ID: 1013277519

View in Genome Browser
Species Human (GRCh38)
Location 6:108600020-108600042
Sequence TTTTATATGTATAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013277510_1013277519 30 Left 1013277510 6:108599967-108599989 CCTCTATGTGAGAAGATCTGAGG 0: 1
1: 0
2: 1
3: 16
4: 120
Right 1013277519 6:108600020-108600042 TTTTATATGTATAAGGAGGGTGG 0: 1
1: 0
2: 1
3: 23
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013277519 Original CRISPR TTTTATATGTATAAGGAGGG TGG Intronic
900468380 1:2837173-2837195 TTTTCTATGGATCTGGAGGGTGG + Intergenic
900836989 1:5012617-5012639 TTGTATTTGCATAAGGAAGGGGG + Intergenic
901651082 1:10743614-10743636 TTCTATAAAAATAAGGAGGGAGG + Intronic
902464133 1:16604461-16604483 TTTTATATGTACATAAAGGGAGG + Intronic
903156965 1:21452217-21452239 TTTTATATGTATATAAAGGGAGG - Intronic
903350651 1:22714488-22714510 TTTGATGTGTCTGAGGAGGGTGG + Intronic
906442959 1:45866698-45866720 TTTTATAAGTATAAGGCTGTAGG - Intronic
908260660 1:62337446-62337468 TTTCACATCTATAAGGAAGGAGG - Intergenic
909315136 1:74207299-74207321 TTTTATATGTATATGCAAGAGGG - Intronic
909772032 1:79435749-79435771 TTTTTTATCTATGAGGAGGGAGG + Intergenic
910956008 1:92705692-92705714 TTTTATTTATAAAAGGAAGGTGG + Intronic
911015229 1:93325058-93325080 TTTTGTGTGTATGTGGAGGGTGG + Intergenic
911042411 1:93601067-93601089 TTCTCTATGCATAAGGAGTGGGG + Intronic
911095364 1:94050394-94050416 TTTAATCTGTGAAAGGAGGGAGG + Intronic
911769219 1:101717864-101717886 TTTCAATTGTTTAAGGAGGGAGG + Intergenic
912006406 1:104906619-104906641 TTTTATCAGTATTAGGAGGTGGG + Intergenic
912475272 1:109930680-109930702 TATTATATGTTTAAGGTAGGGGG - Exonic
913541886 1:119829254-119829276 TTTTATATGTACACAAAGGGAGG - Intergenic
917280066 1:173371510-173371532 TTTGATAAGGAAAAGGAGGGGGG - Intergenic
918194571 1:182209276-182209298 CTTTATATTTGTAAGGAAGGTGG - Intergenic
918457355 1:184735815-184735837 ATGTATATGTGTATGGAGGGTGG - Intronic
919243295 1:194942734-194942756 TTTTATAAGTGGTAGGAGGGAGG + Intergenic
919850030 1:201666340-201666362 TTTTTTTTTTGTAAGGAGGGAGG - Intronic
919886358 1:201937910-201937932 CTTTATGTTTACAAGGAGGGAGG - Intronic
921330833 1:214033803-214033825 TTTTATTTGTATAATGTGAGTGG + Intronic
921474201 1:215586348-215586370 TTTTATTTGTAATAGGAAGGTGG + Intronic
922115783 1:222612418-222612440 TTTTATATGTGGTAGGAGGTAGG + Intergenic
922938869 1:229443671-229443693 TTTTACATATATAAGGCGTGCGG - Intronic
923183109 1:231542162-231542184 TTTTAGTTGTTTAAGGAGGGAGG + Intronic
923587170 1:235284031-235284053 TTTTAAATGTAGAATGAGGCTGG - Intronic
924579297 1:245309630-245309652 TATTATATATATAATGAGAGAGG - Intronic
924926096 1:248682432-248682454 TTTTATTTGTTTAAGCAGTGTGG - Intergenic
1063146167 10:3297051-3297073 TCTTATTTGTGGAAGGAGGGAGG + Intergenic
1063921484 10:10937837-10937859 GTATATATATATATGGAGGGAGG + Intergenic
1063931714 10:11035242-11035264 TTTTCTATGTATAAGGATTTAGG - Intronic
1065371598 10:24992330-24992352 TTTTAGATAAATAAGGAGGTCGG + Intronic
1069572976 10:69505718-69505740 TTTTATATGTACCTGGAGTGGGG + Intronic
1071437202 10:85658404-85658426 TTTAATCTGTAAAATGAGGGGGG - Intronic
1071517600 10:86309301-86309323 TATCATTAGTATAAGGAGGGGGG - Intronic
1072046675 10:91663943-91663965 ATTTATAGGTATGAGTAGGGAGG + Intergenic
1073357089 10:102865245-102865267 TTTTATCTTTATAAGGAGCTGGG - Intronic
1074460382 10:113631305-113631327 TTTTAAATAGATAAGGAGTGTGG - Intronic
1074542387 10:114375728-114375750 TTTTTGAAGGATAAGGAGGGAGG + Intronic
1074808387 10:117077455-117077477 TTTTTTTTTTATTAGGAGGGAGG + Intronic
1075877678 10:125822094-125822116 TTTTCTCTGTAAAATGAGGGGGG - Intronic
1075900783 10:126041312-126041334 TTATATATGTATGAACAGGGTGG + Intronic
1076173635 10:128345792-128345814 TTGTATATGTTTAAGGAGTGAGG + Intergenic
1076216153 10:128694921-128694943 GTTAATATGCATGAGGAGGGAGG - Intergenic
1080871068 11:36237447-36237469 TTTTTCATGTAAAAGGAGGCTGG - Intergenic
1082987304 11:59179980-59180002 TATTATATGTCTAAGCAGGATGG - Intronic
1083461019 11:62812035-62812057 TTTTAGATGTATATGGATTGAGG + Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1086271986 11:85079009-85079031 TTTTATGTGTTTTAGGGGGGGGG + Intronic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1087386410 11:97474627-97474649 GGTGATATGTATAAAGAGGGAGG - Intergenic
1088424648 11:109689780-109689802 TTTTATATATAGTAGGAGGTAGG - Intergenic
1088536181 11:110864250-110864272 CTGTATATGTTTAGGGAGGGAGG + Intergenic
1090358845 11:126158770-126158792 CCTTGGATGTATAAGGAGGGAGG + Intergenic
1092697902 12:11193763-11193785 TTTCATAGGCATAAGGAAGGGGG + Intergenic
1093913117 12:24769592-24769614 TTTTATGTGTGTAGGGATGGGGG + Intergenic
1094237841 12:28189208-28189230 TTTTGTATGCATAAAGAAGGGGG + Intronic
1094242025 12:28239212-28239234 TTTTATATGTATGAGAATAGAGG + Intronic
1094749599 12:33390561-33390583 TTTTATATATATATAGAGGGTGG - Intronic
1095165065 12:38962508-38962530 TTTTAGTTGTTTAAGGTGGGAGG + Intergenic
1097054611 12:56242162-56242184 GTTTGCATGTATATGGAGGGAGG - Exonic
1098347165 12:69518005-69518027 TTTTTTATGTATAAGGAATGAGG + Intronic
1099146451 12:79051411-79051433 CTATATATGTATAAAGAGAGAGG + Intronic
1099566584 12:84256016-84256038 TTTTATATGTGTAAGCAAGAAGG - Intergenic
1100115710 12:91301268-91301290 TTGTATAAGTGTAAGGAAGGGGG - Intergenic
1102382123 12:112475827-112475849 ATGTATATGTATGAGGATGGGGG + Intronic
1103594270 12:122014127-122014149 TCTTTTCTGTAAAAGGAGGGAGG + Intergenic
1104336688 12:127902995-127903017 TTTTGTCTGTATCAGGTGGGAGG - Intergenic
1104395295 12:128427428-128427450 GTATATATATTTAAGGAGGGTGG + Intronic
1105569036 13:21582476-21582498 TTTGATATATATCAGGAAGGGGG - Intronic
1105718548 13:23091521-23091543 TTTTATCCGTATCAGGAGAGGGG - Intergenic
1106282081 13:28283556-28283578 TTTTATATATTTAAAGGGGGAGG - Intronic
1107299639 13:38951570-38951592 TTTTATTTCTATAAAGAGGTGGG - Intergenic
1107367605 13:39701030-39701052 TTTTATATATATAAGTGGGGAGG + Intronic
1107462040 13:40613585-40613607 TTTTATGTGTACAGGGAGTGTGG + Intronic
1107854064 13:44597498-44597520 TTTTATAGGTATAGGATGGGTGG + Intergenic
1108282605 13:48874743-48874765 TTTTATTTGTATAAGTAGTAAGG + Intergenic
1109924209 13:69113353-69113375 TTTTATATACATCAGGAAGGCGG - Intergenic
1110732917 13:78901381-78901403 TTGTGTATGTGTAAGGAAGGGGG - Intergenic
1113071348 13:106424447-106424469 TTTTAGATGTAAAATGATGGAGG - Intergenic
1114741523 14:25103274-25103296 GTTTATATATATAAGGAAGGAGG + Intergenic
1116514982 14:45794353-45794375 TTTTATATATATAGGAAGGTAGG + Intergenic
1116716529 14:48433067-48433089 AGTTATATGTATAAGAAGAGGGG + Intergenic
1116816385 14:49587573-49587595 TATTATATGATTAAGGAAGGAGG + Intronic
1117313983 14:54556196-54556218 TGGTATATGTAAAAGGAGAGAGG + Intergenic
1119828625 14:77680389-77680411 TTCTATGTCTATAATGAGGGTGG + Intronic
1120079333 14:80198010-80198032 TTTTATGTGTATTAGGATTGGGG - Intronic
1120090925 14:80332733-80332755 CTTTATATATATATGGAGAGTGG - Intronic
1120463178 14:84823006-84823028 TTTGATTTGTATAATGAGGCAGG + Intergenic
1121096893 14:91223614-91223636 TTTTATTTTTGGAAGGAGGGGGG + Intronic
1122369324 14:101220419-101220441 TTTTAGATGCTTCAGGAGGGAGG + Intergenic
1123927622 15:25133850-25133872 TTTTACATGGACAAGGAGGAGGG - Intergenic
1124517759 15:30382341-30382363 TTTTATAGGGATTAGGAGGTAGG - Intronic
1127544060 15:59973401-59973423 TTCAAAATGTTTAAGGAGGGAGG - Intergenic
1127594339 15:60463825-60463847 TTTTGTGTGTGTATGGAGGGTGG - Intronic
1128965289 15:72052027-72052049 TTTTATAGGTCTCAGCAGGGAGG - Intronic
1130584412 15:85169275-85169297 TTGTATTTGTATGTGGAGGGGGG - Intergenic
1132110472 15:99099061-99099083 TATTATATGGATAAGGAGGTGGG + Intronic
1132189372 15:99837614-99837636 TTTTATATGTTTGTGGAAGGAGG - Intergenic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1135734451 16:24919671-24919693 ATTCTTATGTATTAGGAGGGAGG - Exonic
1135883369 16:26280931-26280953 TTTTATATGTACAAGGAAGTTGG + Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137272215 16:46909315-46909337 TTTTAAATTTTTAAGTAGGGAGG + Intronic
1137808052 16:51326138-51326160 ATTTAGATGAATAAGAAGGGTGG - Intergenic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1140816593 16:78627040-78627062 TTGTGTATGTATGAGGTGGGGGG - Intronic
1141810498 16:86372429-86372451 GTTTATGTGTATAAGGGGGTGGG + Intergenic
1145405978 17:22594576-22594598 ATTTATATTTAAAAGGAGGATGG + Intergenic
1145876543 17:28322791-28322813 TCTTTTATGTATAACAAGGGTGG + Intronic
1145890292 17:28409472-28409494 TTTTATCTGTTTACTGAGGGAGG - Intergenic
1146205330 17:30900020-30900042 TTTCATATGTATAATCAAGGTGG + Intronic
1146478662 17:33184435-33184457 TTTTAAATGCATAAGGCTGGGGG - Intronic
1147221747 17:38937598-38937620 TTATATACGTATAAGGCGGGTGG - Intronic
1148690235 17:49522922-49522944 TATTATAGGGATAGGGAGGGAGG + Intergenic
1150057395 17:62030740-62030762 TTTTAAAGGTAGATGGAGGGAGG + Intronic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1152669737 17:81595713-81595735 TTTTATATTTATAAAGAGATGGG + Intronic
1155013569 18:21808233-21808255 TTTTATATGCATTAGGAAGTAGG + Intronic
1155683678 18:28520731-28520753 TTTTATGGGTACAAGGTGGGGGG - Intergenic
1156146414 18:34186450-34186472 TTTTATACATATAAGGAAGGAGG - Intronic
1157871870 18:51237385-51237407 TTATTTTAGTATAAGGAGGGAGG - Intergenic
1158779781 18:60633683-60633705 TTATATCTGTATAAAGAGGTAGG - Intergenic
1166125966 19:40715557-40715579 ATTTATATGCACAAGGAAGGAGG - Intronic
1167230556 19:48280208-48280230 TTTTATATTTATAGAGACGGTGG - Intronic
1168165056 19:54541447-54541469 TTTTTTTTCCATAAGGAGGGAGG - Intronic
1202679792 1_KI270711v1_random:41901-41923 TTTTATATGTACATAAAGGGAGG + Intergenic
925494275 2:4428448-4428470 TTTTATTTGTAAAAGGAGAGTGG - Intergenic
925915818 2:8604986-8605008 TTTAATAAGTAGAAGGAGGCAGG - Intergenic
925989892 2:9246187-9246209 TTTTAAATGTCTAAGGAGTACGG - Intronic
926519610 2:13895036-13895058 TTGTATATGTATATGGTGGTTGG + Intergenic
926543967 2:14215777-14215799 TTGAAGATGTTTAAGGAGGGAGG - Intergenic
927325237 2:21797862-21797884 TTTTTTTTGTAAAAGGAAGGAGG + Intergenic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928950972 2:36812635-36812657 TGTTTTATTTATAGGGAGGGAGG - Intronic
929172119 2:38942715-38942737 TATTTTTTTTATAAGGAGGGGGG - Intronic
929443450 2:41984433-41984455 GTTTATATGTAAAGGGAAGGTGG - Intergenic
931588478 2:63854752-63854774 GATTATATTTATAAAGAGGGTGG + Intronic
932323492 2:70838817-70838839 TTTTCTCTGGATAAGGATGGAGG + Intergenic
933074736 2:77908655-77908677 TTTGATAATTATAAGGAGTGGGG + Intergenic
933863499 2:86494671-86494693 TTTTATTTGTGTAAAGTGGGTGG + Intergenic
935036037 2:99374574-99374596 TTTTATATGTTTACTGAGTGAGG + Intronic
935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG + Intergenic
935836212 2:107057118-107057140 GTTTCTATGCACAAGGAGGGAGG + Intergenic
936102903 2:109598922-109598944 TTTTATGAGTTTCAGGAGGGTGG + Intronic
938276456 2:130029521-130029543 TTGTGTATGTATTGGGAGGGGGG - Intergenic
938316811 2:130335306-130335328 ATTTATCTGACTAAGGAGGGAGG + Intergenic
938327413 2:130420279-130420301 TTGTGTATGTATTGGGAGGGGGG - Intergenic
938362528 2:130701198-130701220 TTGTGTATGTATTGGGAGGGGGG + Intergenic
938438916 2:131307838-131307860 TTGTGTATGTATTGGGAGGGGGG + Intronic
938579632 2:132634450-132634472 TGTGATAGGCATAAGGAGGGAGG + Intronic
939108270 2:137975368-137975390 TGTTATATGTAAAAGGAGGGGGG + Intronic
939512781 2:143127220-143127242 TTTTCTTTGTATAAGGTGGAAGG - Intronic
940256061 2:151730481-151730503 TTTCAGATGTGTAAGGAGAGAGG + Intronic
942511306 2:176705066-176705088 TTATATATGAATAAGGTGGTTGG + Intergenic
942652541 2:178183806-178183828 TTTTATATGTATAAGGCAACTGG + Intergenic
943341122 2:186683459-186683481 TTTTACATTTAAAAGGAGGATGG + Intergenic
943698259 2:190960250-190960272 TTTGATATGTATTAGGAGTTTGG + Intronic
944312137 2:198245245-198245267 ATTTATATGTAAAAGGAATGTGG + Intronic
944757988 2:202783888-202783910 ATTTATATGTATATGATGGGGGG + Intronic
947737202 2:232461927-232461949 TTTTTTAAAAATAAGGAGGGAGG + Intergenic
1168786896 20:547317-547339 AGTCATGTGTATAAGGAGGGTGG + Intergenic
1169322075 20:4641088-4641110 TGTTATATGTGGAAGGGGGGGGG + Intergenic
1171520015 20:25768653-25768675 TTTTAGAGGTTTAAGGAGGAAGG - Intronic
1171556904 20:26087840-26087862 TTTTAGAGGTTTAAGGAGGAAGG + Intergenic
1172964402 20:38823926-38823948 TTTTTTATTTTTAAGGAGAGGGG + Intronic
1174897387 20:54464921-54464943 TTATATATGTAGAATGATGGCGG - Intergenic
1174994421 20:55550145-55550167 TTTTATATGTACAAGGACGTGGG - Intergenic
1176206341 20:63890655-63890677 TTTTATATGTATATAGATGAGGG + Exonic
1176654148 21:9574940-9574962 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1178014846 21:28332551-28332573 TTTTATATGTGTAAAGAGAGAGG - Intergenic
1178803830 21:35821903-35821925 TTTTATATATATAAAGAGACTGG - Intronic
1180922769 22:19530314-19530336 TTTTAAAAGTATTAGGTGGGTGG - Intergenic
1181438949 22:22925875-22925897 TTTTATGTGGCTAAGGAGTGAGG + Intergenic
1182440265 22:30359252-30359274 TTTTATGTCTCCAAGGAGGGAGG - Intronic
950227486 3:11247799-11247821 GTTTATCTGAATAAGGTGGGGGG + Intronic
952145639 3:30528970-30528992 TTTTAAATGTATTGGGAAGGTGG - Intergenic
952167594 3:30768039-30768061 TGTTATAAGGATAAGGGGGGGGG - Intronic
954345965 3:49999555-49999577 TTTTTTATATATGGGGAGGGAGG + Intronic
955052642 3:55427457-55427479 TTTTATAGGTAGAAGAAGTGAGG - Intergenic
957183564 3:76913096-76913118 TTTTAAATTAATAAGGTGGGAGG + Intronic
957671107 3:83303856-83303878 TTTTGTATGTACAGGGAGTGAGG - Intergenic
957731102 3:84137411-84137433 TTTTATTTATATAATGAGAGGGG + Intergenic
958528865 3:95297958-95297980 TTTTATATGTGGAAGGTGTGAGG + Intergenic
959139480 3:102468550-102468572 TATCATTTGTTTAAGGAGGGAGG + Intronic
959517336 3:107283788-107283810 TTTTGTTTGTATAAGAAGGCTGG - Intergenic
959561167 3:107783283-107783305 TTTTATATCTATAATTTGGGGGG + Intronic
959723484 3:109517861-109517883 ATATATATGTATCAGCAGGGAGG - Intergenic
960789597 3:121413870-121413892 TCTTATTTGTAAAATGAGGGGGG - Intronic
961096889 3:124164955-124164977 TTATATTTGTAAAATGAGGGGGG + Intronic
962033225 3:131623379-131623401 TTTTTTATTTTTGAGGAGGGAGG - Intronic
963523515 3:146386720-146386742 TTATATATGTAGAAAGTGGGTGG + Intergenic
964961423 3:162432554-162432576 TTTTATATATAGAAAGAGAGAGG - Intergenic
965618900 3:170622809-170622831 TAGCATATGTAAAAGGAGGGAGG - Intronic
965906624 3:173715547-173715569 ATTTCTATGTATCAGGAGGAAGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967527159 3:190508302-190508324 TTTTAAATGGAGAATGAGGGAGG - Intergenic
968592754 4:1467034-1467056 TATTATAGTTATAATGAGGGCGG - Intergenic
968979264 4:3837808-3837830 TGTTTTATAGATAAGGAGGGTGG - Intergenic
970485118 4:16517332-16517354 TTTTATGTGTATGTGGAGTGGGG - Intronic
970602891 4:17654353-17654375 TTTTATATATATATAGAGGGAGG + Intronic
970827903 4:20299116-20299138 TTTTATATATATAAGCAAGCAGG + Intronic
972857665 4:43126748-43126770 TTCTCTATGTATAAGGAGAATGG + Intergenic
973154614 4:46935331-46935353 TTATATATTTATTAGGAGGAAGG - Intronic
974007593 4:56574244-56574266 TTTTATATTTGTACGGATGGGGG - Intronic
974046548 4:56903504-56903526 TTTTATATGTAAAAGGAGACAGG - Intergenic
975673923 4:76808328-76808350 TTTTGTATTTATAAAGACGGGGG + Intergenic
976254009 4:83082064-83082086 TTTTATTTTTTTAAGGAGGGGGG + Intergenic
976392744 4:84522676-84522698 TTTTATATGTAGAAGGGGCTTGG - Intergenic
976981422 4:91236173-91236195 TTTTATATGTACAATGAGGCTGG - Intronic
977103680 4:92852146-92852168 TTTTCTCTGTATGTGGAGGGGGG + Intronic
977344833 4:95804453-95804475 TTCTATTTGTAAAAGGAGGTGGG + Intergenic
978740558 4:112132959-112132981 TATTATATGTATAATGTAGGGGG - Intergenic
982582570 4:157197607-157197629 CTTTATATATATAAGGATAGAGG + Intergenic
983868170 4:172792849-172792871 ATTTATATAGATAAAGAGGGAGG - Intronic
984379522 4:178972861-178972883 TTTTCTATCCATAAGGAGGAAGG - Intergenic
984529820 4:180902351-180902373 TTCTGTATGTTTAAGGAGAGGGG - Intergenic
984709639 4:182874339-182874361 TTATACAAGTATAATGAGGGAGG - Intergenic
985163766 4:187070994-187071016 ATTTATATGTAAATGGAGGTTGG - Intergenic
985638096 5:1049840-1049862 TTTAATTTATATAAGGATGGAGG - Intergenic
986602621 5:9488245-9488267 TTTTACATGTCCAAGGAAGGAGG - Intronic
986870043 5:12035367-12035389 TTTTATATGTATGTTGAGTGGGG + Intergenic
989480207 5:41922252-41922274 TTTTATATATATTTTGAGGGAGG - Intergenic
991574139 5:68085094-68085116 TTTTATATGGAAAAGGAAAGAGG + Intergenic
991575047 5:68093887-68093909 TTTTATATGTATATAAAGTGAGG + Intergenic
991655403 5:68899119-68899141 TTTTCAGTGGATAAGGAGGGTGG - Intergenic
992513500 5:77466391-77466413 TTTTATTTGTATAGTGATGGTGG + Intronic
993640048 5:90391618-90391640 TTTTTTTTGTAAAAAGAGGGAGG - Intergenic
993958973 5:94273022-94273044 TCCTATATGGATAAGCAGGGTGG + Intronic
994504466 5:100624064-100624086 TTTTATATTTATAATGATGTTGG + Intergenic
996349540 5:122523185-122523207 ATTTGTATTTATAAGGAAGGAGG - Intergenic
997888642 5:137655376-137655398 TTTTTTGTGTGTAAGGAGTGAGG - Intronic
998239900 5:140431137-140431159 TTTTAAAGTTATAAAGAGGGTGG + Intronic
998704311 5:144741076-144741098 GTATATATATATATGGAGGGAGG - Intergenic
999226991 5:150033788-150033810 GTTTATTTGTATATGGAGAGAGG + Intronic
999353086 5:150895952-150895974 TCTTTTATGTATAATGAGGTGGG + Exonic
999434884 5:151555761-151555783 TTTTAAAAGTATCAGGAGGGGGG - Intronic
999895155 5:156024671-156024693 TTTTATAAGGATAAAGAGGCTGG + Intronic
1001042872 5:168349354-168349376 TTCTATAGTTATAAGGTGGGGGG - Intronic
1003217707 6:4129960-4129982 TTTTATAAGTATAGGGAGAAAGG - Intronic
1007137830 6:39539915-39539937 TTTTACATGTATCAGGATGAAGG - Intronic
1007896368 6:45364491-45364513 TTTTGTCTGTATAAGGTGGGGGG - Intronic
1008064422 6:47032162-47032184 TTTTATTTTTTTAAGGAGGAGGG - Intronic
1008784384 6:55148379-55148401 TTTTAGATGAATAATGTGGGAGG - Intronic
1009855059 6:69251548-69251570 TTTTAAATCTAGAAGTAGGGAGG + Intronic
1012360447 6:98371288-98371310 TTTTATAGATTTAAGGAGGTGGG - Intergenic
1012802116 6:103843601-103843623 TTGTGTAAGTATAGGGAGGGTGG + Intergenic
1012978588 6:105806320-105806342 TTGTATGTGTGTAAGGAGGAAGG - Intergenic
1013277519 6:108600020-108600042 TTTTATATGTATAAGGAGGGTGG + Intronic
1014535942 6:122612948-122612970 TGTTATATGTATATAGAGAGAGG + Intronic
1014888007 6:126805616-126805638 TTTTCTATTTATAGGGATGGGGG + Intergenic
1015878290 6:137845902-137845924 TGTTTTCTGTATAAGGAGGCTGG + Intergenic
1016300491 6:142625079-142625101 TATTATATGAATAAAGAGAGTGG - Intergenic
1016717939 6:147255527-147255549 TGTTTTTTGTTTAAGGAGGGAGG + Intronic
1019876674 7:3818142-3818164 TTTTAAATGTACAAAGATGGGGG + Intronic
1021423429 7:20471495-20471517 CCTTAGATGTATATGGAGGGTGG - Intergenic
1021817178 7:24458801-24458823 TTTAATATTTATAACAAGGGTGG + Intergenic
1021958106 7:25846683-25846705 TTTTATATCAATAAGGAAAGTGG - Intergenic
1021960321 7:25864707-25864729 TTTTCTATGTATTAGTAGTGAGG + Intergenic
1024173247 7:46811483-46811505 TTTTATCTGTCTGAGGAGAGAGG + Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1025280500 7:57623614-57623636 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1025304231 7:57841893-57841915 TTTTAGAGGTTTAAGGAGGAAGG + Intergenic
1025916226 7:65868280-65868302 TTTTATTTGTATAGAGATGGGGG - Intergenic
1026213192 7:68324875-68324897 ATTAATCTGTATATGGAGGGAGG - Intergenic
1027650270 7:80858163-80858185 AGTTATTTGTATAAGGAGGAAGG + Intronic
1029693473 7:102197917-102197939 TTTTATCTTTTTACGGAGGGTGG - Intronic
1030261329 7:107567391-107567413 TTTTATATCTATAAAAATGGTGG + Intronic
1030852366 7:114505815-114505837 TATTTTATGTATAAGGGCGGGGG + Intronic
1031247898 7:119340498-119340520 TTTAAATTGTATAAGGAAGGTGG - Intergenic
1032548583 7:132763469-132763491 TTTTGTATATAAAGGGAGGGAGG - Intergenic
1034015607 7:147581893-147581915 ATTTATATGTATAAATAGGCAGG - Intronic
1035994262 8:4528320-4528342 TTTTATAGGAATAAAGAAGGTGG + Intronic
1038771634 8:30487622-30487644 TTTTATATGTAAAATAAGTGAGG + Intronic
1042587588 8:70358579-70358601 TTTTATATATAGAATGAGGTGGG - Intronic
1043020568 8:74994661-74994683 TTTTCTGTTTTTAAGGAGGGAGG - Intronic
1044819097 8:96144050-96144072 TTTTACATGTGTAAAGAAGGTGG - Exonic
1045847622 8:106657302-106657324 TTTTTTATGTTTAAGGACGGCGG - Intronic
1051087279 9:13364350-13364372 TTTCATGTGTTAAAGGAGGGAGG + Intergenic
1051320137 9:15894469-15894491 ATTTAGCTGTATAAGAAGGGAGG - Intronic
1052027607 9:23591075-23591097 TTTGATAGGCATAAGGAAGGAGG + Intergenic
1053219525 9:36300298-36300320 TTTTATATATATACAGATGGGGG + Intronic
1055421478 9:76147973-76147995 TTTTAGCTGTGAAAGGAGGGAGG - Intronic
1056245908 9:84695121-84695143 TGATCTATCTATAAGGAGGGAGG + Intronic
1056378086 9:86033932-86033954 TTTTATATGTGTATGCAGGCTGG + Intronic
1057767016 9:97930152-97930174 TTTTATATGTCTCAGTAGAGAGG + Exonic
1058312634 9:103523962-103523984 TTTTATTTGTATAAGATGTGGGG + Intergenic
1203631871 Un_KI270750v1:78398-78420 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1185871452 X:3668121-3668143 TTTTCTATGTATGAAAAGGGAGG - Intronic
1186428889 X:9487565-9487587 TTTTAAATGTAATTGGAGGGAGG - Intronic
1186613963 X:11167044-11167066 TTTCATACGTATAAGGAGTAAGG + Intronic
1186876064 X:13819396-13819418 TTCTATATGTAGAAGTAGGATGG + Intronic
1187156246 X:16722737-16722759 TTGTAAATTTATCAGGAGGGAGG - Intronic
1187842318 X:23501570-23501592 TTTTATATGTAAAGGTAGAGGGG - Intergenic
1188114106 X:26222970-26222992 TTTTATATATATAAAGAAGTGGG - Intergenic
1189041775 X:37549306-37549328 TTTACTATATATAAGGAGAGAGG - Intronic
1189495781 X:41507540-41507562 TTTTTTATGTATCATGAGGTAGG + Intergenic
1192384668 X:70655079-70655101 TTTTGTATGTATAAGTAGTATGG + Intronic
1193364142 X:80610263-80610285 TCTTATAGGGATAAGGAAGGTGG - Intergenic
1194541792 X:95182175-95182197 TTTTTTATGAATAAAGAGGCTGG + Intergenic
1194979717 X:100427979-100428001 TATTATAATTATAAGGAGGTAGG - Intergenic
1195329862 X:103788030-103788052 TTTTCTTAGTGTAAGGAGGGTGG + Intronic
1195388222 X:104333762-104333784 TTTTGTTTGTTTAAGAAGGGAGG + Intergenic
1195711998 X:107780338-107780360 ATTAATATATATAAGGAGGTTGG - Intronic
1196205498 X:112934954-112934976 GTTTATATGAATAAGAAGTGGGG - Intergenic
1197965626 X:132057560-132057582 TTTTATGTATATGTGGAGGGAGG + Intergenic
1199229491 X:145419641-145419663 TTTTATATGGTTTAGGAGGAGGG + Intergenic
1199368275 X:147014744-147014766 TTTTATATGTTGAAGGACAGAGG - Intergenic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1200792659 Y:7313570-7313592 TTTTCTATGTATGAAAAGGGAGG + Intergenic
1201304677 Y:12540655-12540677 TTTTATATGTTTAATGGTGGGGG - Intergenic
1201758617 Y:17515568-17515590 TTTTATCTGTGTGATGAGGGTGG + Intergenic
1201842938 Y:18390422-18390444 TTTTATCTGTGTGATGAGGGTGG - Intergenic