ID: 1013289530

View in Genome Browser
Species Human (GRCh38)
Location 6:108708432-108708454
Sequence GCAAAAGCACACTGAAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013289523_1013289530 12 Left 1013289523 6:108708397-108708419 CCTGAGACACTAGACATCAGGAG No data
Right 1013289530 6:108708432-108708454 GCAAAAGCACACTGAAGCCAGGG No data
1013289520_1013289530 17 Left 1013289520 6:108708392-108708414 CCCAACCTGAGACACTAGACATC No data
Right 1013289530 6:108708432-108708454 GCAAAAGCACACTGAAGCCAGGG No data
1013289521_1013289530 16 Left 1013289521 6:108708393-108708415 CCAACCTGAGACACTAGACATCA No data
Right 1013289530 6:108708432-108708454 GCAAAAGCACACTGAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013289530 Original CRISPR GCAAAAGCACACTGAAGCCA GGG Intergenic
No off target data available for this crispr