ID: 1013290887

View in Genome Browser
Species Human (GRCh38)
Location 6:108717733-108717755
Sequence TGATGCGTGGCCTTGGTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013290883_1013290887 9 Left 1013290883 6:108717701-108717723 CCACTGTGGCTGCAGTTTCTTTG No data
Right 1013290887 6:108717733-108717755 TGATGCGTGGCCTTGGTCAGCGG No data
1013290879_1013290887 17 Left 1013290879 6:108717693-108717715 CCCCGCTCCCACTGTGGCTGCAG No data
Right 1013290887 6:108717733-108717755 TGATGCGTGGCCTTGGTCAGCGG No data
1013290881_1013290887 15 Left 1013290881 6:108717695-108717717 CCGCTCCCACTGTGGCTGCAGTT No data
Right 1013290887 6:108717733-108717755 TGATGCGTGGCCTTGGTCAGCGG No data
1013290882_1013290887 10 Left 1013290882 6:108717700-108717722 CCCACTGTGGCTGCAGTTTCTTT No data
Right 1013290887 6:108717733-108717755 TGATGCGTGGCCTTGGTCAGCGG No data
1013290880_1013290887 16 Left 1013290880 6:108717694-108717716 CCCGCTCCCACTGTGGCTGCAGT No data
Right 1013290887 6:108717733-108717755 TGATGCGTGGCCTTGGTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013290887 Original CRISPR TGATGCGTGGCCTTGGTCAG CGG Intergenic
No off target data available for this crispr