ID: 1013291215

View in Genome Browser
Species Human (GRCh38)
Location 6:108720282-108720304
Sequence ATGCTCCGAAAGTCCAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013291211_1013291215 30 Left 1013291211 6:108720229-108720251 CCAGTTTAAATCTGGTTTCTGAC No data
Right 1013291215 6:108720282-108720304 ATGCTCCGAAAGTCCAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013291215 Original CRISPR ATGCTCCGAAAGTCCAAGGT GGG Intergenic
No off target data available for this crispr