ID: 1013275250

View in Genome Browser
Species Human (GRCh38)
Location 6:108578898-108578920
Sequence CTTGCACCACAGGTGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013275246_1013275250 -4 Left 1013275246 6:108578879-108578901 CCTAAAAGGCGCACGACCTCTTG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1013275250 6:108578898-108578920 CTTGCACCACAGGTGGAACCAGG No data
1013275244_1013275250 10 Left 1013275244 6:108578865-108578887 CCTCGGCTCAGGATCCTAAAAGG 0: 1
1: 0
2: 2
3: 9
4: 98
Right 1013275250 6:108578898-108578920 CTTGCACCACAGGTGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013275250 Original CRISPR CTTGCACCACAGGTGGAACC AGG Intronic
No off target data available for this crispr