ID: 1013292927 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:108734106-108734128 |
| Sequence | CCCAGAGTTTCTGATTCTGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2411 | |||
| Summary | {0: 9, 1: 44, 2: 244, 3: 709, 4: 1405} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1013292922_1013292927 | 14 | Left | 1013292922 | 6:108734069-108734091 | CCTGGAGACTTGTGCAATCACAG | No data | ||
| Right | 1013292927 | 6:108734106-108734128 | CCCAGAGTTTCTGATTCTGCAGG | 0: 9 1: 44 2: 244 3: 709 4: 1405 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1013292927 | Original CRISPR | CCCAGAGTTTCTGATTCTGC AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||