ID: 1013292925

View in Genome Browser
Species Human (GRCh38)
Location 6:108734101-108734123
Sequence AGAATCAGAAACTCTGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013292925_1013292931 -8 Left 1013292925 6:108734101-108734123 CCTCACCCAGAGTTTCTGATTCT No data
Right 1013292931 6:108734116-108734138 CTGATTCTGCAGGTTTGGAAGGG No data
1013292925_1013292930 -9 Left 1013292925 6:108734101-108734123 CCTCACCCAGAGTTTCTGATTCT No data
Right 1013292930 6:108734115-108734137 TCTGATTCTGCAGGTTTGGAAGG No data
1013292925_1013292933 24 Left 1013292925 6:108734101-108734123 CCTCACCCAGAGTTTCTGATTCT No data
Right 1013292933 6:108734148-108734170 TTGCCTTTTCAACAAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013292925 Original CRISPR AGAATCAGAAACTCTGGGTG AGG (reversed) Intergenic
No off target data available for this crispr