ID: 1013292927

View in Genome Browser
Species Human (GRCh38)
Location 6:108734106-108734128
Sequence CCCAGAGTTTCTGATTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2411
Summary {0: 9, 1: 44, 2: 244, 3: 709, 4: 1405}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013292922_1013292927 14 Left 1013292922 6:108734069-108734091 CCTGGAGACTTGTGCAATCACAG No data
Right 1013292927 6:108734106-108734128 CCCAGAGTTTCTGATTCTGCAGG 0: 9
1: 44
2: 244
3: 709
4: 1405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013292927 Original CRISPR CCCAGAGTTTCTGATTCTGC AGG Intergenic
Too many off-targets to display for this crispr