ID: 1013283026

View in Genome Browser
Species Human (GRCh38)
Location 6:108656479-108656501
Sequence TTTCCTGGAAGGGGCCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013283020_1013283026 9 Left 1013283020 6:108656447-108656469 CCTCTGAAATACTTTTTTAAAGT 0: 1
1: 2
2: 5
3: 64
4: 723
Right 1013283026 6:108656479-108656501 TTTCCTGGAAGGGGCCGCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013283026 Original CRISPR TTTCCTGGAAGGGGCCGCCC TGG Intronic
900130974 1:1087135-1087157 TTACCAGGATGTGGCCGCCCGGG + Exonic
901869124 1:12127152-12127174 CTGCCTTGAAGGGGCTGCCCAGG - Intronic
903059640 1:20661088-20661110 TTTCCTGGAGCAGGCCGCCCGGG - Intronic
903647127 1:24902394-24902416 TGGCCTGGAAGGGCCCGCTCTGG + Exonic
905202590 1:36324051-36324073 TTGCCTGGAAGGGGCCTCCTAGG - Exonic
905792838 1:40799370-40799392 TTTCCAGGAAGGGGTGGCCCAGG - Intronic
908806785 1:67940034-67940056 AGTCCTGGATGGGGCCGGCCTGG - Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
916152134 1:161804503-161804525 TTTCCTGGAAGATGGCTCCCAGG - Intronic
918113960 1:181481966-181481988 TCTCCTGGAAGGGCCCTCCATGG - Intronic
919451182 1:197775078-197775100 TGGCCTGGGAGGGGCCGCCGAGG + Intronic
920008871 1:202853320-202853342 TTTCCTGGAAGGGTCTGTACAGG + Intergenic
920183945 1:204149122-204149144 TTTACTGGGAGGGGCTCCCCAGG + Intronic
921292382 1:213670663-213670685 TTGCCTGGCAGGTGCAGCCCAGG - Intergenic
921677015 1:217987569-217987591 TTTCCTGGAACTGGCCATCCAGG + Intergenic
1063189219 10:3678432-3678454 TTTCCTGGAAGGGTGGGCTCTGG - Intergenic
1063958012 10:11283708-11283730 TGTCCTGGAGGGGGACTCCCTGG + Intronic
1067682766 10:48450925-48450947 TTCCCTGGACGGGGCGGCCGTGG - Exonic
1070748304 10:78948469-78948491 TTTCATAGAAAGGGCCTCCCAGG - Intergenic
1070768597 10:79069952-79069974 GTGCCTGGACGGGGCTGCCCCGG + Intronic
1072614930 10:97043064-97043086 ATTCCTGGAAGAGGCAGGCCAGG + Exonic
1072660183 10:97359047-97359069 CTTTCTGGAGGGGGCTGCCCTGG - Intronic
1073462842 10:103676522-103676544 CTGCCTAGAAGGGGCTGCCCTGG + Intronic
1076361787 10:129894696-129894718 TTTTCTGGAAGAGTCTGCCCTGG - Intronic
1076888132 10:133271846-133271868 GTTCCTGGCAGCGGCAGCCCTGG + Exonic
1077269096 11:1666640-1666662 GTCCCCGGATGGGGCCGCCCCGG + Intergenic
1077271451 11:1684074-1684096 GTCCCCGGATGGGGCCGCCCCGG - Intergenic
1077413435 11:2413898-2413920 GTTCCTGGAAGGCGCCCACCTGG - Intronic
1077634791 11:3835009-3835031 TTTCCTGGAAGAGGCAGCAATGG - Intronic
1078594456 11:12674584-12674606 GTGCCTGGACGCGGCCGCCCCGG - Exonic
1080497053 11:32830212-32830234 TTACCTGGAAGGGGCCACCTCGG + Intronic
1080887211 11:36377524-36377546 TTTCCTTGAGGCCGCCGCCCGGG + Intronic
1084389011 11:68862697-68862719 GTTCCTGGAGGGGCCAGCCCAGG + Intergenic
1089651719 11:119918860-119918882 CTTTCTGGAAGGGGTAGCCCTGG - Intergenic
1091407687 12:219515-219537 TCTCCAGGAAGGGGCAGCCAAGG + Intergenic
1091743051 12:2973748-2973770 TTTTCTGGATGGGGCCAGCCCGG - Intronic
1092849329 12:12612372-12612394 TTTCCAGGAAGGGCCCTCTCTGG + Intronic
1094007887 12:25774732-25774754 TTCCCTGGAAGGGGCTCCTCAGG - Intergenic
1096022942 12:48337349-48337371 TTTCCTGGAAGAGGATGCCCAGG + Exonic
1096156201 12:49342657-49342679 TTCCCTAGGAGGGGTCGCCCTGG - Intergenic
1101898228 12:108771384-108771406 CTTCCTGGAAGAGGCAGCTCTGG + Intergenic
1102207628 12:111101234-111101256 CTTCCTGGAAGGTGCATCCCAGG - Intronic
1105425279 13:20289126-20289148 CTTCCTGGAGGGGGAGGCCCAGG - Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1106602112 13:31197097-31197119 TGACTTGGAAGGGGCCTCCCAGG - Intergenic
1112280612 13:98059671-98059693 TTTACTGTTAGGAGCCGCCCAGG + Intergenic
1114661361 14:24347265-24347287 TTTCCTGGAAGGGTGACCCCAGG - Intergenic
1118984066 14:70738531-70738553 TTTCCTGGAAGGGTCCACTTGGG - Intronic
1126865905 15:52936464-52936486 TTCCCTCGAAGGGGCAGACCAGG - Intergenic
1130899989 15:88199885-88199907 TTTCTTGGAAGTGGTGGCCCAGG - Intronic
1131062203 15:89411103-89411125 TTTCCTGGAAGGCAGCGCCAGGG - Intergenic
1131110243 15:89760361-89760383 GTCCTTGGAAGGGGCTGCCCTGG - Intergenic
1132602130 16:778127-778149 TTTCCTGGACGGCCCCGCACAGG + Intronic
1132616045 16:841626-841648 GTTCCTGCATGGGGCTGCCCAGG + Intergenic
1132837787 16:1963117-1963139 TGTCCTGGAGGGGGCTGCGCTGG - Intronic
1133220613 16:4317676-4317698 TGTCCTGGGAGGGGCCTCCCAGG - Intronic
1133502863 16:6381971-6381993 TTTCCTGTAAAGGGCCACACAGG + Intronic
1138915424 16:61457820-61457842 TTTCCTGGAAGGGGTGGCGGGGG - Intergenic
1139954234 16:70685740-70685762 TGGCCTGGAAGAGCCCGCCCAGG + Exonic
1141609069 16:85170999-85171021 GATCCTGGAGGGGACCGCCCGGG - Intergenic
1142113542 16:88344757-88344779 GTTCCTGGGAGGGGCCGCTATGG + Intergenic
1145790046 17:27620891-27620913 TTTCCTCGAAGGGGCTGGGCAGG - Intronic
1151249427 17:72822065-72822087 TTTGTTGGATGTGGCCGCCCAGG - Intronic
1151939072 17:77281506-77281528 TTTCCTGGGAGCGGCGGCCACGG + Exonic
1152590248 17:81208257-81208279 TTCCCAGGAAGGGTCCACCCGGG + Intronic
1153920650 18:9786259-9786281 TTTCCTGGAAAGTGGCGCCCAGG + Intronic
1160709107 19:542623-542645 GTTCCTGGAAGGCGGTGCCCCGG - Intergenic
1160901744 19:1432322-1432344 TTTCCTGGGGGGAGCGGCCCGGG + Intronic
1161055437 19:2188546-2188568 TTCTCTGGGAGGGGCCGTCCTGG + Intronic
1161159309 19:2753048-2753070 TTCTCTGGAGGGGGCCGTCCTGG + Intergenic
1161548305 19:4895827-4895849 TCTCCTGGGTGGGGCCGTCCTGG + Intronic
1162135340 19:8551853-8551875 GCTGCTGGAAGGGGCCTCCCAGG - Exonic
1168179816 19:54654120-54654142 TATCCTTGAAGGCGCTGCCCCGG - Intronic
925922032 2:8644854-8644876 CTTCCTGGAAGCGTCCTCCCAGG + Intergenic
932014603 2:68011618-68011640 GTTCCTGGAGGGTGGCGCCCAGG - Intergenic
932495156 2:72142512-72142534 TTTCATGGAAGGGGCCACTGAGG - Intronic
932563001 2:72888675-72888697 TTTCCTGGAGGGGGCGGACTAGG - Intronic
934714818 2:96537346-96537368 TTTCCTGAAAGGGGCTGCGCGGG + Intronic
937991335 2:127664085-127664107 TCTCCTGGCAGGGTGCGCCCAGG - Intronic
938114542 2:128594417-128594439 CTTCCTGGAAGGGGCCACTGAGG - Intergenic
938727407 2:134120539-134120561 TCCCCTGGGAGGGGCTGCCCGGG - Intronic
1169384189 20:5134134-5134156 TTTCCTGGGAGTGGCCACTCTGG + Intronic
1172794138 20:37525507-37525529 TTTCCAGGCAAGGGCTGCCCTGG + Intronic
1172797057 20:37547503-37547525 GTTCCTGGAGGGTGGCGCCCTGG - Intergenic
1175714314 20:61245504-61245526 TTTCCAGTAAGGGGCCACCTTGG - Intergenic
1179842284 21:44084950-44084972 GTTCCTGGAGGGTGGCGCCCAGG - Intronic
1181169090 22:20998291-20998313 TCCCCTGGAAGGGGCCAGCCTGG - Exonic
1181286077 22:21753557-21753579 TTCCATGGAAGGGGCTTCCCGGG + Intergenic
1181514037 22:23401546-23401568 TGTCCTGGAAGGGGCTGGCACGG - Intergenic
1181559535 22:23692171-23692193 TGTCCTGGAAGGGGCAGACCTGG - Exonic
1182091285 22:27596650-27596672 TTTCCACGAAGCGGCCTCCCAGG + Intergenic
1183314387 22:37128958-37128980 CTTCCTGGATGGGGCAGCCCTGG - Intronic
1184109201 22:42385096-42385118 TTTGGTGGCAGGGGCTGCCCCGG + Exonic
1184640921 22:45869620-45869642 TTGACAGGAAGGGTCCGCCCAGG - Intergenic
1184656479 22:45944403-45944425 TTCCCGGGGAGGGGCAGCCCCGG + Intronic
953011205 3:39027074-39027096 ATTCCTGGAAGTGGCCTCCATGG - Intergenic
953916160 3:46922416-46922438 GTTGCTGGAGGGGGCTGCCCTGG + Intronic
954874263 3:53791146-53791168 TTGCTTGGAAGGGGTCTCCCTGG - Intronic
956744852 3:72303235-72303257 TTTCCTGGAGAGGGCTGCCAAGG + Intergenic
962271434 3:133980542-133980564 TCTCCTGGAAGGCGCCCCTCTGG + Intronic
967866607 3:194195122-194195144 TATTCTGCAAGGGGCTGCCCTGG + Intergenic
968079634 3:195836989-195837011 TTTCCTGGGAGCAGCCTCCCAGG + Intergenic
968516555 4:1017996-1018018 TCTTCTGGAAGGGCCCGTCCTGG - Intronic
969349943 4:6592623-6592645 AATGCTGGAAGGGGCTGCCCAGG + Intronic
969438431 4:7201979-7202001 TTTCTTGGAAAGCGCCGTCCTGG + Intronic
969459579 4:7321903-7321925 TTACCTGCAAGGGGCAGCCATGG + Intronic
969521183 4:7678575-7678597 TTTCCTGGAAGAGGCTGAGCAGG + Intronic
971247672 4:24945024-24945046 TGTCCTAGAAGGGGCTGCACAGG - Intronic
971372326 4:26029000-26029022 TCCCCTGGAAGGGGCGTCCCAGG + Intergenic
976786840 4:88831181-88831203 TTTCCTGGAATGGGACTCTCTGG + Intronic
984892927 4:184509501-184509523 ATACCTGGAAGGGGCTGCCGAGG - Intergenic
985795956 5:1962263-1962285 TTTCCTAGAAGGCGCCCACCTGG + Intergenic
986451413 5:7869270-7869292 TCTCCTGGGAGAGGCGGCCCGGG + Intronic
992151544 5:73909501-73909523 GGTCCTGCAAGGGGCCGCCTCGG - Exonic
997267270 5:132502147-132502169 TTTCTGGGAAGTGGCTGCCCAGG - Intergenic
1001520163 5:172385644-172385666 CTGCCTGGAGGGGGCCTCCCAGG + Intronic
1001536995 5:172504981-172505003 TTTCCTGGAAGGGGCTGGATTGG + Intergenic
1002342747 5:178527506-178527528 TTTCCAGGAAGCGGCTGGCCCGG + Intronic
1002431670 5:179207704-179207726 TCTCCTTGCAGGGGCCTCCCTGG - Exonic
1004520722 6:16358878-16358900 CTTCCTGGAATGGGAGGCCCAGG - Intronic
1006799003 6:36747777-36747799 TTACCTGGCTGGGGCTGCCCTGG - Intronic
1007473320 6:42104530-42104552 GTCCCTGGAGGGCGCCGCCCGGG - Exonic
1013283026 6:108656479-108656501 TTTCCTGGAAGGGGCCGCCCTGG + Intronic
1018995041 6:168704104-168704126 TTTCCTGGAAAGGGGCATCCTGG + Intergenic
1019750355 7:2725298-2725320 TCTCCTAGAAGGGGCTGCCCTGG + Intronic
1020074501 7:5248784-5248806 TGGCCTGGAAGGGGCTGCTCTGG - Intergenic
1022467351 7:30660752-30660774 TTTCTGGGAAGGGGCAGTCCTGG - Intronic
1025204601 7:56985023-56985045 TGGCCTGGAAGGGGCTGCTCTGG + Intergenic
1025667336 7:63591912-63591934 TGGCCTGGAAGGGGCTGCTCTGG - Intergenic
1029207373 7:98878033-98878055 CTTTCTGGAAGTGGCCGCCCAGG - Intronic
1029339159 7:99929164-99929186 TGTCCTGGAGGGGGCAGCCCTGG - Exonic
1035733449 8:1869868-1869890 TTTGCTGGACGTGGCCGCTCAGG - Intronic
1035881200 8:3245588-3245610 TTTCCTGGAAGGGGTAGGCATGG - Intronic
1036256743 8:7212432-7212454 CTTCCTGGAAGGGCCTGGCCAGG - Intergenic
1036308793 8:7671034-7671056 CTTCCTGGAAGGGCCTGGCCAGG - Intergenic
1036360748 8:8075077-8075099 CTTCCTGGAAGGGCCTGGCCAGG + Intergenic
1036587483 8:10137754-10137776 TTACCTGGAAGGGGCAGGGCAGG - Intronic
1036890220 8:12591895-12591917 CTTCCTGGAAGGGCCTGGCCAGG - Intergenic
1038492674 8:27981905-27981927 TTTCCTGGGAGGGGCTGGCTGGG - Intronic
1039967502 8:42293803-42293825 TTTCCTGGAATGGCCGGCGCTGG + Intronic
1044701432 8:94968657-94968679 TTTCCTGGAAGGTTCTGCACAGG + Intronic
1049099415 8:140568493-140568515 TGACCTGGACGGGGCCTCCCTGG + Intronic
1049265649 8:141666595-141666617 CTCCCTGGAAGGGGCCACCCAGG + Intergenic
1049536376 8:143184293-143184315 TGTCCTGGAAGGGCCACCCCAGG + Intergenic
1056054421 9:82806091-82806113 ATTCCTGGCAGAGGCTGCCCTGG - Intergenic
1060041016 9:120301180-120301202 TCTCCTGGAAGAGGTGGCCCTGG + Intergenic
1062105218 9:134751441-134751463 GCTCCTGGAAGGGGCTGCCTGGG + Intronic
1062397333 9:136357770-136357792 TTTCCTGGGCGGGCCTGCCCTGG + Intronic
1185750838 X:2608962-2608984 GCTCCAGGTAGGGGCCGCCCTGG + Intergenic
1199002988 X:142662727-142662749 TGTGATGGAAGGGGCTGCCCTGG - Intergenic