ID: 1013289523

View in Genome Browser
Species Human (GRCh38)
Location 6:108708397-108708419
Sequence CTCCTGATGTCTAGTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013289523_1013289530 12 Left 1013289523 6:108708397-108708419 CCTGAGACACTAGACATCAGGAG No data
Right 1013289530 6:108708432-108708454 GCAAAAGCACACTGAAGCCAGGG No data
1013289523_1013289529 11 Left 1013289523 6:108708397-108708419 CCTGAGACACTAGACATCAGGAG No data
Right 1013289529 6:108708431-108708453 AGCAAAAGCACACTGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013289523 Original CRISPR CTCCTGATGTCTAGTGTCTC AGG (reversed) Intergenic
No off target data available for this crispr