGAGGAGAAGGGGCCAGG + Intronic
1064142481 10:12802392-12802414 CTGTCTGTGGAGAAAGGGCCTGG - Intronic
1065426361 10:25608525-25608547 CTGTCATGGGGTGAGGGGCAAGG - Intergenic
1065500983 10:26382096-26382118 CAGTGTTGGGGGAAGGGACCTGG + Intergenic
1065504781 10:26418952-26418974 CTGTCGTGGGGGAGGGGGAAGGG - Intergenic
1065515525 10:26520521-26520543 TTGTCTTGGGGGATAGTGCCTGG + Intronic
1067693445 10:48519220-48519242 CTGTCTTGGAGGGAGAGGTCAGG - Intronic
1067945479 10:50685789-50685811 GGGTCTGGGGGGAAGGGGCTGGG + Intergenic
1067985186 10:51135959-51135981 CTGTTGTGGGGGAAGGGGGGAGG + Intronic
1068528336 10:58156614-58156636 CTGTTTTGGGGGTAGGAGGCTGG + Intergenic
1069596089 10:69671724-69671746 CTGTCATGGGGTGAGGGGCTAGG + Intergenic
1069827365 10:71262371-71262393 CTGGCTGGGGGGATGGGGCAGGG + Intronic
1069904844 10:71726217-71726239 CTGGTTTAGGGGAAGGGGCTGGG - Intronic
1069912398 10:71767534-71767556 CCATCCTGGGGGATGGGGCCTGG - Intronic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070559931 10:77558659-77558681 CTTTCTTGGGGGCAGGGACTGGG - Intronic
1070660606 10:78303065-78303087 CGGACTTGGGGGAAGGGACGTGG + Intergenic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1070830308 10:79414057-79414079 CTGTCTTGGTGGAAGGGGTGAGG - Intronic
1070866992 10:79712662-79712684 GGGTCTGGGGGGAAGGGGCTGGG + Exonic
1070880782 10:79850783-79850805 GGGTCTGGGGGGAAGGGGCTGGG + Exonic
1071396943 10:85233351-85233373 CTGCCTTGAAGGAAGGGGTCAGG + Intergenic
1071633904 10:87234885-87234907 GGGTCTGGGGGGAAGGGGCTGGG + Exonic
1071647354 10:87367102-87367124 GGGTCTGGGGGGAAGGGGCTGGG + Exonic
1071669119 10:87590692-87590714 CTGTTTGCGGGGAGGGGGCCTGG - Intergenic
1073693373 10:105836225-105836247 CTGTCGTGGGGTGAGGGGTCGGG + Intergenic
1074533959 10:114315502-114315524 CTCTCCTTGGGGAAGGGGCAGGG - Intronic
1074584696 10:114755759-114755781 CTGTCCTGGGGCAGGTGGCCAGG + Intergenic
1074820736 10:117176302-117176324 CTGTCTTGAGGGCAGGGGAAAGG - Intergenic
1075121880 10:119670235-119670257 CTGTCCTGAGGGGATGGGCCCGG - Intronic
1075626785 10:123969607-123969629 CTGTCTAGGGGTAGGGGGGCGGG + Intergenic
1075718042 10:124568405-124568427 CTGTCCCGGGGGCAGAGGCCGGG - Intronic
1076548092 10:131259663-131259685 ATGTCCTCGGGGCAGGGGCCCGG - Intronic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1076890379 10:133280486-133280508 CTAGCCTGGGGGAAAGGGCCAGG - Intronic
1077394617 11:2314963-2314985 CTGTCTAGGGGGAAGGGTGCAGG + Intronic
1077697657 11:4409151-4409173 CTGTCTGGGGGTGAGGGGCTAGG + Intergenic
1078493897 11:11796935-11796957 CTGTCTTTGGGTAGGGGGCAGGG - Intergenic
1078585303 11:12580839-12580861 TTGTCCTGGGGGTAGGGGCTGGG + Intergenic
1079572813 11:21965657-21965679 CTGGGTTGGAGGAAGGGGCAGGG - Intergenic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1080216389 11:29846378-29846400 CTTTTTTGGGGGGAGGGGACGGG - Intergenic
1082122859 11:48398165-48398187 CTATCATGGGGGAAGGAGCAAGG + Intergenic
1082556560 11:54569441-54569463 CTATCATGGGGGAAGGAGCAAGG + Intergenic
1082563232 11:54643803-54643825 CTGTCGTGGGGTAGGGGGTCAGG + Intergenic
1082867653 11:57914357-57914379 TTTTTTTGGGGGAAGGGGCGGGG + Intergenic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1083300948 11:61739397-61739419 CTGGCTGGGGGGCAGGGGCAGGG - Intronic
1083329666 11:61891621-61891643 CAGCCTTGGGGGCCGGGGCCTGG - Intronic
1083513166 11:63230797-63230819 CTGTCTTGGGGTTAGGGGATGGG - Intronic
1083749437 11:64753264-64753286 GTGTCTTGCTGAAAGGGGCCTGG + Intronic
1084385183 11:68839347-68839369 GGGGCTTGGGGGAAGGGGCGGGG - Intronic
1084587895 11:70073843-70073865 CTGTCTTGGGGGTGGGGGGCGGG - Intergenic
1084680496 11:70663676-70663698 CTGTCTCTGGGGAGGGGGCAAGG - Intronic
1085784105 11:79436840-79436862 CTGTGGTGGGGGAAGGGATCAGG - Intronic
1086253092 11:84840834-84840856 CTGTCCTGGGGTAGGGGGCAGGG + Intronic
1086388854 11:86339892-86339914 CTGTCTTGGGGTGGGGGGCAGGG - Intronic
1086497714 11:87421408-87421430 GAGTCTTGGGGAAAGGGTCCAGG + Intergenic
1087301732 11:96443698-96443720 CTCTCCTGGGGGCAGGGACCTGG + Intronic
1087721868 11:101674827-101674849 CTGTTTTGGGGGTTGGGGCATGG + Intronic
1088690594 11:112323433-112323455 CTGTCAGGGGGGCTGGGGCCTGG - Intergenic
1088840677 11:113625006-113625028 CTCACTTGGTGGAAGGGGCAAGG + Intergenic
1088971765 11:114780285-114780307 CTGTCTTGGGCCAAGGAGGCAGG + Intergenic
1089014377 11:115154448-115154470 CTGCCTCGGGGGCAGGGACCAGG - Intergenic
1089273257 11:117315847-117315869 CAGACTTGGGGGCAGGCGCCAGG - Exonic
1089503742 11:118949246-118949268 CTGTCATGGGGTAGGGGGCAGGG - Intronic
1089876039 11:121722943-121722965 CTGTCGTGGGGGAGGGGGCCCGG + Intergenic
1090726161 11:129529255-129529277 CTCCCTTGGTGGAAGGGGCCAGG + Intergenic
1091277643 11:134363133-134363155 CTGGCTTGAGGGGAGGGGTCTGG + Intronic
1091803752 12:3341816-3341838 CTGCCTCCGGGGAAGGGGACAGG + Intergenic
1092182173 12:6453330-6453352 CTGTCCTGGTGGAGGGAGCCCGG - Intronic
1092259619 12:6946070-6946092 CTGTTCAGGGGGATGGGGCCTGG - Intergenic
1092526747 12:9314293-9314315 CTGCCCTGGAGGAAGGGGCAGGG - Intergenic
1092540525 12:9417486-9417508 CTGCCCTGGAGGAAGGGGCGGGG + Intergenic
1094090367 12:26643092-26643114 CTGACTTGGGGAAAGGGGCAAGG - Intronic
1094719999 12:33053121-33053143 CTGCCTGAGGGCAAGGGGCCAGG - Intergenic
1095793255 12:46190084-46190106 CTGTCGTGGGGTGGGGGGCCCGG - Intronic
1095939579 12:47717264-47717286 CCTTCTAGGGGGAAGGGGCGGGG - Intronic
1095971084 12:47902436-47902458 CTGTCTTGGAGTCAGGGGCCTGG + Intronic
1096238161 12:49943614-49943636 ATGTAATGGGGGAAGGAGCCAGG + Intergenic
1096245410 12:49982315-49982337 CTGTGGTGAGGGAAGAGGCCAGG + Intronic
1096527210 12:52217486-52217508 CTGTCTTGGGGCAGGCTGCCAGG - Intergenic
1096876485 12:54633934-54633956 GTTGGTTGGGGGAAGGGGCCAGG + Intronic
1097069807 12:56346649-56346671 CGGGCTTGAGGGAAGAGGCCGGG + Intronic
1097143106 12:56919722-56919744 CTGTCTGAGGGTAAGGGGCTAGG + Intergenic
1097644871 12:62224450-62224472 CTTACATGGTGGAAGGGGCCAGG + Intronic
1097716971 12:62977351-62977373 CTGTTTTAAAGGAAGGGGCCAGG + Intergenic
1098991513 12:77068972-77068994 CTGTCATGGGGTAGGGGGCAAGG - Intergenic
1100018525 12:90041861-90041883 CTATCTTCTGGGAAGTGGCCTGG + Intergenic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1100522022 12:95384327-95384349 CTGTTTTAAAGGAAGGGGCCAGG - Intergenic
1101325525 12:103712258-103712280 GTCTCATGGGGGCAGGGGCCAGG + Intronic
1101857941 12:108459577-108459599 CTGTTTTCTGGGAAGGGGACTGG - Intergenic
1101987865 12:109461507-109461529 CATTCTTGGGGGTGGGGGCCAGG + Intronic
1102053219 12:109878422-109878444 CTGAGTTGGGGGATGGGGCACGG - Intronic
1102445373 12:112998187-112998209 CTGTTTTGGGGAAAGAGGCCTGG - Intronic
1103359616 12:120346122-120346144 CAGTCTTGGGGTGAGTGGCCAGG - Exonic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1103972010 12:124678463-124678485 CTGTCTAGGAGGCAGGGGCGGGG - Intergenic
1103983344 12:124750922-124750944 CTTTCTGGGGTGAAGGGGGCGGG + Intergenic
1104108584 12:125685911-125685933 ATGTCCTGGGGGAACTGGCCTGG - Intergenic
1104457727 12:128929095-128929117 CTCGCTTGGTGGAAGGGGCGAGG - Intronic
1105024774 12:132840634-132840656 GGGTCTTGGAGGAAGGGCCCGGG + Intronic
1106403276 13:29450142-29450164 CTCTCTGGGGGGAAGTGTCCAGG + Intronic
1107824153 13:44312409-44312431 CTGTCTTGAGGCCAGGGGGCTGG - Intergenic
1109584629 13:64383037-64383059 CTGTCATGGGGTAGGGGGCTAGG - Intergenic
1112015336 13:95326826-95326848 GTATCATGGGGGAAGGTGCCTGG + Intergenic
1112420884 13:99247579-99247601 CTGTCTATGGGTAAGGGGCAAGG + Intronic
1112907254 13:104439171-104439193 CTGTTGTGGGGGAAGGGGGGAGG + Intergenic
1113711251 13:112466842-112466864 GTGTCCTGGGGGAGGAGGCCTGG - Intergenic
1113714426 13:112493082-112493104 CTGGCTTTGGGAACGGGGCCTGG + Intronic
1113714435 13:112493120-112493142 CTGGCTTTGGGAACGGGGCCTGG + Intronic
1114263775 14:21058869-21058891 CTGTCTTGGGGTAAGTGGAGAGG + Intronic
1114412913 14:22517599-22517621 CTGTCTTTTGGGAAGGGGCTCGG - Intergenic
1114568083 14:23647076-23647098 CTGCCTTCAGGGAGGGGGCCAGG - Intergenic
1115755760 14:36524950-36524972 CCCTCTGGCGGGAAGGGGCCTGG + Intergenic
1117546499 14:56798120-56798142 CTGGCCGGGGAGAAGGGGCCGGG - Intergenic
1117630127 14:57682482-57682504 CTGTCATGGGGTAGGGGGCTAGG + Intronic
1117890243 14:60413491-60413513 CTGTCATGGGGGCAGGGGAAGGG - Intronic
1119385969 14:74258386-74258408 CTGCCGCGGGGGAGGGGGCCCGG + Intronic
1120818070 14:88883883-88883905 CTGTTTTAAGGGAAGGGGCCGGG - Intergenic
1121659004 14:95620804-95620826 CTGTCTTTGTGGAAGGGCACAGG + Intergenic
1121693510 14:95894423-95894445 CTGTCCTGGGTTAAGGTGCCTGG - Intergenic
1122066308 14:99176269-99176291 CTGGCCTGGGGGACGCGGCCCGG + Intronic
1122269868 14:100564075-100564097 CTGTCTGTGGGGAAGGGTCTCGG + Intronic
1122269888 14:100564132-100564154 CTGTCTGTGGGGAAGGGTCTCGG + Intronic
1122631621 14:103109856-103109878 CTGTGCTGGGGGAGGGGGCAGGG - Intronic
1122810988 14:104287765-104287787 ATGTCTTGGGGGAGGTGGCCTGG + Intergenic
1123670193 15:22648778-22648800 CTTACTTGGTGGAAGGGGCTAGG + Intergenic
1123984638 15:25634443-25634465 CTTTCTTGGGGGAAGGGGCCTGG - Intergenic
1124056207 15:26242892-26242914 CTGTGTTGGGGTCAGGGCCCTGG - Intergenic
1124526166 15:30455196-30455218 CTTACTTGGTGGAAGGGGCTAGG + Intergenic
1124628044 15:31320854-31320876 CTCACATGGTGGAAGGGGCCAGG + Intergenic
1124772488 15:32552488-32552510 CTTACTTGGTGGAAGGGGCTAGG - Intergenic
1126419493 15:48456409-48456431 GTGTGTTGGGGGAAAGGGGCTGG + Intronic
1126617695 15:50602377-50602399 CTGTCATGGGGTAGGGGGCAGGG + Intronic
1126760378 15:51964394-51964416 CTGTCATGGGGTGAGGGGCAGGG + Intronic
1127580582 15:60335653-60335675 CTGTCATGGGGTCAGGGGCAGGG + Intergenic
1127625045 15:60772205-60772227 CTGTCAGGGGGGTGGGGGCCTGG - Intronic
1128055793 15:64699358-64699380 GTTTTTTGGGGGAAGGGGGCAGG - Intronic
1128223128 15:65982530-65982552 CTCTCCTTGGGGCAGGGGCCAGG + Intronic
1128245109 15:66127722-66127744 AGGTCCTGGGGGAATGGGCCGGG - Intronic
1128493242 15:68172060-68172082 CTGTCTTGGGGTGGGGGGCTGGG - Intronic
1128876885 15:71208990-71209012 ATCTCTTGGGGGAAGGGTCACGG + Intronic
1128987902 15:72234650-72234672 CAGGTATGGGGGAAGGGGCCTGG - Intergenic
1129205758 15:74036183-74036205 CTTTCTTGGGCAAAGAGGCCTGG - Intronic
1129661159 15:77553857-77553879 CCCTCTTGCTGGAAGGGGCCGGG + Intergenic
1129863134 15:78879226-78879248 CTGTCTTGGGGGGCGGGGCGGGG - Intronic
1130271970 15:82456472-82456494 CTGTCTTGGAGGTAGTGGGCGGG - Intergenic
1131116504 15:89799382-89799404 CTGTCCTGGGGCAGGGGGCAGGG + Intronic
1132498266 16:273917-273939 CTGTCTTGGGTTTTGGGGCCTGG + Intronic
1132956935 16:2599285-2599307 GTGACTTGGGGGTAGGGACCAGG - Exonic
1132969287 16:2677738-2677760 GTGACTTGGGGGTAGGGACCAGG - Intergenic
1133008244 16:2896500-2896522 CTGGCTTGGGGGATGGCTCCTGG - Exonic
1133013807 16:2929736-2929758 CTGGCTTGGGGGATGGCTCCTGG - Exonic
1133014964 16:2935423-2935445 CTGGCCTGGGGGCAGAGGCCGGG + Intronic
1133208343 16:4247791-4247813 CTGTTTTAAAGGAAGGGGCCAGG - Intergenic
1133782468 16:8950492-8950514 TTGCCTTGGGGTAAGGGGTCTGG - Intronic
1133930044 16:10224511-10224533 CTGTCTTGGAGGAAGAGGTTTGG + Intergenic
1134838603 16:17382986-17383008 CTGTCTTGGGAGATGGGACTGGG - Intronic
1135258681 16:20962666-20962688 CTTTTTTGGGGGGAGGGGGCAGG + Intronic
1135332781 16:21574610-21574632 GTGGGGTGGGGGAAGGGGCCAGG - Intergenic
1135642207 16:24130459-24130481 CTATTTTGGGGGTGGGGGCCAGG - Intronic
1135971661 16:27076365-27076387 CTATCTGGGGGGAAGGGACATGG - Intergenic
1136522560 16:30806238-30806260 CTCTCTCGGGAGGAGGGGCCAGG - Intergenic
1136845399 16:33572462-33572484 CTTGTTTGGGGGCAGGGGCCAGG + Intergenic
1137282103 16:46986103-46986125 CTTTTTTGGGGGAATGGGGCGGG + Intergenic
1138249097 16:55488796-55488818 CTGTCTTGGGGAAAGGAGGTGGG - Intronic
1138451316 16:57094783-57094805 CTGTTCTAGGGGCAGGGGCCTGG + Intronic
1138475177 16:57266425-57266447 CTCTCTTGGGGGACTGGGCTGGG - Intronic
1138528217 16:57620853-57620875 CTGTCGTGGAAGAAAGGGCCCGG + Intronic
1139130367 16:64135483-64135505 CTGTCTGGGGGTGAGGGGCAAGG - Intergenic
1139472727 16:67186880-67186902 CTTGCCTGGGGGGAGGGGCCAGG + Exonic
1140592331 16:76368666-76368688 CTGTTGTGGGGTAAGGGGCAAGG + Intronic
1140796804 16:78445871-78445893 CTGTCTTGGGGCGGGGGGCAGGG + Intronic
1141992362 16:87617817-87617839 GTGTCTGGGTGGAAGGGGCGGGG + Intronic
1142063642 16:88047404-88047426 CTGGTTTGGGGGAAGGAGCAAGG - Intronic
1142127038 16:88415355-88415377 GGGGCTTGGGGGAAGGGCCCTGG - Intergenic
1142205573 16:88781411-88781433 GCGTGTTTGGGGAAGGGGCCAGG - Intronic
1142215256 16:88826662-88826684 TTGGATCGGGGGAAGGGGCCGGG + Intronic
1142259965 16:89038038-89038060 CAGTCCTGGGGGCAGGGGCAGGG + Intergenic
1142304958 16:89279798-89279820 CTGTTCTGGGGGAACGGGCGCGG + Exonic
1203107107 16_KI270728v1_random:1421115-1421137 CTTGTTTGGGGGCAGGGGCCAGG + Intergenic
1142497455 17:313946-313968 CTGGCTTGGGTGATGAGGCCGGG - Intronic
1143620172 17:8076042-8076064 TTGGCCTTGGGGAAGGGGCCTGG - Intronic
1143719204 17:8798462-8798484 CTTCCTGGGGGGAAAGGGCCCGG - Exonic
1144959890 17:19039074-19039096 CTGGTGTGGGGGAAGGAGCCGGG - Intronic
1144975270 17:19135450-19135472 CTGGTGTGGGGGAAGGAGCCGGG + Intronic
1145769769 17:27484725-27484747 CTGCCTTGGGGCTAGGGGTCAGG + Intronic
1145875835 17:28317924-28317946 GTGTCGTGGGGGCAGGAGCCAGG - Intergenic
1145950431 17:28812668-28812690 CTGGCTTTGGGGTAGGGGCCGGG - Intronic
1146594557 17:34157359-34157381 CTGCCTTGGGGGGAAGGGCAGGG + Intronic
1146803186 17:35844058-35844080 CGGCCTAGGGGGATGGGGCCAGG - Exonic
1146862922 17:36320897-36320919 CTGTCATGGGGTAGGGGGCTGGG - Intronic
1146890418 17:36503010-36503032 CTGTCTTAGGGCTAGGGGCTGGG - Intronic
1147017786 17:37506363-37506385 CTGGCTTGGGGGATGGGGGTAGG - Intronic
1147093251 17:38124980-38125002 CTGTCATGGGGTAGGGGGCTGGG - Intergenic
1147103956 17:38195508-38195530 CTGTCATGGGGTAGGGGGCTGGG + Intergenic
1148029259 17:44608538-44608560 AGGCCTTGGGGGAGGGGGCCAGG - Intergenic
1148185632 17:45641615-45641637 ATGGCTTGGGGGCAGGGGCTTGG - Intergenic
1148336877 17:46847854-46847876 CTGGCCTGGGGGCAGGTGCCGGG + Intronic
1148425535 17:47592901-47592923 CTGTCATGGGGTAGGGGGCTGGG - Intronic
1148755057 17:49969100-49969122 CTGTCCCGGGGGGCGGGGCCCGG + Intronic
1148852912 17:50563351-50563373 CTGCCTGGGAGAAAGGGGCCTGG - Intronic
1149991836 17:61387759-61387781 CTTTCTTGGGGGATGGGGGTGGG + Intronic
1150103600 17:62445137-62445159 CTGTCTGGGGGTGAGGGGGCTGG + Intronic
1150505464 17:65693874-65693896 CTCCCATGGTGGAAGGGGCCAGG - Intronic
1150941714 17:69700186-69700208 GTGTGTTGTGGGAAGGGACCCGG + Intergenic
1151162335 17:72176031-72176053 ATGTGTTGGGGGAAGGGGGGAGG - Intergenic
1151550186 17:74818245-74818267 CAGGCTTGGGGGATGGGGCTGGG - Intronic
1151652977 17:75481433-75481455 CTGGCCTGAGGGACGGGGCCTGG - Intronic
1151723920 17:75874016-75874038 CTGGCCTGGGAGAAGGGGGCTGG - Intergenic
1151770337 17:76156371-76156393 CTGTGCTGGAGGAAGGGGTCAGG + Intronic
1151844189 17:76639924-76639946 CTGTCTTGGAGGGTGGGGCTAGG + Intronic
1151883103 17:76906372-76906394 CGGTCTTGGGGGATGTGGCAGGG + Intronic
1152225419 17:79090503-79090525 CTGTCTTGGGAGTTGGGGGCTGG + Intronic
1152412805 17:80137720-80137742 CTCTATGGGGGGAGGGGGCCAGG + Intronic
1152460097 17:80438170-80438192 CAGCCTTGGGGAAAGGGGCTGGG - Intergenic
1152574122 17:81132732-81132754 CTGTGCTGAGGGAAGGGGCTGGG - Intronic
1152684063 17:81685123-81685145 TTGGCTTGGAGCAAGGGGCCTGG + Intronic
1152714023 17:81889748-81889770 CTGCCTTTGGGGGAGGGGCTGGG - Intronic
1153358139 18:4161232-4161254 CTGTCCTGGGGAAAGGTGGCGGG - Intronic
1153444583 18:5156877-5156899 CTGTAATGGGGGTAGGGGACAGG + Intronic
1154308048 18:13244685-13244707 GTGTCTTGGGGGAAGAGGGAAGG - Intronic
1155487051 18:26356177-26356199 CTCACTTGGTGGAAGGGGCGAGG + Intronic
1156461928 18:37326099-37326121 CTGTCCTGGGAGAGGAGGCCGGG + Intronic
1156517475 18:37693091-37693113 CTGTCATGGGGTAGGGGGCAGGG - Intergenic
1157188775 18:45562789-45562811 CTCCCTGGGGGGAAGGGGCTGGG + Intronic
1157300042 18:46472681-46472703 CTGTCTTGGGGGAGGGGTAATGG + Intergenic
1157312216 18:46560742-46560764 CTTTGTTGGAGGATGGGGCCAGG - Intronic
1157500023 18:48183817-48183839 CTGACTTGGAGGCAGGGGGCAGG - Intronic
1158495904 18:57954931-57954953 CTGAGTTGGGGCAAGGGGACAGG + Intergenic
1158541169 18:58355967-58355989 CTGTCTTGGGGACCGGGGCGGGG - Intronic
1158548902 18:58418219-58418241 TTGCTTTGGGGGATGGGGCCTGG + Intergenic
1158829810 18:61264418-61264440 CTGTTCTGGGGGATGTGGCCGGG - Intergenic
1159010205 18:63051731-63051753 CTGGCTTGGAGGATGGGGGCTGG + Intergenic
1159652976 18:70999563-70999585 CAGCCTTGGGGAAAGGGCCCTGG + Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160501347 18:79402411-79402433 GTGTTTTGGGGGAATGAGCCCGG - Intronic
1160677217 19:397856-397878 CTGTCTGGAAGGAAGGGGCATGG - Intergenic
1160865218 19:1253210-1253232 CTGTCTTGGGGCAGGGGGGTAGG + Intronic
1160886401 19:1351004-1351026 CTGGCTTGTGTGAAGGGGGCTGG + Intergenic
1160939784 19:1614855-1614877 CTGCCTGACGGGAAGGGGCCAGG + Intronic
1160985423 19:1836407-1836429 CCGTCTGGGTGGGAGGGGCCTGG - Intronic
1161292258 19:3500815-3500837 CGTTCTTCGGGGAAGGGGACGGG + Exonic
1161439012 19:4279984-4280006 CCTCCTTGGGGAAAGGGGCCCGG + Exonic
1161827338 19:6577100-6577122 ATCTCTTGGGGGCAGGGGCGGGG - Intergenic
1162477202 19:10907780-10907802 CTGTCTGGTGGGAGTGGGCCTGG - Intronic
1162479307 19:10919511-10919533 CAGACCTGGGGGAAGGGGCAGGG + Intronic
1163215307 19:15871895-15871917 CTGGTTTGGGGGATGGTGCCAGG - Intergenic
1163556904 19:17998326-17998348 TGGTCTTGGGGGCCGGGGCCGGG - Exonic
1163831876 19:19550856-19550878 CTGTCTGGTGGGAGGTGGCCTGG + Intergenic
1164728128 19:30480542-30480564 CTGTCGTGGGGTAGGGGGCAAGG + Intronic
1165118118 19:33541363-33541385 TTGTCTTTGGGGAGGAGGCCAGG - Intergenic
1165639325 19:37370885-37370907 CTGTGTTGGGGAAAGCGGCCAGG - Intergenic
1165807158 19:38587487-38587509 CTGCCTTAGGGGGAGGGGCTTGG - Intronic
1165889303 19:39100930-39100952 CTTTCTAGGGAGAAGGGCCCAGG - Exonic
1165943082 19:39425001-39425023 CTGGCTCGGCGGCAGGGGCCTGG + Exonic
1166270018 19:41708023-41708045 CTGTCCTTGGGGAAGGCTCCAGG - Intronic
1166645687 19:44530030-44530052 TGGTCTTGGGAGAAGGGGCAGGG + Intergenic
1166874216 19:45887207-45887229 CTGTCTTTGGGGAAGGGCGGAGG + Intergenic
1166874981 19:45891441-45891463 CTGTCTTGGGGCTGGGGGGCGGG - Intronic
1167055956 19:47111983-47112005 CTGGCTTCGGGGAAGGGGATGGG - Intronic
1167077059 19:47256610-47256632 GTGACCTGGGGGAGGGGGCCGGG + Intronic
1167517268 19:49930468-49930490 CTGTATTGGGGGAAGGGGTGGGG + Intronic
1167560111 19:50221928-50221950 TTGACTTGGGGGAAGGAGCAGGG - Intronic
1167735827 19:51294032-51294054 CTGTGTGGGGCGAGGGGGCCTGG - Intergenic
1167801236 19:51743714-51743736 CTGTCTTTGGGTGAGGGGCTGGG - Intergenic
1167854370 19:52226097-52226119 CCGTGCTGGGGGAAGGGGCCTGG - Exonic
1167859317 19:52270124-52270146 CTGTGTTGGGGGAGGTGGCCGGG + Intronic
1168145183 19:54416379-54416401 GTGTCCCTGGGGAAGGGGCCCGG + Intronic
1168687088 19:58355502-58355524 CTTTTTTGGGGGAGGGGGCAGGG - Exonic
925140025 2:1543899-1543921 CAGTCATGGTGGAAGGGGCAGGG + Intergenic
925147929 2:1593482-1593504 CTCTCCTGGGGGAAGGGGTGAGG - Intergenic
925161137 2:1685230-1685252 CTGTCCCGGGGCAAGGGGCAGGG - Intronic
925173297 2:1765904-1765926 CTGTCATGGGGTAAGGGGAGTGG + Intergenic
925319463 2:2951138-2951160 CTGTGCTGGAGGAAGGGGCACGG + Intergenic
925657236 2:6162863-6162885 CTGTCTTGGGGTGGGGGGCAGGG + Intergenic
925943889 2:8843082-8843104 CTGCAGTGGGGGAAGGGGCTAGG - Intergenic
927395349 2:22643981-22644003 CTGTCTGGGGGTAGGGGGCAAGG + Intergenic
927637987 2:24829911-24829933 CTTTCTTGGGGAAAAGGGACAGG - Intronic
927943117 2:27118381-27118403 CTTTCTTGGGGGATGGGTGCTGG - Intronic
928440016 2:31284536-31284558 CTCACATGGTGGAAGGGGCCAGG - Intergenic
928907237 2:36381107-36381129 CTGTGTGGGGGGTAGGGGCGGGG - Intronic
929107784 2:38380914-38380936 CTTCCTTTGGGGGAGGGGCCAGG + Intergenic
929286965 2:40146420-40146442 CTGGCCTAGGGGATGGGGCCTGG - Intronic
929508423 2:42547094-42547116 CTGTCTCTGGGGGAGGGGCCAGG - Intronic
930088978 2:47518234-47518256 CTGGATTGGGGGATGGGGACAGG + Exonic
931486645 2:62700425-62700447 CTATGTTGGGGGAAGGGGATGGG + Intronic
931880318 2:66562242-66562264 CAGTTTTGGGGGAAGAGACCAGG + Intronic
932280978 2:70491629-70491651 CTGTCTCCGGGGAAGGGGCATGG - Intronic
932301790 2:70672621-70672643 CTGAGTTGGGGCAAGGAGCCGGG + Intronic
932428473 2:71658915-71658937 CTGTCTTGGGGGCATGGGGATGG - Exonic
932463996 2:71901785-71901807 CTGAATTGGGGGAAGGGCCCTGG - Intergenic
932716020 2:74101225-74101247 CTGTGAAGTGGGAAGGGGCCAGG - Exonic
933694862 2:85210235-85210257 ATGTGTGTGGGGAAGGGGCCAGG - Intronic
934944122 2:98524449-98524471 CTGGGTTGGGGGAGGAGGCCAGG + Intronic
935341231 2:102061499-102061521 CTGTCCAGAGGGAGGGGGCCGGG + Intergenic
935361802 2:102251540-102251562 CTGTCTTAAGGGAAGGTGCCTGG - Intergenic
936098754 2:109555828-109555850 CTGTTTTAAAGGAAGGGGCCAGG - Intronic
936612308 2:114013122-114013144 CTGTTTTGGGGTGAGGGGTCGGG - Intergenic
936882396 2:117269784-117269806 CTGCCTTTGGGCAAGGGGTCTGG - Intergenic
937103786 2:119291693-119291715 CTGCCTTGTAGGAAGAGGCCTGG + Intergenic
937279258 2:120706042-120706064 CAGGCTTGGAGGAAGGAGCCCGG - Intergenic
940197717 2:151114218-151114240 CTCTTTTGGGGGGAGGGGCTGGG - Intergenic
940395644 2:153187398-153187420 CTGACTTGGGGGAAGGGGAAAGG + Intergenic
940763155 2:157760896-157760918 TTGTTTTGTGGGAAGTGGCCAGG - Exonic
943629523 2:190235086-190235108 CTGTTTTAAAGGAAGGGGCCAGG + Intronic
944125263 2:196285619-196285641 GAATCTTGGGGGAAGGAGCCAGG - Intronic
945469511 2:210211466-210211488 CAGTGTTGGAGGAGGGGGCCTGG + Intronic
945954217 2:216070629-216070651 CTGTTTTAAAGGAAGGGGCCAGG + Intronic
946177080 2:217928584-217928606 CTGGGTTTGGGGAAAGGGCCAGG - Intronic
946293815 2:218766819-218766841 CTGTCATGGGGTGGGGGGCCAGG - Intergenic
946528970 2:220550943-220550965 CTGACTTGGCAGAAGGGGCCAGG + Intergenic
947307619 2:228764853-228764875 CTTTCCTGGGGGATGGGGCTTGG - Intergenic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947546375 2:231013200-231013222 TTGCCTTGGGGGAAGGGGGATGG - Intronic
947769832 2:232662041-232662063 CTGTAATGGGGGAAGTGGCTTGG + Intronic
948382919 2:237563666-237563688 CTGGCTTGGGGGAGGGCACCTGG + Intergenic
948553028 2:238787375-238787397 ATGACTTGCGGGAAGTGGCCTGG - Intergenic
948557160 2:238821009-238821031 CTCTCTTGGGGAGAGGGGACAGG + Intergenic
948790088 2:240372493-240372515 CTGTGGTGGGGGGAGGGGCGTGG + Intergenic
948790175 2:240372772-240372794 CTGTGGTGGGGGGAGGGGCATGG + Intergenic
1169227317 20:3864817-3864839 CTGTCCCGGGGGAAGGGGCCAGG - Intronic
1169388435 20:5170292-5170314 CTTTCTTGTGGGAAGGAGCATGG + Intronic
1169891533 20:10458512-10458534 CTGTTGTGGGGGAAGGGGGAGGG - Intronic
1170192078 20:13654361-13654383 CCCTCTTGAGGGAAGGGGGCTGG - Intergenic
1170370055 20:15638765-15638787 CTGACTGGGGCAAAGGGGCCAGG + Intronic
1170598918 20:17825972-17825994 CTGTCTTGGGGGAGTAGGACTGG + Intergenic
1170882384 20:20308443-20308465 CTGGTGTGGGGGAAGGGGGCTGG + Intronic
1171034188 20:21703224-21703246 CTGGCTGCGGGAAAGGGGCCAGG + Intergenic
1172214154 20:33223136-33223158 CTGTCTTGGAGGAGGGGGATGGG + Intronic
1172270811 20:33654799-33654821 CTGACTTGGGGGCTGGGGCGAGG + Intergenic
1172976185 20:38907765-38907787 CTGTTGTGGGGGACGGGGCCAGG - Intronic
1173869124 20:46330689-46330711 CTGTCATGGGGGATGGGGCTAGG + Intergenic
1174042981 20:47713034-47713056 CTGTCTGGGGGGCAGGGGTGGGG + Intronic
1175250176 20:57604421-57604443 CAGTTTTGGGGGAATGGACCTGG - Exonic
1175315475 20:58043887-58043909 CTGGCATGGGGGTAGGGGGCAGG + Intergenic
1175365130 20:58448333-58448355 CTGTCTGAGGAAAAGGGGCCAGG - Exonic
1175419541 20:58822734-58822756 CTGACTTCAGGGAAGGGGCCAGG - Intergenic
1175938139 20:62524568-62524590 CTGTGTTGGGGGAGGGTCCCAGG + Intergenic
1176075065 20:63244632-63244654 CTGCCTTTGGGGCAGGGGTCAGG + Intronic
1176239265 20:64068406-64068428 GGGCCTTGGGGGAAGAGGCCAGG - Intronic
1176386503 21:6140760-6140782 CTGTCTTGGAGGAGGCGGGCCGG + Intergenic
1176958600 21:15134292-15134314 CTGTTCTGGGGGAGGGGGGCAGG - Intergenic
1177122718 21:17157740-17157762 CTGTCATGGGGTAGGGGGCTGGG + Intergenic
1177384676 21:20393242-20393264 CTGTCGGGGGGTGAGGGGCCAGG - Intergenic
1177994330 21:28077007-28077029 TTATGTTGGGGGAAGAGGCCAGG + Intergenic
1178696622 21:34798202-34798224 GTGTGTTGGGGGAACGGGGCGGG - Intronic
1178914781 21:36700078-36700100 CTGGCTTGGGGCGAGGGGCCAGG + Intronic
1179146535 21:38773342-38773364 TTGGCTTGGAGGAAGGGGCAAGG - Intergenic
1179499658 21:41799929-41799951 CAGTTTCGGGGGCAGGGGCCAGG - Intronic
1179736970 21:43397492-43397514 CTGTCTTGGAGGAGGCGGGCCGG - Intergenic
1179835302 21:44027864-44027886 CTCACGTGGGGGAAGGGGCAAGG - Intronic
1180179414 21:46111382-46111404 CTGCCATGGGGGAGGGTGCCAGG + Intronic
1180831447 22:18908962-18908984 CTGCCTGGGCAGAAGGGGCCTGG - Intronic
1181031041 22:20149031-20149053 CTGTCCAGGAGGAAGGGGCCAGG - Intronic
1181068406 22:20317405-20317427 CTGCCTGGGCAGAAGGGGCCTGG + Intronic
1181173263 22:21022070-21022092 CTGTCAGGAGGGAAGGGGCAGGG + Intronic
1181512285 22:23394371-23394393 CTGTCCAGGAGGAAGGGGCCAGG + Intergenic
1181629439 22:24142870-24142892 CTGACTTGGGGGAAGGAGTGAGG - Intronic
1182425090 22:30267458-30267480 CTGGCTTTGGGGAGTGGGCCTGG - Intergenic
1182576526 22:31276731-31276753 CTGGCCTGGGGGCCGGGGCCGGG - Intronic
1183191718 22:36325849-36325871 CTGTCTTGGGAGGAGGGGCTGGG - Intronic
1183587702 22:38762546-38762568 CTGTCTTGGAGGAGGAGGCGGGG - Intronic
1183748139 22:39704097-39704119 CTGTCCTGGGGGACAGGCCCTGG + Intergenic
1185129316 22:49028630-49028652 CTGTCTGGGGGGCAGGCACCTGG + Intergenic
1185161790 22:49234393-49234415 TTCTCTTGGGGGAAGAGGCCCGG + Intergenic
1185223835 22:49642173-49642195 CTATCTGGGGGGAAGGTGCCAGG - Intronic
1185340422 22:50288454-50288476 CTGTCCTGATGGAAGGGACCTGG - Intronic
1203281531 22_KI270734v1_random:134233-134255 CTGCCTGGGCAGAAGGGGCCTGG - Intergenic
950032707 3:9862913-9862935 CTGGCCTCGGGGACGGGGCCAGG - Intergenic
950091360 3:10297560-10297582 CTGTTGTGGGGGGAGGGGACGGG - Intronic
950560552 3:13719001-13719023 ATGGCTTTGGGGGAGGGGCCGGG - Intergenic
950810737 3:15647760-15647782 CAGACTTGGGGGAAGTGGCTTGG + Intergenic
952106524 3:30076457-30076479 CTGTAATGGGGGAAGGGGGAAGG - Intergenic
952838905 3:37627934-37627956 CTGCCTCTGGGGAAGGGGGCTGG + Intronic
953108527 3:39909562-39909584 CTGTCTTAGAGGAGGGGGCTAGG + Intronic
953133861 3:40166415-40166437 ATGACCTGTGGGAAGGGGCCGGG + Intronic
953227613 3:41034905-41034927 CAGTCTTGGTCCAAGGGGCCTGG - Intergenic
953393190 3:42545670-42545692 CAGTGGTGGGGGAAGGGGCGGGG - Intergenic
955383876 3:58463108-58463130 CTGGCTTGGGGAAAGAGGGCTGG + Intergenic
955396220 3:58559653-58559675 CTGACTTGGGGGCAGAGGGCTGG + Intergenic
955815090 3:62833758-62833780 CTGTTTTGGGGCAAGGGGTGTGG - Intronic
955979031 3:64506094-64506116 CTGTCATGGGGCAAGGGGATGGG + Intergenic
956064968 3:65388417-65388439 CTGTCTTGGGGGGAGGGGGCAGG + Intronic
956302822 3:67790966-67790988 CTGTCTTGGGGAATGGGGATAGG + Intergenic
958605458 3:96352842-96352864 CAGTGTTGGGGGGAGGGACCTGG + Intergenic
959888810 3:111531537-111531559 CTGTCTTGTGGGAAGGGCTGAGG - Intronic
959913652 3:111793160-111793182 CTGTCTTTGAGCAAGGGCCCAGG + Intronic
960483283 3:118219533-118219555 GTGTGTTGGGGGAGGGGGCAGGG + Intergenic
960739595 3:120818545-120818567 CTGTCGCGGGGGCAGGGGCAAGG - Intergenic
960999006 3:123359748-123359770 CTGTCTTTAGGGCTGGGGCCAGG - Intronic
961311092 3:126001907-126001929 CTGTCATGGGGTAGGGGGCAGGG + Intergenic
961328446 3:126125287-126125309 CTGTCTTAGAGCATGGGGCCTGG + Intronic
961475239 3:127141855-127141877 CTGTGTTAGGGGAGGAGGCCTGG - Intergenic
961593102 3:127995584-127995606 CTGCCTCTGAGGAAGGGGCCTGG + Intergenic
961633507 3:128318487-128318509 CTGTCCTGGGTGAAGGGTGCAGG - Intronic
961637881 3:128344471-128344493 CTGCCTTTGGGGAGGGGACCTGG - Intronic
961669926 3:128521490-128521512 CTGCCTTGGTGCAAGGGGCTGGG + Intergenic
962746086 3:138398286-138398308 AGGGCTTGGGGGAAAGGGCCCGG - Intronic
962814039 3:138982732-138982754 CAGTCTTGTGGCAGGGGGCCTGG - Intergenic
963293126 3:143513992-143514014 CTGTCCTGGGGTAGGGGGACGGG - Intronic
963311871 3:143718598-143718620 CTGTTACGTGGGAAGGGGCCAGG - Intronic
963348550 3:144125477-144125499 CTGTCATGGGGTGGGGGGCCTGG - Intergenic
965158258 3:165094260-165094282 CTGTTGTGGGGTAAGGGGCTAGG - Intergenic
965371943 3:167873958-167873980 GTGTCTTGGAGGAAGGGGTTGGG - Intergenic
966592204 3:181695645-181695667 GTGTCTTGAGGGATCGGGCCCGG - Intergenic
967158074 3:186711639-186711661 CTGTCCAGGGGGAAGTGGACAGG - Intergenic
967311238 3:188108293-188108315 CTGTCGTGGGGTAGGGGGCAGGG - Intergenic
967482050 3:189983925-189983947 CTTTCTTGGGGGAAGGGGAGAGG + Intronic
967574155 3:191070751-191070773 ATGTCTAGTGGGTAGGGGCCAGG - Intergenic
967994675 3:195157649-195157671 CTCTCTTGAGGGCAGGGTCCTGG - Intronic
968110890 3:196045616-196045638 CAGTGTTGGAGGAGGGGGCCTGG - Intronic
968682265 4:1929262-1929284 CTGTCTTGGGAGGAGGGGTTTGG + Intronic
969321052 4:6412854-6412876 CTCACATGGGGGAAGGGGCAAGG - Intronic
969442663 4:7226601-7226623 TGGCCTCGGGGGAAGGGGCCGGG - Intronic
969461985 4:7333825-7333847 CTGGGCTGGGGAAAGGGGCCAGG + Intronic
969568121 4:7992205-7992227 CTGTCCTGGGGCACAGGGCCTGG + Intronic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
970332423 4:15001418-15001440 CTCCCTGGGGGGAAGGGGCGGGG + Intergenic
970392633 4:15631064-15631086 CTGTGGTGGGGGTAGGGGACTGG - Intronic
970504561 4:16714383-16714405 CTTTCTTGGGGACAGTGGCCTGG + Intronic
971427971 4:26534412-26534434 CTGCCTTGTGGGAGGGGGCATGG - Intergenic
971964292 4:33531910-33531932 CTGTCGGGGGGTAGGGGGCCAGG - Intergenic
972287559 4:37663279-37663301 CTGTCTCCTGGGAAGGGGCTGGG + Intronic
974162297 4:58155564-58155586 CTGTCATGGGGTAGGGGGCTAGG + Intergenic
974247518 4:59339745-59339767 CTGTGTTGGGGGAATTGCCCTGG + Intergenic
975373459 4:73614441-73614463 CTGACATGGTGGAAGGGTCCAGG - Intronic
977665575 4:99643716-99643738 GTGGCTTGGGGGAAAGGGCAGGG - Intronic
977732461 4:100370328-100370350 ATGTCCTGGGGGAAGGGGGAAGG + Intergenic
978077602 4:104552603-104552625 TTTTCTTGGGGGAAGGGGGCTGG - Intergenic
980153964 4:129081669-129081691 CAGTGTTGGAGGAGGGGGCCTGG - Intronic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
981430612 4:144654670-144654692 CTGTGCTGGGGGCAGGGGCAGGG - Intronic
982059610 4:151591600-151591622 CTGTCAGGGGGCCAGGGGCCAGG - Intronic
983491647 4:168397064-168397086 CTTACTTGGTGGAAGGGGCGAGG - Intronic
983678331 4:170322364-170322386 CTGTCTTGGGGTTGGGGGCTCGG + Intergenic
983722175 4:170869050-170869072 ATGTCTAGCAGGAAGGGGCCAGG - Intergenic
984032734 4:174625126-174625148 CTGTCAGGGGGTAGGGGGCCGGG - Intergenic
984505878 4:180618056-180618078 CTGTCTTGGGGGTTGGGGAAGGG - Intergenic
984993636 4:185406448-185406470 ATTTTTTGGGGGAAGGTGCCCGG + Intronic
985107189 4:186510778-186510800 CTGTCTTGGCAGCAGGGTCCGGG + Intronic
985523388 5:389625-389647 CTGGTCTGGGGGAAGGGCCCGGG - Intronic
985625345 5:982618-982640 CTGTGTTGTGGGGAGGGGCCGGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986082619 5:4410020-4410042 CTGTGGTGGTGGCAGGGGCCGGG + Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986898248 5:12397367-12397389 CTGTCTTGGGGCAGGGGGAGCGG + Intergenic
987097009 5:14559100-14559122 CTGGCTTGGGGGAAGGAGAGGGG + Intergenic
987118929 5:14748382-14748404 CTGCCTTGAGGGGAGCGGCCCGG - Intronic
988580244 5:32462485-32462507 CTGTCTTAGGGGAAACAGCCTGG + Intergenic
988867853 5:35354923-35354945 CTGTCTTAGGGGAAGGGTGGAGG + Intergenic
989749240 5:44871458-44871480 ATGTCTTGAGGTAAGGGGCCAGG + Intergenic
989846911 5:46156446-46156468 CTGTCATGGGGTAAGGGGATGGG - Intergenic
990240128 5:53808756-53808778 CTGTCATGGGGTGAGGGGCTGGG + Intergenic
990941174 5:61204594-61204616 CTGTCGTGGGGTAGGGGGCAGGG + Intergenic
991445254 5:66692777-66692799 CTCACTTGGTGGAAGGGGCAAGG + Intronic
991633396 5:68679603-68679625 GTGACTTGGGGGAAGGGCACTGG - Intergenic
991953712 5:71971732-71971754 CTCACATGGGGGAAGGGGCAGGG + Intergenic
992015061 5:72567134-72567156 ATGTTTTGGGGGAAGTGCCCAGG - Intergenic
992321860 5:75621157-75621179 TTGGCTTGGGGGAGGGGGCAGGG + Intronic
992499488 5:77327860-77327882 CTGTGTGGGGGGAAGGCTCCCGG - Intronic
996630597 5:125626776-125626798 CTGTCATGGGGTAAGGGGAGGGG + Intergenic
997608303 5:135192249-135192271 CTGTCTTGGGGAAGGGGGCCTGG + Intronic
998596051 5:143531620-143531642 CTGTCTTGGGGGCAGGGGGATGG - Intergenic
999510083 5:152240959-152240981 CTGTCATGGGGCAGGGGGCTAGG + Intergenic
999513321 5:152275782-152275804 ATGTCTTTGAGGAAGGGGCAAGG - Intergenic
1000152025 5:158512367-158512389 ATGCCTTGGGGGCAGGGGGCAGG - Intergenic
1001080344 5:168663046-168663068 CTGTCTTGGTTGATGGGGGCTGG + Intronic
1001544118 5:172559342-172559364 CTGTCTTGGGAGACTGGCCCAGG + Intergenic
1001708125 5:173756831-173756853 CTGCAGTGGAGGAAGGGGCCTGG - Intergenic
1001901302 5:175432529-175432551 ATGTCCTGGGGGAAAGGGCAAGG + Intergenic
1003000364 6:2325973-2325995 CAGTGTTGGAGGATGGGGCCTGG + Intergenic
1003992203 6:11497409-11497431 GTGTCTGGTGGGCAGGGGCCAGG - Intergenic
1004107931 6:12683770-12683792 GTGTCTAGGAGGTAGGGGCCAGG - Intergenic
1004400982 6:15288433-15288455 CAGTGTTGGGGGACAGGGCCTGG - Intronic
1004481533 6:16024020-16024042 ATGACTTGGGGGAATGGGCTGGG + Intergenic
1005176215 6:23047500-23047522 CTGTTTTAAAGGAAGGGGCCAGG - Intergenic
1005661278 6:28001643-28001665 CTGGCTTGGTGGAAGGGGGCCGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006515317 6:34542180-34542202 CAGCTTTGGGGGCAGGGGCCGGG + Intronic
1006832567 6:36977606-36977628 CAGTCTCGGGGGAAGGGGGGTGG + Intronic
1007231067 6:40348020-40348042 GTGTGCTGGGGGAAGGGGCAGGG + Intergenic
1007261956 6:40570075-40570097 CTGTCTTGTGGGTAGGGCTCAGG + Intronic
1007360941 6:41355102-41355124 CTGTCATGGGGTCAGGGGACGGG + Intergenic
1007628577 6:43260083-43260105 CAGCTTTGGGGGAGGGGGCCTGG + Intronic
1008928471 6:56912076-56912098 CTGTCTTGGGAGAAAGAGCCTGG - Intronic
1009514606 6:64598870-64598892 CTGTTTTGGAGGCAGTGGCCAGG + Intronic
1010046230 6:71447304-71447326 CTGTCTGGGGAGAAGGGGCAGGG + Intergenic
1010980517 6:82364743-82364765 CTTTCTGGAGGGAAGGGGCGGGG + Exonic
1011726120 6:90212298-90212320 ATGCATTGGGGGAAGGGGGCAGG - Intronic
1012104674 6:95141097-95141119 CTGTTTTAAAGGAAGGGGCCAGG - Intergenic
1012903953 6:105042210-105042232 CTGAATTGGGGGAAGGGGGTAGG + Intronic
1013273673 6:108562887-108562909 CTGTCTTGGGGGAAGGGGCCAGG - Intronic
1013368073 6:109449599-109449621 CTGACCTGGGGGAAGGGGGTTGG + Intronic
1013576227 6:111485237-111485259 ATATTTTGGGGGATGGGGCCTGG + Intergenic
1014014804 6:116517993-116518015 CAGGTTTGGGGGAAGGGGCACGG - Exonic
1014422862 6:121266905-121266927 CTGTCGGTGGGGAAGGGGCAAGG + Intronic
1014499368 6:122165844-122165866 CCTTCTGGTGGGAAGGGGCCAGG - Intergenic
1015050632 6:128835456-128835478 CTGTCTTGGGGTAGGGGGAGGGG + Intergenic
1015072304 6:129109211-129109233 CTGTGTTGGGGGCAGAGGCTGGG + Intronic
1015196251 6:130527394-130527416 CAGGCTTGGGAGAAGGGGCCAGG - Intergenic
1015198201 6:130547818-130547840 CTGCCTTGGGGGAAAAGGCAAGG + Intergenic
1016039000 6:139412481-139412503 CTGTCCTGGGGTGAGGGGCAGGG + Intergenic
1016634961 6:146277602-146277624 CTGCCTTGGGGGAAGACACCTGG + Intronic
1017641380 6:156497594-156497616 CTTTCTTGGGGGAAGTAGTCTGG - Intergenic
1018014373 6:159698926-159698948 CTGTCTGGGGGGTGGGGGGCGGG + Intronic
1018534238 6:164802801-164802823 TTGTGATGGGGGAAGGGGCAGGG + Intergenic
1018623188 6:165751337-165751359 CTCTCCTGGAGGCAGGGGCCAGG - Intronic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1018798257 6:167203625-167203647 CAGTCTCGGGGGAAGGAGCGTGG + Intergenic
1018814454 6:167320551-167320573 CGGTCTCGGGGGAAGGAGCGTGG - Intergenic
1018965078 6:168478782-168478804 CTGTCCTGGGGAAAGGAGTCAGG + Intronic
1018965091 6:168478857-168478879 CTGTCTCGGGGAAAGGAGTCAGG + Intronic
1019366727 7:636914-636936 CGGCCGTGAGGGAAGGGGCCAGG + Intronic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1020210575 7:6154939-6154961 CTGTCGTGGGAGAAGCGGTCGGG - Exonic
1020220628 7:6233931-6233953 CTCACTTGGTGGAAGGGGCAAGG + Intronic
1021505788 7:21383592-21383614 CTGTCTTTGGGGAAATGACCAGG + Intergenic
1021708978 7:23396247-23396269 CTGGCTTGGGGGTAGGGGGCAGG + Intronic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022518714 7:30992128-30992150 GTGTGTTGGGGGGCGGGGCCGGG - Intronic
1024895700 7:54259371-54259393 CTGAATGGGGTGAAGGGGCCAGG + Intergenic
1025716289 7:63959996-63960018 CTGTCACGGGGGGAGGGGCTGGG - Intergenic
1025916987 7:65873570-65873592 CCGGCTTGGGGGAGTGGGCCAGG + Intronic
1026505741 7:70981057-70981079 CTGTCTTGGGGGCAGGAGCAGGG - Intergenic
1027744598 7:82057441-82057463 ATGTGTTGGGGGAAAGGGGCAGG + Intronic
1028405636 7:90470821-90470843 GTTTGTTGGGAGAAGGGGCCAGG - Intronic
1028593088 7:92519234-92519256 CTGTTTTGAGAGATGGGGCCTGG + Intronic
1029110479 7:98211169-98211191 CTGTCTTGGGGGACGAGGGTGGG + Intergenic
1029438299 7:100574352-100574374 GACTCCTGGGGGAAGGGGCCGGG + Intronic
1030036875 7:105415497-105415519 CTTTTTTGGGGGAGGGGGCTGGG + Intergenic
1030714499 7:112791807-112791829 CGGTGGTGGGGGAGGGGGCCGGG - Intergenic
1031174332 7:118330411-118330433 CTGTCTCTGGTGAAGGGGCAGGG + Intergenic
1031690522 7:124782466-124782488 CTGCCTTGGGGGAAGGGAAGGGG - Intronic
1032504344 7:132424387-132424409 CTGTCTTGTGGGCCTGGGCCAGG - Intronic
1033655385 7:143370131-143370153 CTGTGTTGGGGGCAGGGCCAAGG + Intergenic
1033707171 7:143901522-143901544 TTGTGGTGGGGGAAGGGACCTGG - Intronic
1034276086 7:149824458-149824480 CAGTCCTGGAGGCAGGGGCCAGG - Intergenic
1034482404 7:151332611-151332633 CAGTCTTGGGGGAAGGCAACAGG + Intergenic
1034493684 7:151407943-151407965 CTGTCTTGGGGGTAGAGGGGTGG - Intronic
1035231731 7:157469630-157469652 CTGTCCTGGGGGAAGGGCAAGGG + Intergenic
1035601320 8:898543-898565 CTGTGTGCAGGGAAGGGGCCTGG + Intergenic
1035686081 8:1524326-1524348 CTGACTGGGAGGAAGGAGCCTGG + Intronic
1035848877 8:2894148-2894170 CTGTCTCGGGGGTGGGGCCCTGG - Intergenic
1036146244 8:6257644-6257666 CAATGTTGGGGGAGGGGGCCTGG - Intergenic
1036206262 8:6807569-6807591 CTGTCTTGGGGAGAAGGGACTGG - Intergenic
1036824708 8:11967089-11967111 CTGTCCTGGGAACAGGGGCCTGG - Intergenic
1037458306 8:19084580-19084602 GTGTCTTGGAGGCAGGGGCCTGG + Intronic
1038039997 8:23716453-23716475 CTGTCATGGGGTGAGGGGCAAGG - Intergenic
1038116840 8:24566014-24566036 CTGTCATGGGGTAGGGGGCAGGG - Intergenic
1038126580 8:24679976-24679998 CTTTGTTGCCGGAAGGGGCCCGG - Intergenic
1038213928 8:25544324-25544346 CAGTCTTGGGAGGTGGGGCCTGG - Intergenic
1038537028 8:28360824-28360846 CAGTCTTGGGGTAGGGGGCTGGG - Intronic
1039828725 8:41195807-41195829 CTGTCTTGGGGGGCGGCACCTGG + Intergenic
1039901151 8:41753421-41753443 CTGACTGAGGGGAAGGGGTCTGG - Intronic
1040657279 8:49525959-49525981 CTGTCGTGGGGTAGGGGGCTAGG + Intergenic
1040679902 8:49796174-49796196 CTCCCTTGGGGGCAGGGGCCAGG - Intergenic
1041213569 8:55577431-55577453 CTGTTTGGGGGGTGGGGGCCTGG + Intergenic
1041669044 8:60474923-60474945 CTGTCTTGAGGCAAGAAGCCTGG - Intergenic
1041823245 8:62063287-62063309 CTGCCTTGAAGGAAAGGGCCCGG + Intergenic
1042895084 8:73658071-73658093 CTATCTTGGGGGACTGGGCACGG + Intronic
1043208295 8:77475800-77475822 GCGTGTTGGGGGATGGGGCCTGG - Intergenic
1044032277 8:87253208-87253230 CAGTCTTGGGGTAAAGGGCAAGG - Intronic
1045070612 8:98500509-98500531 CTGTCATGGGGTAGGGGGCAGGG - Intronic
1045516226 8:102863420-102863442 CTGTTTCCGGGGAGGGGGCCCGG - Intronic
1046969040 8:120200545-120200567 CTATCCAGGGAGAAGGGGCCTGG + Intronic
1047187766 8:122649600-122649622 CTGCCTTGAGGTAAGGGGGCTGG - Intergenic
1047213095 8:122855457-122855479 CTTTCTTGGAGCAAGGGGGCAGG + Intronic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048559811 8:135522096-135522118 CTGTCATGGGGGCAGGGGGAGGG - Intronic
1048685065 8:136895619-136895641 CTTTCTTGAGTGAAGAGGCCTGG - Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049212448 8:141392898-141392920 CTGTCTTGGCTGAGGGTGCCCGG - Intronic
1049478011 8:142805846-142805868 CTGTCTTGGGAAAAGGGGGATGG + Intergenic
1049779790 8:144423633-144423655 CTTTATTGTGGGGAGGGGCCCGG + Exonic
1051491566 9:17672634-17672656 CTGTATTGGGTGAAGGGGGTGGG - Intronic
1051939630 9:22490269-22490291 CTGTCTTGGGTGAAGGGCCTAGG - Intergenic
1052349312 9:27442489-27442511 CTGTCTTTGGCAAAGGAGCCTGG - Intronic
1052492653 9:29188838-29188860 CTGTCTGGGAGGAAGGTGGCGGG - Intergenic
1052800597 9:32963800-32963822 CTGTCGTGGGGTAGGGGGCTGGG + Intergenic
1053719778 9:40933764-40933786 GTGGGTTGGGGGAAGGGGACAGG + Intergenic
1054731473 9:68705781-68705803 GGGTCTAGTGGGAAGGGGCCGGG - Intronic
1054816012 9:69476197-69476219 TTGGCTGGGGGAAAGGGGCCGGG + Intronic
1054969897 9:71073012-71073034 CTGTTTTAAAGGAAGGGGCCGGG - Intronic
1055259186 9:74412547-74412569 CTGTGTTGAGGGAGGGGGCAGGG + Intergenic
1055337578 9:75248109-75248131 CAGTGTTGGAGGGAGGGGCCTGG + Intergenic
1057373394 9:94495195-94495217 CTGTGTTGGAGGAAAGGGCTTGG + Intergenic
1057414025 9:94845504-94845526 CCGTTTTGGGGGAACGGGACAGG + Intronic
1058085366 9:100742626-100742648 CTGTCGTGGGGTGAGGGGGCTGG - Intergenic
1058554647 9:106153865-106153887 CTGTCTTGGGGTGAGGGGAAGGG + Intergenic
1058615672 9:106824703-106824725 CTGTCGTGGGGTCAGGGGCAGGG + Intergenic
1058775873 9:108283201-108283223 TTGTCTTGGGGGAAAGGGAGTGG - Intergenic
1059098547 9:111445824-111445846 CTGTTGTGGGGGGTGGGGCCTGG - Intronic
1059708155 9:116842859-116842881 CTCTCCTGGGGGATGGGGGCAGG - Intronic
1060134586 9:121140358-121140380 CTGCCTTGGGGCAATGGGCATGG + Intronic
1060664318 9:125423834-125423856 GTTTCCTGCGGGAAGGGGCCTGG - Intergenic
1060858222 9:126933040-126933062 CTGGCGAGGGGGCAGGGGCCTGG + Intronic
1061487128 9:130925616-130925638 CTGTGTTGGAGGGAGGGGCGGGG - Intronic
1061519769 9:131111296-131111318 GTGTCTTGGGGGAGGGGCACGGG + Intronic
1061592751 9:131608575-131608597 CTCTCTTGGACAAAGGGGCCTGG + Intronic
1061678300 9:132230521-132230543 CTGCCCCAGGGGAAGGGGCCTGG - Intronic
1062122493 9:134841279-134841301 TTGTCTTGGGGGAAGTTGACGGG + Intronic
1062148878 9:135007309-135007331 CTCTCCTGGGGTCAGGGGCCAGG - Intergenic
1062261008 9:135663432-135663454 GGGTCTGTGGGGAAGGGGCCAGG + Intronic
1062263001 9:135672135-135672157 CTCTGAAGGGGGAAGGGGCCAGG - Intergenic
1062479353 9:136744286-136744308 CTCTCTTGGGGGAAGGGGGTGGG - Intronic
1062696595 9:137878901-137878923 CTCTCCTGGCGGAAGCGGCCTGG - Intronic
1203455228 Un_GL000219v1:160822-160844 GTGGGTTGGGGGAAGGGGGCAGG - Intergenic
1203655958 Un_KI270752v1:25050-25072 GTGTGTTGGGGGGAGGGGTCGGG - Intergenic
1185637646 X:1564843-1564865 CTCACATGGTGGAAGGGGCCAGG - Intergenic
1185656339 X:1688691-1688713 CTGTCTCGGGGGGAGGGGAGGGG + Intergenic
1186066800 X:5775275-5775297 CTCACATGGTGGAAGGGGCCAGG + Intergenic
1186172850 X:6895896-6895918 CTCACGTGGGGGAAGGGGCGAGG + Intergenic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1186634354 X:11386455-11386477 CTGTCTTGTGGGAAGGGGAGAGG + Intronic
1186822664 X:13306619-13306641 GTGTCTTGTGGGTAGAGGCCAGG + Intergenic
1186968604 X:14815164-14815186 CTGTCTTGGGGTGGGGGGCAGGG + Intergenic
1188579380 X:31690962-31690984 CTGTCGTGGGGTGAGGGGACGGG + Intronic
1189074158 X:37898165-37898187 CTCACGTGGGGGAAGGGGCAAGG + Intronic
1189320233 X:40083301-40083323 CTCTCTCGGGGGAGGGGGTCGGG - Intronic
1189357640 X:40323551-40323573 TTGTCTTAGAAGAAGGGGCCAGG - Intergenic
1189691621 X:43623341-43623363 TTTTCTTGGGGGCAGGGGCGGGG - Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1190263934 X:48816389-48816411 CTGTCTTAGGGGTGGGGACCAGG + Intronic
1190300737 X:49055536-49055558 TTGTCTTGGGGGAGAAGGCCAGG + Intronic
1192294299 X:69831211-69831233 CTGTTGTGGGGTAAGGGGCTGGG - Intronic
1192428384 X:71096623-71096645 CTCTGGTCGGGGAAGGGGCCAGG - Exonic
1192929765 X:75793594-75793616 CTGTCATGGGGGGAGGGGGGAGG - Intergenic
1193460766 X:81788780-81788802 CTGTCAGGGGGTGAGGGGCCAGG - Intergenic
1194952987 X:100149015-100149037 CTGTCAGGGGGTAAGGGGCAAGG + Intergenic
1195792824 X:108607486-108607508 CTGTCTTGGGGTATGGGGGGAGG - Intronic
1197160438 X:123317198-123317220 CTGTGTTGTGGGAGGGGCCCAGG - Intronic
1197771790 X:130093934-130093956 CTGTCATGAGAGCAGGGGCCGGG + Intronic
1198173936 X:134135963-134135985 CAGTGTTGGGGGAGGGGGCCTGG + Intergenic
1198593994 X:138216402-138216424 CTGTCTTGGGGTGGGGGGCTAGG - Intergenic
1199086669 X:143635861-143635883 CTGTCTGCGCGTAAGGGGCCAGG + Intergenic
1200687319 Y:6268058-6268080 GGGTTTTGTGGGAAGGGGCCTGG - Intergenic
1201015733 Y:9599602-9599624 CTGCCTTGTGAGAAGGTGCCTGG + Intergenic
1201047954 Y:9906652-9906674 GGGTTTTGTGGGAAGGGGCCTGG + Intergenic