ID: 1013274314

View in Genome Browser
Species Human (GRCh38)
Location 6:108569713-108569735
Sequence CTGCAGTCCTAGGGCACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013274314_1013274323 26 Left 1013274314 6:108569713-108569735 CCAGATGTGCCCTAGGACTGCAG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1013274323 6:108569762-108569784 AGCATGTGGCACATGTGTAGGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1013274314_1013274322 25 Left 1013274314 6:108569713-108569735 CCAGATGTGCCCTAGGACTGCAG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1013274322 6:108569761-108569783 AAGCATGTGGCACATGTGTAGGG 0: 1
1: 0
2: 1
3: 16
4: 178
1013274314_1013274319 1 Left 1013274314 6:108569713-108569735 CCAGATGTGCCCTAGGACTGCAG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1013274319 6:108569737-108569759 GGAGAGGTGAGCACAGAGTAAGG No data
1013274314_1013274324 27 Left 1013274314 6:108569713-108569735 CCAGATGTGCCCTAGGACTGCAG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1013274324 6:108569763-108569785 GCATGTGGCACATGTGTAGGGGG 0: 1
1: 0
2: 1
3: 8
4: 135
1013274314_1013274321 24 Left 1013274314 6:108569713-108569735 CCAGATGTGCCCTAGGACTGCAG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1013274321 6:108569760-108569782 AAAGCATGTGGCACATGTGTAGG 0: 1
1: 0
2: 1
3: 13
4: 195
1013274314_1013274320 12 Left 1013274314 6:108569713-108569735 CCAGATGTGCCCTAGGACTGCAG 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1013274320 6:108569748-108569770 CACAGAGTAAGGAAAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013274314 Original CRISPR CTGCAGTCCTAGGGCACATC TGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
902636101 1:17735992-17736014 TAGCAATCCTAGGGCACATTAGG - Intergenic
903018390 1:20376752-20376774 CTGCAGTCTTCGGACACATGAGG + Intergenic
905006333 1:34713092-34713114 CTGCAGGACTAGGGAACAGCTGG + Intronic
905852178 1:41282606-41282628 CTCCAGTCCAAGTGAACATCTGG - Intergenic
905864773 1:41370798-41370820 CTGCAGACCAGGGGAACATCAGG - Intronic
912547682 1:110462778-110462800 CTCAAGCCCTGGGGCACATCAGG + Intergenic
919183452 1:194114931-194114953 CTGCAGTCTGAGGACACAGCAGG + Intergenic
919303933 1:195805957-195805979 CTCCAGACCTAGGGTCCATCAGG + Intergenic
920227941 1:204451389-204451411 CTTCAGTCCTTGGGTATATCTGG + Intronic
922353339 1:224753641-224753663 CTGCAGTCCTGGCCAACATCTGG - Intergenic
923042275 1:230327743-230327765 CGGCAGTCCTTGGGCACTGCAGG - Intronic
924817750 1:247457528-247457550 CTGGAGACCAAGGGCACATGAGG - Intergenic
1066196229 10:33102836-33102858 CTGCAGTCCTCAGGCAAATCTGG + Intergenic
1066443318 10:35459323-35459345 CTGCACTCCTGGGCCACATGCGG - Intronic
1067058401 10:43065360-43065382 CTGCAGGCCTAGAGCTCACCAGG + Intergenic
1073015403 10:100395039-100395061 CTACAATCCTAGGGCACTTGGGG - Intergenic
1076252331 10:128994506-128994528 CTCCAGTCCTGGGGCCCAGCAGG + Intergenic
1076526716 10:131116754-131116776 CTGCACTCCTACGGCAGACCCGG - Intronic
1080559192 11:33446613-33446635 CTGCAGTCCTAGCCAACATTTGG - Intergenic
1081977846 11:47247105-47247127 CTATATTCCTAGGGCACATCAGG - Intronic
1083950220 11:65950514-65950536 CTGCAGTCCTAGAGCTCAGGAGG - Intronic
1090259965 11:125312475-125312497 CTGCTCTCCTGGGGCACAGCAGG - Intronic
1091636844 12:2203573-2203595 CTGCAGTCCTATGGCCAAGCCGG + Intronic
1091986998 12:4918405-4918427 CTGCTGTCCAAGGACATATCCGG + Intronic
1092288472 12:7143766-7143788 TGGCAGTCCTAGGCCAAATCTGG + Intronic
1092836930 12:12499245-12499267 ATGCATTCCTAGGGCAAAGCTGG - Intronic
1094469486 12:30790398-30790420 CTGCAGTTCTAGGACTCAACTGG - Intergenic
1095188748 12:39231769-39231791 CTGCAGTCCTGGCCAACATCTGG + Intergenic
1097093066 12:56522784-56522806 GTGCTGTCCTTGGGCACATGGGG + Intronic
1097773012 12:63611156-63611178 GTGCAGCCAAAGGGCACATCAGG + Intronic
1100608324 12:96170002-96170024 CTCCAGCCCTTGGCCACATCTGG - Intergenic
1101604409 12:106237140-106237162 CTTCAGCCCTAGTGCACACCTGG - Intergenic
1102118205 12:110419641-110419663 CTGTATTCCTAGGGGACATTGGG + Intergenic
1102464643 12:113121397-113121419 CCTCAGTCCTGGGGCACTTCTGG - Intronic
1106135237 13:26968623-26968645 CTGCAGTCCTTGGGGACTCCTGG - Intergenic
1106595149 13:31129308-31129330 CTGCAGTCGTAGTGGACAGCCGG - Intergenic
1108609406 13:52069501-52069523 CTGAAGGCCTGGGGCATATCAGG - Intronic
1109605471 13:64688572-64688594 GTTCAGTCCTAGGTCACATATGG - Intergenic
1110029292 13:70586041-70586063 CTGCAGTCATAGCCTACATCTGG - Intergenic
1112670093 13:101625496-101625518 CTGCACTGCAAGGGCTCATCAGG + Intronic
1113121162 13:106924942-106924964 CTGCAGTCCTTGGCCACCCCAGG - Intergenic
1118137635 14:63046124-63046146 CTGAAGTCCGAGCGCACAGCCGG + Intronic
1121734869 14:96211232-96211254 CTGCACTCTTAGAGCACAGCAGG - Intronic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126730865 15:51681292-51681314 CTGCAGTCCTAGGGTGCTCCTGG - Intergenic
1126907373 15:53382440-53382462 CTGCAGCCTTATTGCACATCTGG + Intergenic
1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG + Intronic
1129652127 15:77498503-77498525 CTGCAGTCCCCAGGCACCTCTGG + Intergenic
1133052411 16:3124618-3124640 CTGCAGTCCTAGAGAGCATACGG + Intergenic
1133981996 16:10639894-10639916 CTCCAGTCCCAAGGCAGATCTGG - Intronic
1135043613 16:19136515-19136537 CTGCAGTCAGAGTTCACATCTGG - Intronic
1137607643 16:49797113-49797135 CTGCAGGCCAAGGCCACAACAGG + Intronic
1139123036 16:64043390-64043412 CTGCAGTACAAGAGAACATCAGG + Intergenic
1140455906 16:75105400-75105422 CTGGAGTCCCAAGGCATATCTGG - Intronic
1142102650 16:88283831-88283853 CTGCAGACCTTGGGCACACTGGG - Intergenic
1143198062 17:5091786-5091808 CTGCAGTCCCAGCCCAAATCTGG + Exonic
1144731285 17:17527931-17527953 CTGCAGTGGTAGGTCCCATCTGG + Intronic
1145102094 17:20085984-20086006 CTTCACTCCTTGGGGACATCAGG - Intronic
1151153976 17:72111517-72111539 CTGCAGTCCCTGGGGCCATCTGG + Intergenic
1152184269 17:78844329-78844351 CTGCCAGCCTAGGGCACATCTGG - Intergenic
1155184743 18:23377223-23377245 CTGCAGTCCTGGGCCATAGCAGG - Intronic
1156572679 18:38276751-38276773 CAGCAGTCCTAAGGGACATTTGG + Intergenic
1158409939 18:57196843-57196865 CTTCAGCCCTAGTGCACACCAGG - Intergenic
1162096155 19:8311127-8311149 AGGCAGACCTAGGGCAGATCAGG - Intronic
1162205766 19:9054930-9054952 CTGCAGGCCTGGGGCGCCTCAGG - Intergenic
1162575358 19:11495921-11495943 CTGCAGGGCGAGGGCACATAGGG - Intronic
1163145806 19:15378964-15378986 CACCAGCCCCAGGGCACATCAGG + Intronic
1163404272 19:17112730-17112752 CCGCAGCCCCAGGGCTCATCAGG + Intronic
1164513248 19:28914196-28914218 CTACAGGCCCAGGGCACACCAGG + Intergenic
1165132055 19:33639053-33639075 CTCCAGTCCTAGCACACAGCAGG + Intronic
1166229274 19:41416305-41416327 CTGCAGAGCGAGGGCACACCGGG + Intronic
1167432928 19:49463790-49463812 CTGCAGTCCTCGGTCTCAGCAGG + Intronic
926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG + Intergenic
927866530 2:26591491-26591513 CTGGGGCCCTAGGGCACAGCTGG - Intronic
929901287 2:46005837-46005859 CTGCAGCCCCAGAGTACATCAGG - Intronic
935806054 2:106748672-106748694 CTAGTGTCCTGGGGCACATCGGG - Intergenic
937298190 2:120822383-120822405 CTGGAGCCTTAGGGCCCATCGGG - Intronic
941063176 2:160871232-160871254 CAGCTGTCCTAGGGAACATCTGG - Intergenic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
942195113 2:173509394-173509416 CTGGAGTTCTAGAGCCCATCTGG - Intergenic
945883546 2:215351228-215351250 CTTCAGTCCCAGGCAACATCTGG + Intergenic
948693931 2:239723259-239723281 CTGCAGTTCTAGGACAGAGCAGG - Intergenic
948982074 2:241499502-241499524 CTGGCCTCCTAGGGCACAGCAGG + Intronic
1170530716 20:17288242-17288264 CTGCTACCCTAGGGCACATGAGG + Intronic
1171409037 20:24933834-24933856 CTGCAAGCCTAGGGCACCGCTGG - Intergenic
1173255484 20:41391900-41391922 CTGCAGCCCTTGGGCAGATGTGG + Intergenic
1178822321 21:35986712-35986734 CTGCCTGCCTAGGGGACATCAGG + Intronic
1181031349 22:20150074-20150096 CCGCAGTCTTAGGGCTGATCTGG - Intronic
1182702192 22:32249491-32249513 CTCCAGCCATAGGGCATATCTGG + Intronic
1183178253 22:36239865-36239887 CTGCAGTTTAAGGGCACAGCAGG + Exonic
1185391719 22:50565150-50565172 CTGCAGACCTATGGGACATGGGG + Intergenic
949202463 3:1395350-1395372 GTGCAGCCCTTGAGCACATCTGG - Intronic
952157049 3:30654688-30654710 CTTCAGTCCTGGTGCCCATCAGG - Intronic
952990058 3:38823957-38823979 CTGCAGCCCCAGGGCCCAGCAGG - Intergenic
954551824 3:51488313-51488335 CTGCAGTCATAAAGGACATCAGG - Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
968055667 3:195689888-195689910 CTGCAGCCCAACTGCACATCAGG + Intergenic
968100121 3:195958710-195958732 CTGCAGCCCAACTGCACATCAGG - Intergenic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
982932604 4:161428301-161428323 CTGCAATTCTTGGGCACATCTGG + Intronic
985202270 4:187495667-187495689 CTTCAGTTCTAGGGCTCTTCTGG - Intergenic
985244438 4:187965612-187965634 ATGCAGTACTCTGGCACATCAGG + Intergenic
985503582 5:264664-264686 CTGCAGCCCAACTGCACATCAGG + Intergenic
986815617 5:11406275-11406297 TGACAGTCCTTGGGCACATCTGG + Intronic
992884625 5:81145738-81145760 CTGCAGCCCTAGTGGACACCTGG + Intronic
1000790130 5:165595961-165595983 CTACAATCCCAGGGAACATCTGG + Intergenic
1002435269 5:179227609-179227631 CTGCAGTCCTAGAGGGCATCTGG - Intronic
1003017809 6:2482065-2482087 CTGCACCCCTTGAGCACATCGGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1005949812 6:30623566-30623588 CTACAGTCACAGGGCAAATCTGG + Intronic
1007939044 6:45759543-45759565 TAGCAGTCCTTGGGGACATCAGG - Intergenic
1013270977 6:108545164-108545186 CTGCACTCCCACGCCACATCAGG + Intergenic
1013274314 6:108569713-108569735 CTGCAGTCCTAGGGCACATCTGG - Intronic
1016937658 6:149459541-149459563 CTGCAGTCTTGGAGCACTTCTGG + Intronic
1020100820 7:5393531-5393553 CTGCAGGCTTAGGGCTCTTCCGG - Intronic
1022932580 7:35134864-35134886 GTGCAGCCAAAGGGCACATCAGG + Intergenic
1024006374 7:45227472-45227494 CTGCATTCCAAGGGCAGTTCAGG + Intergenic
1025640542 7:63363523-63363545 CTGCAGTCATATGGCACAAGTGG - Intergenic
1025642157 7:63384570-63384592 CTGCAGTCATATGGCACAAGTGG + Intergenic
1026373061 7:69721201-69721223 CTGCAGTACTTGAGCAGATCAGG - Intronic
1026509790 7:71018444-71018466 CTGCAGTCCTATGGCAATACAGG + Intergenic
1029828505 7:103227642-103227664 GTGCAGCCAAAGGGCACATCGGG + Intergenic
1035480612 7:159179642-159179664 CAGCAGTCATAGGTCACATGCGG - Intergenic
1037776353 8:21838421-21838443 CTGCAGGCCTTGGACACATGGGG + Intergenic
1037823326 8:22146397-22146419 TTGGAGTCCTAGGTGACATCTGG - Intergenic
1038220724 8:25604619-25604641 CTGCATACCTGGGGCCCATCAGG + Intergenic
1047765433 8:127986365-127986387 CTGCGGTCCCAGGAGACATCAGG + Intergenic
1048224083 8:132567980-132568002 CTGCAGTTCTAGCCAACATCTGG - Intergenic
1049322119 8:142002098-142002120 CTGCAGCCCTGGGTCACATGTGG + Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1059437597 9:114285894-114285916 CTGCAGCCTTAGGGCAGATTTGG - Intronic
1186189105 X:7051941-7051963 CTGGAGTTCTAGGCCACATGTGG - Intronic
1187813897 X:23210049-23210071 CTGCAGTCAAAGGCAACATCAGG + Intergenic
1192363995 X:70455772-70455794 CTGCAGCCCTAGGGGACAAAGGG - Intronic
1197761972 X:130034419-130034441 ATGCAGTCCTAGGTCAGGTCAGG - Intronic
1199722554 X:150552362-150552384 AGGCAGTTCTAGGGCACTTCTGG + Intergenic