ID: 1013290879

View in Genome Browser
Species Human (GRCh38)
Location 6:108717693-108717715
Sequence CTGCAGCCACAGTGGGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013290879_1013290884 4 Left 1013290879 6:108717693-108717715 CCCCGCTCCCACTGTGGCTGCAG No data
Right 1013290884 6:108717720-108717742 TTTGCAGTGACCTTGATGCGTGG No data
1013290879_1013290885 10 Left 1013290879 6:108717693-108717715 CCCCGCTCCCACTGTGGCTGCAG No data
Right 1013290885 6:108717726-108717748 GTGACCTTGATGCGTGGCCTTGG No data
1013290879_1013290887 17 Left 1013290879 6:108717693-108717715 CCCCGCTCCCACTGTGGCTGCAG No data
Right 1013290887 6:108717733-108717755 TGATGCGTGGCCTTGGTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013290879 Original CRISPR CTGCAGCCACAGTGGGAGCG GGG (reversed) Intergenic
No off target data available for this crispr