ID: 1013275269

View in Genome Browser
Species Human (GRCh38)
Location 6:108579062-108579084
Sequence AGTTCTGGATGTTCATGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 479}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013275262_1013275269 29 Left 1013275262 6:108579010-108579032 CCTAGCTGGTGGCTTTAGGAATG 0: 1
1: 0
2: 1
3: 23
4: 178
Right 1013275269 6:108579062-108579084 AGTTCTGGATGTTCATGTGAGGG 0: 1
1: 0
2: 2
3: 26
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013275269 Original CRISPR AGTTCTGGATGTTCATGTGA GGG Intronic
900896356 1:5485650-5485672 AGTTCTGGCTGGACAGGTGAGGG - Intergenic
900948530 1:5844708-5844730 ATGTCTGGATGTTGCTGTGAAGG - Intergenic
903118973 1:21201605-21201627 TATTCTGGATGTTTCTGTGAAGG - Intergenic
904936397 1:34132546-34132568 ATTTCTGGATGTGTTTGTGAAGG + Intronic
906780211 1:48566588-48566610 TATTCTGGATGTTTCTGTGAGGG + Intronic
907639908 1:56177919-56177941 AGCTCTGGATATTCTTGTGTAGG + Intergenic
907919666 1:58900684-58900706 AGTTCTGGGTGGGCATGTGATGG + Intergenic
908120456 1:60981406-60981428 ACTTCTGGATGACCATGAGATGG + Intronic
908329925 1:63061456-63061478 ATTTCTGGGTGTGCCTGTGAGGG - Intergenic
908482858 1:64559621-64559643 AGGTTTGGGTGTACATGTGAAGG - Intronic
908907004 1:69026776-69026798 TATTCTGGATGTTTCTGTGAAGG - Intergenic
909671765 1:78197375-78197397 TATTCTGGATGTTTTTGTGAAGG + Intergenic
909824143 1:80104973-80104995 GTTTCTGCATGTTCAAGTGAAGG - Intergenic
909876608 1:80812989-80813011 TATTCTGGATGTTTCTGTGAGGG + Intergenic
910271850 1:85404393-85404415 AGTTCTGGATGGCAATTTGATGG - Intronic
911031816 1:93496857-93496879 TATTCTGGATGTTTCTGTGAAGG - Intronic
911192105 1:94958467-94958489 TATTCTGGATGTTTTTGTGATGG - Intergenic
911375621 1:97047169-97047191 AGTTATGGATGTTCATAGAAGGG + Intergenic
911543944 1:99192840-99192862 AGGTTTGGAGGTACATGTGAAGG - Intergenic
912600338 1:110925115-110925137 CATTCTTGATGTTTATGTGAAGG + Intergenic
914414143 1:147462773-147462795 AGGTTTGGGGGTTCATGTGAAGG + Intergenic
915099967 1:153491976-153491998 AGTTCTGGCTGGTGATATGAAGG + Intergenic
916274235 1:162976681-162976703 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
916651069 1:166835262-166835284 ATTTATGGGTGTTCCTGTGAGGG + Intergenic
917338228 1:173947442-173947464 AGTTTTGGAAGTTCGTGAGATGG + Exonic
917850449 1:179059029-179059051 ACTCCTGGATGTGCCTGTGAAGG - Intronic
917902738 1:179559288-179559310 ACATCTGGATGTTACTGTGAAGG - Intronic
918328831 1:183436427-183436449 AGGTTTGGAGGTACATGTGAAGG - Intergenic
919599969 1:199610580-199610602 AGTTCTTGCTGTTCCTCTGAAGG + Intergenic
919829257 1:201528711-201528733 TATTCTGGATGTTTCTGTGAGGG + Intergenic
920868259 1:209771191-209771213 AGGTGTGCGTGTTCATGTGAAGG + Intronic
921258332 1:213362711-213362733 TATTCTGGATGTTTCTGTGAGGG + Intergenic
922003253 1:221502482-221502504 ACTTCTGGATGTATCTGTGAAGG - Intergenic
922342788 1:224670887-224670909 TATTCTGGATGTTTCTGTGAGGG + Intronic
922345703 1:224694543-224694565 TGTTCTGGTTGTTTCTGTGAGGG + Intronic
923885952 1:238155834-238155856 AATTCTGGGTGTTTCTGTGAAGG - Intergenic
923903195 1:238352496-238352518 GGTTCAGGGTGTACATGTGAAGG + Intergenic
923973251 1:239229145-239229167 TATTCTGGATGTTTCTGTGAGGG + Intergenic
924718361 1:246599920-246599942 AGTTTTGTATGCTCAAGTGAGGG + Intronic
1063191813 10:3702241-3702263 ACTTCTGGATGCTGATGTGAGGG - Intergenic
1063903663 10:10761495-10761517 TATTCTGGGTGTTCCTGTGAGGG + Intergenic
1066501189 10:35996413-35996435 ATTTCTGGGTGTTTCTGTGAGGG - Intergenic
1066726093 10:38396393-38396415 AGTCCTGGGTCTTCATGAGAAGG - Intergenic
1067099956 10:43327420-43327442 ACTTCTGGATGTGTCTGTGAGGG + Intergenic
1067413301 10:46084247-46084269 AGTTGTAGATGTTTATGGGATGG + Intergenic
1068403916 10:56565537-56565559 ACTTCTGGATATTCATTTAAAGG + Intergenic
1068850861 10:61738358-61738380 ATTTCTGGATTTTTATGTGAAGG + Intronic
1070237184 10:74640814-74640836 AGGTCTAGATGTTAATGTAATGG + Intronic
1070706627 10:78643785-78643807 TATTCTGGATGTTCCTGTGAGGG - Intergenic
1071343678 10:84671089-84671111 ATTTCTGGATGTGTCTGTGAGGG + Intergenic
1071758187 10:88569802-88569824 AGGTTTGGAGGTACATGTGAAGG - Intronic
1072171273 10:92864539-92864561 ATTTCTGGGTGTTCCAGTGAGGG + Intronic
1072409961 10:95192652-95192674 ATTTCTTGATGTGCCTGTGAGGG + Intergenic
1072590039 10:96820648-96820670 ATTTCTGGATGTGTCTGTGAGGG + Intergenic
1072910460 10:99496525-99496547 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
1074607617 10:114989327-114989349 ATTTCTGGGTGTTTCTGTGAGGG + Intergenic
1075283413 10:121161289-121161311 GGTTCTGGATGTGCTTTTGAAGG - Intergenic
1075296536 10:121281280-121281302 TGTTCTAGATGTTTCTGTGAAGG + Intergenic
1075559035 10:123455263-123455285 TATTCTGGATGTTAGTGTGAGGG - Intergenic
1075704580 10:124492621-124492643 TATTCTGGATGTTTCTGTGAAGG - Intronic
1076122198 10:127945122-127945144 AGCTCTGGATGTGCAGGGGAAGG - Intronic
1076257026 10:129035542-129035564 AGTTCAGGAAGTTGATTTGATGG + Intergenic
1077133804 11:988424-988446 GGACCTGGATGTGCATGTGAGGG + Intronic
1077596412 11:3535766-3535788 AGTTCTGGATGGAGATGAGATGG + Intergenic
1077614480 11:3665285-3665307 ATTTCTGGATGTGTCTGTGAGGG + Intergenic
1078077662 11:8176288-8176310 AATTCTGGATGTTTCTGTGAGGG + Intergenic
1078711911 11:13800757-13800779 AGTTCTGGGTGTACGTGTGAGGG - Intergenic
1078893893 11:15581157-15581179 TATTCTGGATGTTTCTGTGAAGG - Intergenic
1078897471 11:15609730-15609752 AAGTCTGAATGTTCTTGTGAAGG - Intergenic
1079343821 11:19634463-19634485 AGGTTTGGAGGTACATGTGAAGG - Intronic
1079766431 11:24398960-24398982 ACTTCTAGATGTTACTGTGAAGG - Intergenic
1079794895 11:24788947-24788969 TATTCTGGATGTTCCTATGAGGG - Intronic
1080262405 11:30363928-30363950 TGTTTTGGATGCCCATGTGAAGG - Intergenic
1081044430 11:38253677-38253699 ATTTCTGAATGTGCCTGTGAGGG - Intergenic
1081057260 11:38425615-38425637 ATTTCTGAATGTTCAGGTGTTGG - Intergenic
1081354972 11:42101520-42101542 AGATCTGGATAATCAAGTGATGG + Intergenic
1083134270 11:60656923-60656945 TATTCTGGCTGTTCCTGTGAGGG + Intergenic
1084252325 11:67909743-67909765 AGTTCTGGATGGAGATGAGATGG + Intergenic
1084820527 11:71686290-71686312 AGTTCTGGATGGAGATGAGATGG - Intergenic
1085527826 11:77174322-77174344 AGTTATGGCTGTGCAGGTGAGGG - Intronic
1085731842 11:79006864-79006886 TATTCTGGATGTTTCTGTGAAGG + Intronic
1085860700 11:80231109-80231131 AGTTCTGGAAGTACAAGTCAGGG + Intergenic
1085908593 11:80794560-80794582 ATTTCTGAATGTCCCTGTGAAGG - Intergenic
1086518014 11:87636499-87636521 TGTTCTGGATGATCTTGTCAAGG + Intergenic
1087620720 11:100538571-100538593 AATTCTGGAGTTTCATCTGAAGG - Intergenic
1087871747 11:103303194-103303216 AGTTCTTGAAGTTCCTGAGAAGG - Exonic
1088826869 11:113503282-113503304 TGTGCTGGTTGCTCATGTGAAGG - Intergenic
1090447015 11:126773210-126773232 CATTCTGGATGTTTCTGTGAAGG + Intronic
1091151633 11:133334618-133334640 AGGTTTGGAAGTCCATGTGAAGG - Intronic
1092422584 12:8344536-8344558 AGTTCTGGATGGAGATGAGATGG + Intergenic
1092643525 12:10543430-10543452 ATTTCTGGATGTGTTTGTGAGGG + Intergenic
1092749965 12:11709639-11709661 TCTTCTGGATGTTTCTGTGAAGG + Intronic
1093725823 12:22507203-22507225 TATACTGGGTGTTCATGTGAAGG - Intronic
1094378898 12:29821290-29821312 GTTTCTGGATGTTTCTGTGAAGG - Intergenic
1095597065 12:43971252-43971274 AGTTCAATATGTTCATGTGGTGG + Intronic
1098473436 12:70871686-70871708 ATTTCTGGAGTATCATGTGATGG - Intronic
1098580730 12:72095824-72095846 TATTCTGGATGTTTCTGTGAGGG + Intronic
1098746214 12:74240419-74240441 ATTTCTGGGTGTGCTTGTGAGGG + Intergenic
1099182507 12:79484451-79484473 TATTCTGGATGTTTCTGTGAAGG - Intergenic
1099488346 12:83255636-83255658 GATTCTGGATGTTTCTGTGAGGG + Intergenic
1099804142 12:87496456-87496478 AGTTCTGGTTTTTCATGCGTAGG - Intergenic
1099841804 12:87975736-87975758 TATTCTGGATGTTTCTGTGAGGG + Intergenic
1099945510 12:89239420-89239442 AGTTCTGAAAATTCATGTGAAGG - Intergenic
1100212813 12:92415425-92415447 ATTTCTAGATGTAAATGTGAGGG + Intergenic
1100850320 12:98703418-98703440 AGTACTGGATGGTGCTGTGATGG - Exonic
1101396384 12:104352060-104352082 ATTCCTGGATGTTTCTGTGAGGG + Intergenic
1101403588 12:104409255-104409277 CATTCTGGATGTTTCTGTGAAGG - Intergenic
1103577341 12:121888178-121888200 GGTGCTGGATGTTCCTGTTAAGG - Intergenic
1104155293 12:126125705-126125727 GGTTCTAGGTGTTCATTTGAGGG + Intergenic
1104531691 12:129577893-129577915 AATTCTGGATGTGTCTGTGAAGG + Intronic
1105231026 13:18495956-18495978 TGTTCTGGAATTTTATGTGAGGG + Intergenic
1105231794 13:18503168-18503190 AGTTCTGGAATCTTATGTGAGGG + Intergenic
1105428914 13:20319294-20319316 TCTTCTGGATGTTTCTGTGAGGG + Intergenic
1105853171 13:24353710-24353732 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
1108718492 13:53105799-53105821 ATTTCTGGGTGTGCCTGTGAGGG + Intergenic
1109013997 13:56984587-56984609 ATTTCTGGATGTGTCTGTGAGGG + Intergenic
1109658785 13:65430747-65430769 AGCACTGGATGTTTAGGTGAAGG + Intergenic
1109672290 13:65625269-65625291 TATTCTGGATGTTACTGTGAGGG + Intergenic
1109864621 13:68246585-68246607 AGTTTTGGGAGTACATGTGAAGG + Intergenic
1109955368 13:69558575-69558597 TATTCTGGATGTTGCTGTGAGGG + Intergenic
1110066232 13:71109928-71109950 ACTTCTGGATGTGTTTGTGAGGG + Intergenic
1111366442 13:87251702-87251724 TGATCTGGAAGTTCCTGTGATGG - Intergenic
1111741768 13:92214160-92214182 AGTCCTTGATTTTCACGTGAAGG - Intronic
1112032254 13:95468065-95468087 TATTCTGGATGTTTCTGTGAGGG - Intronic
1112605198 13:100897642-100897664 TATTCTGGATGTTTCTGTGAGGG - Intergenic
1113223180 13:108128801-108128823 AGCTCTGGAAGTTCATGAGATGG + Intergenic
1114015201 14:18422216-18422238 TGTTCTGGATTTGTATGTGACGG + Intergenic
1114018007 14:18449616-18449638 TGTTCTGGATTATTATGTGAGGG + Intergenic
1114020074 14:18470192-18470214 TGTTCTGGATTGTTATGTGAAGG + Intergenic
1114020188 14:18471296-18471318 TGTTCTGGATTCCCATGTGAGGG + Intergenic
1114021014 14:18478765-18478787 AGTTCTGGAATCCCATGTGAGGG - Intergenic
1114021288 14:18481447-18481469 AGTTCTGGAATCCCATGTGAGGG - Intergenic
1114022267 14:18490953-18490975 GGTTCTGGATCCCCATGTGAGGG - Intergenic
1114023735 14:18505058-18505080 AGTTCTGGAATCCCATGTGATGG - Intergenic
1114027011 14:18537052-18537074 TGTTCTGGATTTCTATGTGAGGG - Intergenic
1114027436 14:18540981-18541003 AGTTCTGGATTCCTATGTGAGGG - Intergenic
1114562282 14:23602040-23602062 AGGTCTGGCTGTTGATGTCAGGG - Intergenic
1115082599 14:29474949-29474971 ATTTCTGGATGTGTTTGTGATGG + Intergenic
1116304191 14:43229541-43229563 ATTTCTGGGTGTGCCTGTGAGGG - Intergenic
1117513498 14:56476538-56476560 GGTTCTGGATGGGCATGTCAAGG + Intergenic
1118070555 14:62242686-62242708 ACTTGTGGATGTTTAGGTGATGG + Intergenic
1118711847 14:68525941-68525963 TGACTTGGATGTTCATGTGATGG - Intronic
1119380320 14:74224239-74224261 AGAGCAGGATATTCATGTGAAGG - Intergenic
1120656059 14:87191291-87191313 TGTTCTGGATGTTCCTGTGAAGG - Intergenic
1120668779 14:87339687-87339709 CGTGCTGGATGTTCATATTATGG + Intergenic
1120919715 14:89743827-89743849 TATTCTGGATGTTTCTGTGAGGG + Intergenic
1120920017 14:89746135-89746157 TATTCTGGATGTTTCTGTGAGGG + Intergenic
1121066953 14:90976515-90976537 ATTTCTGTGTGTTCATTTGAGGG + Intronic
1121837826 14:97107805-97107827 AGGTTTGGAGGTACATGTGAAGG - Intergenic
1121883815 14:97524574-97524596 TGTTCTGGATGTTTCTGTGAGGG - Intergenic
1202886256 14_KI270722v1_random:110147-110169 TGTTCTGGATTTTTATGTGATGG + Intergenic
1202887338 14_KI270722v1_random:120087-120109 TGTTCTGGAATTTTATGTGAGGG + Intergenic
1123886549 15:24732932-24732954 AGTTCTGTGTGTTCTTGTGGTGG + Intergenic
1123978168 15:25572556-25572578 TATTCTGGATGTTTCTGTGAAGG - Intergenic
1124992014 15:34684504-34684526 TGTTCTGGAAGTTCTTGTGCAGG - Intergenic
1126385991 15:48093964-48093986 TGATCTGGATGTTCCTGTGAGGG + Intergenic
1126681988 15:51211187-51211209 AGTTCCAGTTGTTCATCTGAGGG - Intronic
1126904786 15:53352716-53352738 ATTTCTGGGTGTGCCTGTGAGGG - Intergenic
1127910054 15:63409344-63409366 ATTTCTGGGTGTGCCTGTGAGGG - Intergenic
1128756023 15:70184640-70184662 ATTTCTGGATGTGACTGTGAGGG - Intergenic
1128950451 15:71874766-71874788 AGTGTTGCATGTTCATATGAAGG - Intronic
1129929511 15:79398735-79398757 ATTTCTGGATGTGTCTGTGAGGG - Intronic
1130168038 15:81483292-81483314 GATTCTGGATGTTTCTGTGAAGG - Intergenic
1131934991 15:97493810-97493832 ATTTCTGGGTGTGTATGTGATGG - Intergenic
1133672878 16:8041276-8041298 TGTTCTGGATGTTTCTGTGAGGG - Intergenic
1137635389 16:49981659-49981681 TATTCTGGATGTTTCTGTGAGGG - Intergenic
1138032458 16:53570657-53570679 ATTTCTGAATGTGCCTGTGAGGG + Intergenic
1138133559 16:54502160-54502182 AGTTCTGGTTGTTTAAGTGTGGG - Intergenic
1138218236 16:55224546-55224568 GGTTCTAGATGCTCTTGTGAGGG - Intergenic
1140568158 16:76068622-76068644 CGTTCTGGAACTTGATGTGAAGG + Intergenic
1140982315 16:80122667-80122689 AGGGCTGGATGTTCATGAGCTGG - Intergenic
1144224380 17:13130837-13130859 AGGTTTGGAGGTACATGTGAAGG - Intergenic
1148283674 17:46369398-46369420 TATTCTGGATGTTTCTGTGAGGG - Intergenic
1148305892 17:46587315-46587337 TATTCTGGATGTTTCTGTGAGGG - Intergenic
1148990164 17:51659074-51659096 ATTTCTGGGTGTGCCTGTGAGGG + Intronic
1203155981 17_GL000205v2_random:3940-3962 TGTTCTGGAGTTTTATGTGAGGG + Intergenic
1203157441 17_GL000205v2_random:17825-17847 TGTTCTGGAATCTCATGTGAGGG + Intergenic
1203159017 17_GL000205v2_random:32007-32029 AGTTCTGGAATCTTATGTGAGGG + Intergenic
1153279285 18:3399014-3399036 TGTTCTGGGTGTGCCTGTGAGGG + Intergenic
1153375128 18:4368335-4368357 ACATCTGGATGTTTCTGTGAAGG + Intronic
1154521524 18:15235537-15235559 AGTTCTGGAATCTTATGTGAGGG - Intergenic
1154522410 18:15244135-15244157 TGTTCTGGAATTTTATGTGAGGG - Intergenic
1156125282 18:33897732-33897754 AGGTTTGGAGGTACATGTGAAGG - Intronic
1156715430 18:40003175-40003197 AGGTTTGGAGGTACATGTGAAGG - Intergenic
1157829428 18:50843246-50843268 TATTCTGGATGTTTCTGTGAAGG - Intergenic
1157831485 18:50860649-50860671 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
1157896215 18:51470736-51470758 ATTTCTGGATGTGTCTGTGAGGG + Intergenic
1158346302 18:56520200-56520222 AGTTCTGGATGTTCATGATTTGG + Intergenic
1158758339 18:60353395-60353417 AATTCTAGATGTTCCTGGGAAGG + Intergenic
1159238661 18:65711174-65711196 AGGTTTGGAGGTACATGTGAAGG - Intergenic
1159246180 18:65808170-65808192 AGGTTTGGAGGTACATGTGAAGG - Intronic
1160138585 18:76297352-76297374 AAGTCTGGATGTTTCTGTGAGGG + Intergenic
1162806363 19:13139797-13139819 TGTTTTAGATTTTCATGTGAAGG + Exonic
1163860473 19:19740167-19740189 TGTTCCGAATGTTCATGGGAAGG + Intergenic
1164699187 19:30270621-30270643 AGTGATGGAAGATCATGTGACGG + Intronic
1167075397 19:47245463-47245485 GGTACTGGATGTGGATGTGAAGG + Intergenic
1167787805 19:51650120-51650142 TATTCTGGGTGTTCCTGTGAGGG - Intergenic
1168389121 19:55991885-55991907 AGTTTTGGGGGTACATGTGAAGG + Intergenic
1202661720 1_KI270708v1_random:77641-77663 TGTTCTGGATTTTTATGTGATGG + Intergenic
1202662710 1_KI270708v1_random:86643-86665 CGTTCTGGATTTCTATGTGAGGG + Intergenic
1202662761 1_KI270708v1_random:87075-87097 TGTTCTGGAATTTTATGTGAGGG + Intergenic
925166874 2:1721113-1721135 TATTCTGGATGTTTCTGTGAAGG - Intronic
925438442 2:3862856-3862878 ATTTCTGGATGTGTCTGTGAAGG - Intergenic
925581443 2:5415420-5415442 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
926397045 2:12454082-12454104 TATTCTGGATGTTTCTGTGAGGG + Intergenic
926609036 2:14926918-14926940 TATTCTGGATGTTCCTTTGAGGG + Intergenic
927308880 2:21605637-21605659 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
928575387 2:32649424-32649446 TGTGCTGGAAGTTCAGGTGATGG + Intronic
928982687 2:37153236-37153258 AGTTGTGGATGTGGATGTGGTGG - Intronic
929049720 2:37825845-37825867 ACTTCTGGAGGTTTATGTGCTGG - Intergenic
930572209 2:53101473-53101495 ATGTCTGGATTTTCTTGTGAAGG - Intergenic
930900147 2:56496436-56496458 AGTTTTGGGGGTACATGTGAAGG - Intergenic
938204285 2:129404084-129404106 ATTTCTGGGTGTGCCTGTGAGGG + Intergenic
938520890 2:132069304-132069326 AGTTCTGGAATCTTATGTGAGGG - Intergenic
938521663 2:132076704-132076726 TGTTCTGGAATTTTATGTGAGGG - Intergenic
939648965 2:144738763-144738785 ATTTCTGAATGCTCAGGTGAAGG - Intergenic
940070312 2:149679159-149679181 ATTTCTGGATGTGTCTGTGAAGG - Intergenic
941299630 2:163785264-163785286 GATTCTGAATGTTTATGTGAGGG + Intergenic
942837149 2:180314072-180314094 GTTTCTGGATGTGCCTGTGAGGG - Intergenic
942837294 2:180315573-180315595 AGTTCTGGGTGTGTTTGTGAGGG + Intergenic
943475659 2:188352170-188352192 TATTCTGGATGTTTCTGTGAGGG + Intronic
943977739 2:194505291-194505313 AGTTCTGGATATTTTTGTGTGGG - Intergenic
944917102 2:204372360-204372382 AGTTCTGGCCGTGCATCTGAAGG + Intergenic
945679392 2:212895365-212895387 AAATCAGGCTGTTCATGTGATGG - Intergenic
947349953 2:229233375-229233397 AGTTCTAGATGTACATGGGCAGG + Intronic
947380591 2:229541403-229541425 CATTCTGGATGTTTCTGTGAAGG + Intronic
948008794 2:234633987-234634009 AGTTCTGGATGTTTAAGACAAGG - Intergenic
1169553586 20:6726607-6726629 AGTTCTAGATGAGGATGTGAAGG - Intergenic
1170118799 20:12890512-12890534 AATTGTGGATGTTCATGCAATGG + Intergenic
1170194130 20:13673434-13673456 TGTTCTGGATGTGGATGAGAGGG - Intergenic
1171205720 20:23279218-23279240 ACTTCTGGATGTATCTGTGAGGG - Intergenic
1175034211 20:55984405-55984427 ATTTCTGGGTGTGCTTGTGAGGG + Intergenic
1175527398 20:59644880-59644902 GGTTCTGGAGGTACATGTGCAGG + Intronic
1176775015 21:13124309-13124331 TGTTCTGGAATTTTATGTGAGGG + Intergenic
1176775766 21:13131469-13131491 AGTTCTGGAATCTTATGTGAGGG + Intergenic
1176933923 21:14844852-14844874 AATTCAGGAGGTACATGTGAAGG - Intergenic
1177079473 21:16620676-16620698 AGTTCTGTATTTTGATGTGGTGG - Intergenic
1177785416 21:25666083-25666105 CATTCTGGATGTTTCTGTGAGGG - Intronic
1177891830 21:26813883-26813905 ACTTGTGGATGTTGCTGTGAAGG - Intergenic
1178138630 21:29656511-29656533 AATTCAGGATGTCCCTGTGATGG - Intronic
1178772534 21:35519026-35519048 TATTCTGGATGTTTCTGTGAGGG + Intronic
1178804290 21:35825565-35825587 TGTTCTGGGTGTGCCTGTGAGGG + Intronic
1178805463 21:35835725-35835747 ATTTCTGGGTGTGCCTGTGAGGG - Intronic
1179376882 21:40857587-40857609 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
1179531893 21:42025298-42025320 TGTTCTAGATGTTTTTGTGAAGG - Intergenic
1180329566 22:11464575-11464597 TGTTCTGGAATTTTATGTGAGGG + Intergenic
1180439703 22:15352993-15353015 TGTTCTGGATTTGTATGTGACGG + Intergenic
1180442516 22:15380486-15380508 TGTTCTGGATTATTATGTGAGGG + Intergenic
1180442522 22:15380534-15380556 AGTTCTGGAATCCCATGTGAGGG + Intergenic
1180444580 22:15401017-15401039 TGTTCTGGATTGTTATGTGAAGG + Intergenic
1180444694 22:15402121-15402143 TGTTCTGGATTCCCATGTGAGGG + Intergenic
1180445495 22:15409303-15409325 AGTTCTGGAATCCCATGTGAGGG - Intergenic
1180445745 22:15411793-15411815 AGTTCTGGAATCCCATGTGAGGG - Intergenic
1180447368 22:15427466-15427488 AGTTCTGGAGTTCTATGTGAGGG - Intergenic
1180447905 22:15432589-15432611 AGTTCTGGAATCCCATGTGATGG - Intergenic
1180451146 22:15464247-15464269 TGTTCTGGATTTCTATGTGAGGG - Intergenic
1180451584 22:15468270-15468292 AGTTCTGGATTCCTATGTGAGGG - Intergenic
1180847509 22:18992002-18992024 AGTTCTGCATCTTCATGTGAGGG + Intergenic
1181695102 22:24589029-24589051 AGCCCTGGCTGTTCCTGTGATGG + Intronic
1181983394 22:26782250-26782272 ACTTCTGGATGAACAAGTGATGG + Intergenic
1184898218 22:47424756-47424778 TATTCTGGATATTCCTGTGACGG + Intergenic
949593531 3:5518886-5518908 ACATCTGGATGTTGCTGTGAAGG + Intergenic
951453229 3:22862900-22862922 TATTCTGGATGTTTCTGTGATGG - Intergenic
951966355 3:28389990-28390012 TATTCTGGATATTCCTGTGAAGG - Intronic
951994637 3:28713713-28713735 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
952733932 3:36669130-36669152 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
953117527 3:40007946-40007968 AGGTCTGGGTGTTCTTGTCAAGG - Intronic
953118063 3:40012535-40012557 ATTTCTGAATGTGCCTGTGAGGG + Intronic
953278516 3:41528952-41528974 AGGTTTGGAGGTACATGTGAAGG - Intronic
954840702 3:53509049-53509071 AGTCCTGTCTGCTCATGTGATGG + Intronic
954899233 3:54004854-54004876 TATTCTGGATGTTTGTGTGAGGG - Intergenic
955417410 3:58705436-58705458 TATTCTGGATGTTTCTGTGATGG + Intergenic
955571845 3:60315514-60315536 AGTTCTTGAATTTCATGTGTAGG + Intronic
955650706 3:61191199-61191221 ATTTCTGGATGTGTCTGTGAGGG + Intronic
956031723 3:65044789-65044811 ACTTCAGGATGTTCATTTTATGG - Intergenic
956088557 3:65639553-65639575 AATTCTGGGTGTTTCTGTGATGG + Intronic
956446346 3:69329902-69329924 GGTTTGGGAGGTTCATGTGAAGG - Intronic
956769541 3:72513073-72513095 TATTCTGGATGTTTTTGTGAGGG + Intergenic
956894442 3:73645338-73645360 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
957066383 3:75526154-75526176 AGTTCTGGATGGAAATGAGATGG + Intergenic
957791703 3:84949951-84949973 ATTTCTGGATGTATCTGTGAGGG - Intergenic
958518168 3:95148345-95148367 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
958830262 3:99079019-99079041 ATTTCTGGATGTGTCTGTGAGGG + Intergenic
959124055 3:102268626-102268648 AGGTTTGGAGGTGCATGTGAAGG - Intronic
959173145 3:102868764-102868786 AGTTCTGGGTGTTTGTGTGAGGG - Intergenic
960686192 3:120296531-120296553 AGTTTTGGGGGTACATGTGAAGG - Intergenic
960947592 3:122977628-122977650 TATTCTGGATGTTTTTGTGAGGG - Intronic
963420158 3:145052029-145052051 AGTTCTAGAGGTTAAAGTGAGGG + Intergenic
966199885 3:177351248-177351270 TATTCTGGATGTTTCTGTGAGGG + Intergenic
966780679 3:183581500-183581522 AGTTCTGGATGTTTTTGCAAAGG - Intergenic
967268162 3:187709985-187710007 ATTTCTGGATGTGTCTGTGAGGG + Intronic
967616734 3:191578310-191578332 AATTCTGTCTGTCCATGTGAGGG + Intergenic
968344679 3:197991666-197991688 TATTCTGGATGTTTCTGTGAAGG - Intronic
969010985 4:4062210-4062232 AGTTCTGGATGGAGATGAGATGG + Intergenic
969078873 4:4602828-4602850 ATTTCTGGGTGTGCCTGTGAGGG - Intergenic
969094985 4:4725929-4725951 TTTTCTGGATGTTCCTATGAGGG - Intergenic
969743080 4:9047684-9047706 AGTTCTGGATGGAGATGAGATGG - Intergenic
969802462 4:9579771-9579793 AGTTCTGGATGGAGATGAGATGG - Intergenic
970543375 4:17101738-17101760 TATTTTGGATGTTCCTGTGAGGG + Intergenic
971078896 4:23184000-23184022 ATTTCTGGGTGTGCCTGTGAGGG - Intergenic
971266559 4:25100991-25101013 TTTTCTGGATGTTTCTGTGAGGG - Intergenic
971715517 4:30170596-30170618 ATTTCTGCATGTTGATGTCACGG - Intergenic
972147149 4:36042146-36042168 AGGTTTGGAGGTACATGTGAAGG - Intronic
972371881 4:38432015-38432037 TATTCTGGATGTTTTTGTGAGGG - Intergenic
972415486 4:38835443-38835465 ATATCTGGATGTTCCTGTGTGGG - Intronic
972499551 4:39664640-39664662 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
973186078 4:47330274-47330296 TATTCTGGGTGTTCCTGTGAGGG - Intronic
973257256 4:48126005-48126027 TATTCTGGATGTTTCTGTGAAGG - Intronic
974104519 4:57454452-57454474 ATTTGTGCATGTTTATGTGAGGG + Intergenic
974310010 4:60193037-60193059 AGGTTTGGAGGTACATGTGAAGG - Intergenic
974332399 4:60497368-60497390 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
974480339 4:62434751-62434773 AGGTTTGGAGGTTCATGTGCAGG + Intergenic
976336823 4:83897991-83898013 ATTTCAGCATATTCATGTGAGGG + Intergenic
976687462 4:87830704-87830726 AGGTTTGGAGGTACATGTGAAGG - Intronic
977055989 4:92191244-92191266 ATTTCTGGATATTTCTGTGATGG + Intergenic
977412739 4:96689064-96689086 AGCTGTAGATGTGCATGTGAGGG + Intergenic
977774281 4:100899202-100899224 AGATTTGGATGTACATGTGAAGG - Intergenic
979002850 4:115247552-115247574 TGTTCTAGATGTTTCTGTGAAGG + Intergenic
979072802 4:116231737-116231759 CATTCTGGATGTTTCTGTGAGGG + Intergenic
979707418 4:123736993-123737015 AGTTCTAAATGTTCTTGTGGAGG - Intergenic
979906001 4:126294453-126294475 AGTTCAGGAAGTACATGTGCAGG + Intergenic
981157530 4:141457245-141457267 ATTTCTGGGTGTTTCTGTGATGG + Intergenic
981215583 4:142162676-142162698 ATCTCTGCATGTGCATGTGAGGG - Intronic
981347529 4:143694123-143694145 AGGTTTGGAGGTACATGTGAAGG - Intronic
982346262 4:154363846-154363868 AGTTCTGAAAGTTCATCTGTTGG - Intronic
982998682 4:162383701-162383723 AGTTCTGGATATTTCTGTGCTGG - Intergenic
983881907 4:172942369-172942391 TGCTGTGGATGTTCTTGTGAGGG + Intronic
984399006 4:179237876-179237898 ATTTTTGGATGTGCCTGTGAAGG + Intergenic
984414302 4:179436706-179436728 AGATCTGGATGATCAGGTGAAGG + Intergenic
985005491 4:185531307-185531329 AGTTTTGGATGTTCAGTTTAGGG - Intronic
985106283 4:186503255-186503277 TATTCTGGATATTCCTGTGAGGG + Intronic
985261682 4:188120267-188120289 AAATCTGGTTGTTGATGTGAGGG + Intergenic
986428235 5:7655654-7655676 ATTTCTGGATGTGTCTGTGAGGG - Intronic
986619449 5:9656668-9656690 ATTTCTGGATGTGTCTGTGAGGG - Intronic
987012889 5:13785219-13785241 TGTTGTGAATGCTCATGTGAAGG - Intronic
987237834 5:15960834-15960856 ATTTCTGGATGTGCTTGTGAAGG + Intergenic
988177902 5:27750842-27750864 ATTTCTGGATGTGCCTGTGAGGG - Intergenic
988294357 5:29335718-29335740 AGTTCTAGAAGTTCTGGTGAGGG + Intergenic
988489821 5:31696902-31696924 GGTTCTGCTTGTTCATCTGAAGG + Intronic
989263737 5:39448407-39448429 AGTTGTGGATATTGCTGTGAAGG + Intronic
992030188 5:72713390-72713412 AGTTCTGGGTGTGTCTGTGAGGG + Intergenic
992207981 5:74449470-74449492 TATTCTGGATGTTTCTGTGAGGG - Intergenic
993125191 5:83825848-83825870 AGTTCTGGCTGTGTCTGTGAGGG - Intergenic
993568715 5:89508842-89508864 AGTTTTGGGGGTACATGTGAAGG - Intergenic
993597132 5:89871186-89871208 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
993854505 5:93056585-93056607 ATTTCTGGGTGTGCCTGTGAGGG + Intergenic
994073254 5:95624031-95624053 ATTTCTGGGTGTGCCTGTGAGGG + Intergenic
994106604 5:95956522-95956544 AGGTCTGGATGCTCAAGTGGTGG + Intronic
994523392 5:100871958-100871980 AGTTCTGTATTTTCTTGTAAAGG + Intronic
994540957 5:101096404-101096426 GATTCTAGATGTTTATGTGAAGG + Intergenic
994672029 5:102773745-102773767 GGTTCTGGGGGTACATGTGAAGG + Intronic
998927930 5:147147557-147147579 GGTTCTGGAGGTACATGTGCAGG - Intergenic
999315937 5:150584024-150584046 AGGGCAGGATGTTCATGTCATGG + Intergenic
999728069 5:154453352-154453374 AGTCCTGGGTGGTCAGGTGATGG + Intronic
999989788 5:157039135-157039157 ATTTCTGGATGTTAAAGTTATGG - Intronic
1000210521 5:159103219-159103241 ACTTCTAAATCTTCATGTGAGGG + Intergenic
1000481326 5:161778891-161778913 AGTTCAAGATGTTCATTTGTTGG + Intergenic
1001645667 5:173280081-173280103 AGTTCTGGCTGTGTATGTGCGGG + Intergenic
1001739798 5:174043286-174043308 ACTACTGGATGTTCATCTAAAGG - Intergenic
1003078625 6:3003368-3003390 AATCCTGGATGTTCTTGGGAGGG - Intronic
1003084715 6:3052362-3052384 AATCCTGGATGTTCTTGGGAGGG + Intergenic
1003670298 6:8151140-8151162 TGTTCAGGATATTCCTGTGAGGG - Intergenic
1003685920 6:8302029-8302051 TATTCTGGATGTTTCTGTGAGGG + Intergenic
1005687581 6:28269831-28269853 TATTCTGGATGTTTCTGTGAGGG - Intronic
1005937460 6:30534337-30534359 TATTCTGGATGTTTCTGTGAAGG - Intergenic
1006190368 6:32203963-32203985 AGTGCTAGATGTGCAGGTGAAGG + Intronic
1007484343 6:42170506-42170528 ATTTCTGGGTGTTTCTGTGAGGG - Intronic
1007973564 6:46077369-46077391 AGTTCTGGATGTTCTTCTCCTGG - Intronic
1009533196 6:64846927-64846949 ATTTCTGGGTGTGTATGTGAAGG + Intronic
1009687205 6:66977695-66977717 ATTTCTGGATCATCTTGTGAGGG + Intergenic
1010140334 6:72606989-72607011 AGTTGTGGTTGGTCATGAGATGG + Intergenic
1010664172 6:78607415-78607437 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
1011132490 6:84065726-84065748 AATTCTAGATGTTTCTGTGAAGG + Intronic
1011481578 6:87799119-87799141 AGTTCTGGGACTTGATGTGAGGG + Intergenic
1011806046 6:91073578-91073600 ATTTCTGGATGTGTCTGTGATGG - Intergenic
1012298018 6:97548827-97548849 TATTCTGGATGTTTCTGTGAGGG - Intergenic
1012530106 6:100225370-100225392 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
1012831621 6:104210689-104210711 ATTTCTGGATGTGTATGTGAAGG - Intergenic
1013275269 6:108579062-108579084 AGTTCTGGATGTTCATGTGAGGG + Intronic
1014178709 6:118359466-118359488 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
1014364071 6:120518627-120518649 AGTTCAGGAGGTACATGTGTAGG + Intergenic
1016439701 6:144070364-144070386 ATTTCTGGATGTATCTGTGAGGG + Intergenic
1016661480 6:146586004-146586026 ATTTCTGGATGTGTCTGTGAGGG + Intergenic
1016864378 6:148750657-148750679 AATTATGGATGTAAATGTGATGG - Intronic
1017561091 6:155628567-155628589 ATTTCTGGATGTGACTGTGAGGG - Intergenic
1017745038 6:157439019-157439041 TTTTCTGGCAGTTCATGTGAGGG + Intronic
1018266597 6:162030787-162030809 ATTTGTGGATGTACAGGTGATGG + Intronic
1018440387 6:163807115-163807137 TGTTCTGGATGTTGGTGTGAAGG - Intergenic
1018538833 6:164854308-164854330 ATTTCTGGATGTGTCTGTGAGGG - Intergenic
1018672843 6:166193938-166193960 AATTCTGGATCTTGATGTGGAGG - Intergenic
1018763553 6:166911084-166911106 TATTCTGGATGTTTCTGTGAGGG - Intronic
1019116487 6:169768043-169768065 AGTTCTGTATGTTTATGTATGGG + Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1020796333 7:12682291-12682313 AGGTATGGATATGCATGTGAAGG + Intergenic
1021748109 7:23764857-23764879 AGGTTTGGAGGTACATGTGAAGG - Intronic
1021775122 7:24046646-24046668 TATTCTGGATGTTCCTGTGATGG + Intergenic
1021814677 7:24435584-24435606 TTTTCTGGATGTTTCTGTGAGGG + Intergenic
1022298476 7:29080228-29080250 AGGTTTGGGTGTACATGTGAAGG - Intronic
1023006126 7:35869272-35869294 AGTTCTGGGTCTTGATGAGAAGG + Intronic
1023669529 7:42561190-42561212 GGTTCAGGGGGTTCATGTGAAGG + Intergenic
1024057435 7:45670890-45670912 AGTTCTGAGAGTTCACGTGAAGG - Intronic
1024086665 7:45897638-45897660 TATTCTGGATGTTTCTGTGAGGG - Intergenic
1026411056 7:70123325-70123347 AGTTTTGGGGGTACATGTGAAGG + Intronic
1028114356 7:86981001-86981023 GATTCTGGGTGTTCATCTGATGG + Intronic
1028669925 7:93390075-93390097 TGTTATGAATGTTCATGTGTGGG - Intergenic
1028842851 7:95447099-95447121 TATTCTGGATGTTTCTGTGAAGG - Intergenic
1029070273 7:97890234-97890256 AGTTCTGGATGGAGATGAGATGG + Intergenic
1029947656 7:104550248-104550270 TATTCTGGATGTTTCTGTGATGG - Intronic
1031138828 7:117918908-117918930 ATTTCTGGATGTGTTTGTGAAGG - Intergenic
1031808785 7:126340126-126340148 TATTCTGGATGTTTCTGTGAAGG - Intergenic
1032766643 7:135000278-135000300 ATTTCTGGATGTGCCTCTGAGGG + Intronic
1032779733 7:135155508-135155530 ACTTCTGTATGTTTTTGTGATGG + Intronic
1033880247 7:145872720-145872742 AATTCAGGATATTCATGTGTGGG - Intergenic
1034128051 7:148691591-148691613 TATTCTGGATGTTTCTGTGAAGG + Intergenic
1034678097 7:152906808-152906830 ATTTCTGGGTGTGCCTGTGAAGG + Intergenic
1034713544 7:153218627-153218649 ATTTCTGGGTGTGCCTGTGAAGG - Intergenic
1035033176 7:155877776-155877798 AGTTCTAGATGATGAGGTGAAGG + Intergenic
1035301478 7:157900453-157900475 AGGTCTGGATGTTGAGGTCAAGG - Intronic
1036248289 8:7139467-7139489 AGTTCTGGATGGAGATGAGATGG - Intergenic
1036252523 8:7174886-7174908 AGTTCTGGATGGAGATGAGATGG + Intergenic
1036364974 8:8112576-8112598 AGTTCTGGATGGAGATGAGATGG - Intergenic
1036767611 8:11558640-11558662 AGTTCTGCATGTGAACGTGAGGG - Intronic
1036885957 8:12553501-12553523 AGTTCTGGATGGAGATGAGATGG + Intergenic
1036893574 8:12612587-12612609 AGTTCTGGATGGAGATGAGATGG + Intergenic
1037022300 8:13988741-13988763 ACTTCTGGATGTGTCTGTGAGGG + Intergenic
1038095757 8:24308024-24308046 AGTCCTGGATGTTTCTGGGATGG - Intronic
1038285055 8:26199001-26199023 AGGTTTGGGGGTTCATGTGAAGG + Intergenic
1038388618 8:27173890-27173912 ATTTCTGGATGTGTCTGTGATGG + Intergenic
1039342201 8:36663205-36663227 AGTTTTGGGAGTACATGTGAAGG + Intergenic
1039485981 8:37910173-37910195 CGTTCTGTAAGTTCCTGTGAGGG + Intergenic
1040669734 8:49675256-49675278 AGTTCTGGATATTTATATGCTGG + Intergenic
1041079562 8:54203198-54203220 TGTTCTGGATGTTTTTGTGAGGG + Intergenic
1041156383 8:54991452-54991474 ATTTTTTGATGTTCCTGTGAAGG + Intergenic
1042100849 8:65273526-65273548 ATTTCTGGGTGTGCCTGTGAGGG - Intergenic
1042637623 8:70895362-70895384 TGTTCTGGATGTCTTTGTGAGGG + Intergenic
1042823573 8:72957623-72957645 ACTTCTGGGTGTGCCTGTGAGGG - Intergenic
1044624741 8:94226140-94226162 AATTCTGGATATTTCTGTGAGGG - Intergenic
1044892801 8:96855203-96855225 TATTCTGGATGTTTCTGTGAGGG - Intronic
1044923183 8:97187141-97187163 ACATCTGGATGTTGCTGTGAAGG + Intergenic
1047780063 8:128103887-128103909 AGATCTGGAGGTTCTAGTGATGG - Intergenic
1048065978 8:130969105-130969127 TATTCTGGATGTTTCTGTGAAGG + Intronic
1048175468 8:132148586-132148608 ATTTCTGGATGTGTCTGTGAGGG + Intronic
1048237444 8:132705127-132705149 TGGTCTAGATGTTCCTGTGAAGG - Intronic
1048692597 8:136984430-136984452 TATTCTGGATGTTTCTGTGAAGG + Intergenic
1048722439 8:137341463-137341485 ACTTCTGGATGTGTCTGTGAGGG + Intergenic
1050045062 9:1534257-1534279 ATTTCTGGATGTGTCTGTGAGGG + Intergenic
1050203705 9:3176034-3176056 CATTCTGGATGTTTCTGTGAGGG - Intergenic
1050952316 9:11613362-11613384 TATTCTGGATGTTTCTGTGAGGG + Intergenic
1051794345 9:20848139-20848161 ATCTCTGGATCTTCATCTGAAGG - Intronic
1052008345 9:23377226-23377248 AGTTCTGCATATTTCTGTGATGG + Intergenic
1052212838 9:25927776-25927798 AGATCTGGAAGTTCCAGTGAAGG + Intergenic
1052840503 9:33288664-33288686 TGTTTTAGATTTTCATGTGAAGG + Intergenic
1053218134 9:36289668-36289690 TGTTCTGGATGTTTCTGTGAGGG + Intronic
1053581422 9:39408753-39408775 AGTTAAGGATGTTGATGTTAAGG + Intergenic
1053700376 9:40683973-40683995 TGTTCTGGAATTTTATGTGAGGG - Intergenic
1053845901 9:42236786-42236808 AGTTAAGGATGTTGATGTTAAGG + Intergenic
1054103003 9:60967505-60967527 AGTTAAGGATGTTGATGTTAAGG + Intergenic
1054311668 9:63483371-63483393 TGTTCTGGAATTTTATGTGAGGG - Intergenic
1054410450 9:64807524-64807546 TGTTCTGGAATTTTATGTGAGGG - Intergenic
1054583352 9:66939308-66939330 AGTTAAGGATGTTGATGTTAAGG - Intergenic
1056296905 9:85202226-85202248 TATTCTGGATGTTTCTGTGAGGG - Intergenic
1056327808 9:85494839-85494861 ATTTCTGGATGTGTCTGTGAGGG + Intergenic
1056512393 9:87318349-87318371 TATTCTGGATGTTTCTGTGAAGG - Intergenic
1057374178 9:94503632-94503654 TATTCTGGATGTTTCTGTGAAGG - Intergenic
1058071809 9:100609091-100609113 ACTTCTGGATGTTTCTGTGAGGG - Intergenic
1058195925 9:101975752-101975774 GTTTCTGGATGTTTCTGTGAGGG - Intergenic
1058746229 9:107993638-107993660 TATTCTGGATGTTTTTGTGAAGG + Intergenic
1060804757 9:126567954-126567976 ACTTCTGGGTGTTTCTGTGAGGG - Intergenic
1062295123 9:135821042-135821064 AGTTCTGGATGCGAGTGTGAAGG - Exonic
1203455527 Un_GL000219v1:163761-163783 TGTTCTGGAATTCCATGTGAGGG + Intergenic
1203493845 Un_GL000224v1:132225-132247 TGTTCTGGATTCCCATGTGAGGG - Intergenic
1203496116 Un_GL000224v1:153110-153132 AGTTCTGGAATCCCATGTGAGGG + Intergenic
1203506465 Un_KI270741v1:74100-74122 TGTTCTGGATTCCCATGTGAGGG - Intergenic
1203508738 Un_KI270741v1:95033-95055 AGTTCTGGAATCCCATGTGAGGG + Intergenic
1186012136 X:5146135-5146157 TGTTCTGGGTGTTTCTGTGAGGG + Intergenic
1187248521 X:17575471-17575493 AGTTCTGGAGGATGAAGTGATGG - Intronic
1187797868 X:23024198-23024220 TATTCTGGATGTTTCTGTGAAGG + Intergenic
1188516565 X:30993883-30993905 AGGTTTGGGTGTACATGTGAAGG + Intergenic
1188769319 X:34132137-34132159 AGTTCTGGGTGTCCATGGGTGGG + Exonic
1188971047 X:36615574-36615596 AAATCTGGGTGTTCATGTGTTGG - Intergenic
1189087210 X:38038160-38038182 ATTTCTGGATGTTTCTGTGAGGG - Intronic
1190408071 X:50107413-50107435 TATTCTGGATGTTTCTGTGAGGG - Intergenic
1191692124 X:63951194-63951216 AGTTCTGGAAGTTCCAGTCAGGG - Intergenic
1191840513 X:65510448-65510470 AGTGGTGTAGGTTCATGTGAGGG - Intergenic
1192702583 X:73491323-73491345 AGTATTGGATGTTCTGGTGAGGG - Intergenic
1192781467 X:74297568-74297590 AATTCTAGATGTTTCTGTGAGGG + Intergenic
1193226598 X:78990808-78990830 ATTTCTGGGTGTGTATGTGAGGG - Intergenic
1193806932 X:86006392-86006414 AGTGCTGGATGTTCTGGTCAGGG + Intronic
1193852542 X:86557242-86557264 ATTTCTGGATGTGTCTGTGAGGG - Intronic
1193883435 X:86955573-86955595 AGGTTTGGAGGTACATGTGAAGG - Intergenic
1194094059 X:89614758-89614780 AGGTTTGGAGGTACATGTGAAGG - Intergenic
1194108887 X:89806135-89806157 ACTTCTGGATGTGTCTGTGAGGG - Intergenic
1194529701 X:95030434-95030456 AGGTTTGGGTGTACATGTGAAGG - Intergenic
1194584493 X:95716234-95716256 AGTCATTGCTGTTCATGTGAAGG + Intergenic
1195279998 X:103323134-103323156 TATTCTGGATGTTTCTGTGAGGG + Intergenic
1196232622 X:113241248-113241270 AATTCTAGATGTTTCTGTGAAGG - Intergenic
1196931416 X:120685226-120685248 AGCTCTGGATGCTCATGCTAGGG + Intergenic
1197323197 X:125059286-125059308 AAGTCTGGATGTTGCTGTGAAGG + Intergenic
1197547810 X:127848453-127848475 AGTTCTGGATTATCATTTGTTGG - Intergenic
1197970156 X:132106997-132107019 AGGTTTGGGTGTACATGTGAAGG - Intronic
1198204801 X:134455707-134455729 TCTTCTGGATGTTTCTGTGAAGG - Intergenic
1198724513 X:139663461-139663483 AGGTTTGGAGGTACATGTGAAGG + Intronic
1198838574 X:140831698-140831720 ATTTTTGGATGTGCCTGTGAGGG - Intergenic
1199572276 X:149278963-149278985 ATTTCTGGATGTGTCTGTGAGGG + Intergenic
1200461545 Y:3460866-3460888 ACTTCTGGATGTGTCTGTGAGGG - Intergenic
1201442264 Y:14021106-14021128 AGTTCTGGGTGTGTTTGTGAGGG - Intergenic
1202330459 Y:23747358-23747380 AGAGCTGGATGTTAAAGTGATGG - Intergenic
1202540310 Y:25922703-25922725 AGAGCTGGATGTTAAAGTGATGG + Intergenic