ID: 1013292922

View in Genome Browser
Species Human (GRCh38)
Location 6:108734069-108734091
Sequence CTGTGATTGCACAAGTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013292922_1013292927 14 Left 1013292922 6:108734069-108734091 CCTGGAGACTTGTGCAATCACAG No data
Right 1013292927 6:108734106-108734128 CCCAGAGTTTCTGATTCTGCAGG 0: 9
1: 44
2: 244
3: 709
4: 1405
1013292922_1013292930 23 Left 1013292922 6:108734069-108734091 CCTGGAGACTTGTGCAATCACAG No data
Right 1013292930 6:108734115-108734137 TCTGATTCTGCAGGTTTGGAAGG No data
1013292922_1013292931 24 Left 1013292922 6:108734069-108734091 CCTGGAGACTTGTGCAATCACAG No data
Right 1013292931 6:108734116-108734138 CTGATTCTGCAGGTTTGGAAGGG No data
1013292922_1013292929 19 Left 1013292922 6:108734069-108734091 CCTGGAGACTTGTGCAATCACAG No data
Right 1013292929 6:108734111-108734133 AGTTTCTGATTCTGCAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013292922 Original CRISPR CTGTGATTGCACAAGTCTCC AGG (reversed) Intergenic
No off target data available for this crispr